ID: 1062273480

View in Genome Browser
Species Human (GRCh38)
Location 9:135720215-135720237
Sequence TCCAGCTGCCCCGCAGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062273467_1062273480 12 Left 1062273467 9:135720180-135720202 CCCCTTCCATTCACCCGACCCTA 0: 1
1: 0
2: 0
3: 13
4: 124
Right 1062273480 9:135720215-135720237 TCCAGCTGCCCCGCAGGGACAGG No data
1062273469_1062273480 10 Left 1062273469 9:135720182-135720204 CCTTCCATTCACCCGACCCTACC 0: 1
1: 0
2: 0
3: 13
4: 308
Right 1062273480 9:135720215-135720237 TCCAGCTGCCCCGCAGGGACAGG No data
1062273471_1062273480 -1 Left 1062273471 9:135720193-135720215 CCCGACCCTACCCCACAGTGAAT 0: 1
1: 0
2: 1
3: 16
4: 177
Right 1062273480 9:135720215-135720237 TCCAGCTGCCCCGCAGGGACAGG No data
1062273468_1062273480 11 Left 1062273468 9:135720181-135720203 CCCTTCCATTCACCCGACCCTAC 0: 1
1: 0
2: 0
3: 10
4: 170
Right 1062273480 9:135720215-135720237 TCCAGCTGCCCCGCAGGGACAGG No data
1062273474_1062273480 -7 Left 1062273474 9:135720199-135720221 CCTACCCCACAGTGAATCCAGCT 0: 1
1: 0
2: 2
3: 19
4: 198
Right 1062273480 9:135720215-135720237 TCCAGCTGCCCCGCAGGGACAGG No data
1062273470_1062273480 6 Left 1062273470 9:135720186-135720208 CCATTCACCCGACCCTACCCCAC 0: 1
1: 1
2: 3
3: 45
4: 502
Right 1062273480 9:135720215-135720237 TCCAGCTGCCCCGCAGGGACAGG No data
1062273465_1062273480 26 Left 1062273465 9:135720166-135720188 CCCTGCTGGATGCACCCCTTCCA 0: 1
1: 0
2: 2
3: 18
4: 196
Right 1062273480 9:135720215-135720237 TCCAGCTGCCCCGCAGGGACAGG No data
1062273473_1062273480 -6 Left 1062273473 9:135720198-135720220 CCCTACCCCACAGTGAATCCAGC 0: 1
1: 0
2: 0
3: 10
4: 186
Right 1062273480 9:135720215-135720237 TCCAGCTGCCCCGCAGGGACAGG No data
1062273472_1062273480 -2 Left 1062273472 9:135720194-135720216 CCGACCCTACCCCACAGTGAATC 0: 1
1: 0
2: 3
3: 22
4: 186
Right 1062273480 9:135720215-135720237 TCCAGCTGCCCCGCAGGGACAGG No data
1062273466_1062273480 25 Left 1062273466 9:135720167-135720189 CCTGCTGGATGCACCCCTTCCAT 0: 1
1: 0
2: 2
3: 9
4: 153
Right 1062273480 9:135720215-135720237 TCCAGCTGCCCCGCAGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062273480 Original CRISPR TCCAGCTGCCCCGCAGGGAC AGG Intronic
No off target data available for this crispr