ID: 1062280051

View in Genome Browser
Species Human (GRCh38)
Location 9:135747765-135747787
Sequence ACAAGCCTCCCACAGACCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 188}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062280051_1062280062 18 Left 1062280051 9:135747765-135747787 CCACTGGTCTGTGGGAGGCTTGT 0: 1
1: 0
2: 1
3: 29
4: 188
Right 1062280062 9:135747806-135747828 GAGCCCTGAGTATGCCCGGTGGG No data
1062280051_1062280053 -4 Left 1062280051 9:135747765-135747787 CCACTGGTCTGTGGGAGGCTTGT 0: 1
1: 0
2: 1
3: 29
4: 188
Right 1062280053 9:135747784-135747806 TTGTCCCACTGCCTGGCCCCAGG No data
1062280051_1062280061 17 Left 1062280051 9:135747765-135747787 CCACTGGTCTGTGGGAGGCTTGT 0: 1
1: 0
2: 1
3: 29
4: 188
Right 1062280061 9:135747805-135747827 GGAGCCCTGAGTATGCCCGGTGG No data
1062280051_1062280060 14 Left 1062280051 9:135747765-135747787 CCACTGGTCTGTGGGAGGCTTGT 0: 1
1: 0
2: 1
3: 29
4: 188
Right 1062280060 9:135747802-135747824 CCAGGAGCCCTGAGTATGCCCGG No data
1062280051_1062280063 19 Left 1062280051 9:135747765-135747787 CCACTGGTCTGTGGGAGGCTTGT 0: 1
1: 0
2: 1
3: 29
4: 188
Right 1062280063 9:135747807-135747829 AGCCCTGAGTATGCCCGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062280051 Original CRISPR ACAAGCCTCCCACAGACCAG TGG (reversed) Intronic
901700984 1:11044689-11044711 AGGAGGCTCCCACAGACCTGGGG + Intronic
902256736 1:15194049-15194071 ACAAGCCTGGCACAGGCCAGAGG - Intronic
903255963 1:22100112-22100134 CCAAGCCTCCCTCAGACCTTGGG - Intergenic
904342128 1:29843452-29843474 CTAAGCCTCCCACAGCCCCGTGG + Intergenic
904371226 1:30048621-30048643 ACAAGCCCCCCTCAATCCAGGGG - Intergenic
904681925 1:32235111-32235133 ACCAGACTCCCACCGCCCAGAGG - Intergenic
905207329 1:36350327-36350349 AGAAGGTTCCCACAGAGCAGAGG + Intronic
905311050 1:37049252-37049274 ACAGGCCTCCAACAGACAAGAGG + Intergenic
907092172 1:51735239-51735261 ACAAGGTTCCCACCGGCCAGTGG - Intronic
909712272 1:78665568-78665590 ACAATTTTTCCACAGACCAGTGG + Intergenic
918720780 1:187850130-187850152 CCCAGCCTCCCACAGTGCAGCGG - Intergenic
921242061 1:213194859-213194881 ACAACTCTTCCACAGACTAGTGG - Intronic
924551628 1:245083310-245083332 ACAATTCTTCCACAGACCAGGGG - Intronic
1062863578 10:829985-830007 AGAAGTCTCCCAAAGACCACTGG + Intronic
1065204574 10:23344432-23344454 ACAAGACTCCCACAGCCTGGAGG + Intronic
1069878927 10:71579807-71579829 AGGAGCCTCCCAGTGACCAGGGG + Intronic
1070802419 10:79251413-79251435 ACACGCCTCCCACAAACATGAGG - Intronic
1075121858 10:119670156-119670178 CCCAGCCTCCCACGGACCTGAGG + Exonic
1075269436 10:121035777-121035799 AAAAGGCTCCCACAGTGCAGTGG + Intergenic
1075299250 10:121306819-121306841 AAAGGCCTCACCCAGACCAGGGG + Intergenic
