ID: 1062275337

View in Genome Browser
Species Human (GRCh38)
Location 9:135727738-135727760
Sequence GGATTCTCCGGACAGAGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062275320_1062275337 20 Left 1062275320 9:135727695-135727717 CCAGCCCCTGGGTACTGCTCCTC No data
Right 1062275337 9:135727738-135727760 GGATTCTCCGGACAGAGGTGGGG No data
1062275325_1062275337 1 Left 1062275325 9:135727714-135727736 CCTCCAGCCCCCACTCGCTGGCC No data
Right 1062275337 9:135727738-135727760 GGATTCTCCGGACAGAGGTGGGG No data
1062275315_1062275337 28 Left 1062275315 9:135727687-135727709 CCCGGCCCCCAGCCCCTGGGTAC No data
Right 1062275337 9:135727738-135727760 GGATTCTCCGGACAGAGGTGGGG No data
1062275331_1062275337 -9 Left 1062275331 9:135727724-135727746 CCACTCGCTGGCCTGGATTCTCC No data
Right 1062275337 9:135727738-135727760 GGATTCTCCGGACAGAGGTGGGG No data
1062275323_1062275337 14 Left 1062275323 9:135727701-135727723 CCTGGGTACTGCTCCTCCAGCCC No data
Right 1062275337 9:135727738-135727760 GGATTCTCCGGACAGAGGTGGGG No data
1062275322_1062275337 15 Left 1062275322 9:135727700-135727722 CCCTGGGTACTGCTCCTCCAGCC No data
Right 1062275337 9:135727738-135727760 GGATTCTCCGGACAGAGGTGGGG No data
1062275326_1062275337 -2 Left 1062275326 9:135727717-135727739 CCAGCCCCCACTCGCTGGCCTGG No data
Right 1062275337 9:135727738-135727760 GGATTCTCCGGACAGAGGTGGGG No data
1062275318_1062275337 22 Left 1062275318 9:135727693-135727715 CCCCAGCCCCTGGGTACTGCTCC No data
Right 1062275337 9:135727738-135727760 GGATTCTCCGGACAGAGGTGGGG No data
1062275317_1062275337 23 Left 1062275317 9:135727692-135727714 CCCCCAGCCCCTGGGTACTGCTC No data
Right 1062275337 9:135727738-135727760 GGATTCTCCGGACAGAGGTGGGG No data
1062275328_1062275337 -6 Left 1062275328 9:135727721-135727743 CCCCCACTCGCTGGCCTGGATTC No data
Right 1062275337 9:135727738-135727760 GGATTCTCCGGACAGAGGTGGGG No data
1062275329_1062275337 -7 Left 1062275329 9:135727722-135727744 CCCCACTCGCTGGCCTGGATTCT No data
Right 1062275337 9:135727738-135727760 GGATTCTCCGGACAGAGGTGGGG No data
1062275321_1062275337 16 Left 1062275321 9:135727699-135727721 CCCCTGGGTACTGCTCCTCCAGC No data
Right 1062275337 9:135727738-135727760 GGATTCTCCGGACAGAGGTGGGG No data
1062275330_1062275337 -8 Left 1062275330 9:135727723-135727745 CCCACTCGCTGGCCTGGATTCTC No data
Right 1062275337 9:135727738-135727760 GGATTCTCCGGACAGAGGTGGGG No data
1062275319_1062275337 21 Left 1062275319 9:135727694-135727716 CCCAGCCCCTGGGTACTGCTCCT No data
Right 1062275337 9:135727738-135727760 GGATTCTCCGGACAGAGGTGGGG No data
1062275316_1062275337 27 Left 1062275316 9:135727688-135727710 CCGGCCCCCAGCCCCTGGGTACT No data
Right 1062275337 9:135727738-135727760 GGATTCTCCGGACAGAGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062275337 Original CRISPR GGATTCTCCGGACAGAGGTG GGG Intronic