ID: 1062276616

View in Genome Browser
Species Human (GRCh38)
Location 9:135734302-135734324
Sequence CCGTGCCTGGCTCCAGCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062276606_1062276616 -6 Left 1062276606 9:135734285-135734307 CCAGCCCACCTTCCCCTCCGTGC 0: 1
1: 0
2: 6
3: 54
4: 640
Right 1062276616 9:135734302-135734324 CCGTGCCTGGCTCCAGCCATGGG No data
1062276607_1062276616 -10 Left 1062276607 9:135734289-135734311 CCCACCTTCCCCTCCGTGCCTGG 0: 1
1: 0
2: 2
3: 42
4: 357
Right 1062276616 9:135734302-135734324 CCGTGCCTGGCTCCAGCCATGGG No data
1062276600_1062276616 10 Left 1062276600 9:135734269-135734291 CCCCGAGCCTGGGGCCCCAGCCC 0: 1
1: 0
2: 3
3: 76
4: 642
Right 1062276616 9:135734302-135734324 CCGTGCCTGGCTCCAGCCATGGG No data
1062276604_1062276616 -4 Left 1062276604 9:135734283-135734305 CCCCAGCCCACCTTCCCCTCCGT 0: 1
1: 1
2: 1
3: 65
4: 642
Right 1062276616 9:135734302-135734324 CCGTGCCTGGCTCCAGCCATGGG No data
1062276602_1062276616 8 Left 1062276602 9:135734271-135734293 CCGAGCCTGGGGCCCCAGCCCAC 0: 1
1: 1
2: 10
3: 85
4: 643
Right 1062276616 9:135734302-135734324 CCGTGCCTGGCTCCAGCCATGGG No data
1062276605_1062276616 -5 Left 1062276605 9:135734284-135734306 CCCAGCCCACCTTCCCCTCCGTG 0: 1
1: 0
2: 5
3: 39
4: 407
Right 1062276616 9:135734302-135734324 CCGTGCCTGGCTCCAGCCATGGG No data
1062276603_1062276616 3 Left 1062276603 9:135734276-135734298 CCTGGGGCCCCAGCCCACCTTCC 0: 1
1: 1
2: 9
3: 139
4: 766
Right 1062276616 9:135734302-135734324 CCGTGCCTGGCTCCAGCCATGGG No data
1062276601_1062276616 9 Left 1062276601 9:135734270-135734292 CCCGAGCCTGGGGCCCCAGCCCA 0: 1
1: 1
2: 5
3: 74
4: 676
Right 1062276616 9:135734302-135734324 CCGTGCCTGGCTCCAGCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062276616 Original CRISPR CCGTGCCTGGCTCCAGCCAT GGG Intronic
No off target data available for this crispr