1075880598 10:125847581-125847603 ACAATTTTTCCACAGACCAGAGG + Intronic
1080063409 11:27981568-27981590 ACTGGCCTCCCTCAGCCCAGTGG + Intergenic
1080266751 11:30409154-30409176 ACAAGCCTCCCAGAGATAGGTGG - Intronic
1080466496 11:32502374-32502396 ACAATTTTTCCACAGACCAGGGG - Intergenic
1082823404 11:57560391-57560413 AGAAGCCTCCCCCATACCTGCGG - Exonic
1084325870 11:68399760-68399782 TCAGGCCTCCCCCAGACCTGGGG - Intronic
1084744938 11:71164053-71164075 ACAACCCTCCCAGATGCCAGTGG + Intronic
1084983750 11:72849166-72849188 ACATGCCTCCACCAGAACAGGGG + Intronic
1090704823 11:129326685-129326707 ACAATTTTTCCACAGACCAGGGG + Intergenic
1093104453 12:15069103-15069125 ACAATTTTTCCACAGACCAGGGG - Intergenic
1094501908 12:31029072-31029094 ACAAGCCCCTCAGGGACCAGCGG + Intergenic
1095054291 12:37581691-37581713 ACCAGCCTCTCACAAACCAGAGG - Intergenic
1098924878 12:76338259-76338281 ACACTCCTCCCATAGAGCAGTGG - Intergenic
1099632960 12:85174298-85174320 ATAAGTCTCCCAGAAACCAGAGG + Intronic
1100041643 12:90326470-90326492 ACAAGCCTCCCACTTAGCATAGG + Intergenic
1102018391 12:109663713-109663735 ACAGGCCTGCCACAGAACAGGGG + Intergenic
1104510434 12:129372905-129372927 ACAATTTTTCCACAGACCAGTGG - Intronic
1105893753 13:24700832-24700854 ACAAGAGTCCCACAAAACAGAGG - Exonic
1106800739 13:33253908-33253930 ACAGGCCTGCCACAGACCATGGG + Intronic
1108435019 13:50393460-50393482 ACAATTCTTCCACAGACCAGGGG + Intronic
1111299222 13:86324768-86324790 ACAAGCCTACCAGAGGGCAGAGG - Intergenic
1111546030 13:89737652-89737674 TCAAAGCTCCCACAGACCTGGGG - Intergenic
1112409785 13:99153025-99153047 CCAAGCCACCCACAGTCCTGTGG - Intergenic
1113229377 13:108195532-108195554 ACAGGCCTCCCACACTCCACTGG + Intergenic
1113918498 13:113889441-113889463 ACAATTTTTCCACAGACCAGAGG - Intergenic
1116632861 14:47356424-47356446 ACTGGCCTCCCAGAGACCACTGG - Intronic
1118853907 14:69606437-69606459 ACAAAGCTCCCTCCGACCAGTGG + Intergenic
1119747069 14:77052225-77052247 ACAACCCTGACCCAGACCAGGGG + Intergenic
1120479575 14:85033492-85033514 ACAATTTTTCCACAGACCAGAGG + Intergenic
1122079937 14:99259839-99259861 ACAACCTTCCCACCGAACAGAGG + Intronic
1127132843 15:55885007-55885029 ACAAAACTCCCACAGGTCAGGGG + Intronic
1131055828 15:89374261-89374283 CAAACCCTACCACAGACCAGTGG + Intergenic
1132117708 15:99149672-99149694 ACAACCTGCCCACAGACCACTGG + Intronic
1134215228 16:12311985-12312007 ACACCCTTCCCACAGGCCAGTGG - Intronic
1135300285 16:21320832-21320854 ACAATTTTTCCACAGACCAGTGG + Intergenic
1136074432 16:27807173-27807195 ACTGTCCTCCCTCAGACCAGTGG + Intronic
1138246157 16:55468608-55468630 TCAAGTCTCCCACCGACCTGGGG + Intronic
1139659364 16:68410314-68410336 CCATGCCATCCACAGACCAGGGG + Intronic
1140950751 16:79815184-79815206 AGAAGGCTCCCACAGACTAGTGG + Intergenic
1141506401 16:84481290-84481312 ACAGGCCTACCAGGGACCAGAGG - Intronic
1142050400 16:87954478-87954500 AAAAGCACCCCACAGACCCGGGG - Intronic
1143068403 17:4267860-4267882 ACAAGCTTGCCACAGAAGAGAGG + Intergenic
1144523917 17:15973679-15973701 ACAATGTTTCCACAGACCAGGGG - Intronic
1145013087 17:19380941-19380963 AGATGCAGCCCACAGACCAGAGG - Exonic
1145371580 17:22310927-22310949 GCCAGCCTCTCACAGCCCAGAGG - Intergenic
1145374833 17:22337767-22337789 ACCAGCCTCTCAAAGCCCAGAGG - Intergenic
1149232183 17:54547201-54547223 ACAAGCAGCCCATAGACAAGTGG + Intergenic
1149817739 17:59742940-59742962 ACAAGTTTTCCACAGACCTGAGG - Intronic
1149978054 17:61286403-61286425 ACCAGCCTCCCAATAACCAGAGG - Intronic
1151220150 17:72606064-72606086 ACGAGCCCCCCACTGACCATGGG + Intergenic
1151311935 17:73298470-73298492 GCCAGCCTCCCACATAACAGTGG + Intronic
1152201270 17:78947822-78947844 TCAGGCCTCCCACAGCCCAGAGG - Intergenic
1152556640 17:81056405-81056427 CCAAGTGTCCCACAGACGAGTGG - Intronic
1152784038 17:82238867-82238889 ACAAGCCTCCTGCAGACTCGGGG + Exonic
1152977812 18:240686-240708 ACAATTTTTCCACAGACCAGGGG + Intronic
1153050461 18:898576-898598 TCAAGCCTCCCAAAGTGCAGGGG - Intergenic
1153309161 18:3661286-3661308 ACACTCCTCCCACAGACAGGTGG + Intronic
1153533811 18:6078692-6078714 ACAATTTTTCCACAGACCAGGGG + Intronic
1154315229 18:13298768-13298790 ACCAGACTGCCACAGGCCAGTGG - Intronic
1154421759 18:14236588-14236610 ACATGCCTGCAGCAGACCAGAGG - Intergenic
1157351262 18:46888607-46888629 ACAATTTTCCCACAGGCCAGGGG + Intronic
1158442948 18:57493495-57493517 AAAAGTCTTCCACAAACCAGAGG + Intergenic
1158684441 18:59600486-59600508 ACAATTTTTCCACAGACCAGAGG - Intronic
1161053691 19:2179219-2179241 ACGAGCCTCCCAAGGCCCAGCGG - Intronic
1161558270 19:4956646-4956668 CCAGGGCTCCCACAGATCAGTGG - Intronic
1163284874 19:16340174-16340196 ACCTGCCTCCCAGAGACCAGCGG - Intergenic
1163345594 19:16739928-16739950 ACAAGCCAACCACAGACCAGAGG - Intronic
1163459414 19:17427621-17427643 ACAAGACTACAACAGCCCAGAGG - Intronic
1164633304 19:29775581-29775603 TCACTCCTGCCACAGACCAGGGG + Intergenic
1165243793 19:34486288-34486310 ACAAACCTCCCACAGTCCTGAGG - Intronic
1166252233 19:41579099-41579121 AAAACCCTCCCACAGATGAGCGG - Intronic
1166295521 19:41887611-41887633 CCAGGCCTGTCACAGACCAGAGG + Intronic
925139484 2:1540081-1540103 CCACGCCTCCCAGAGACCAGGGG + Intronic
925148713 2:1600327-1600349 CCATGCCTCCCCGAGACCAGGGG - Intergenic
928023297 2:27720694-27720716 ACAAGGCTCTCCCAGACCATTGG + Intergenic
928208568 2:29305752-29305774 ACAACTTTTCCACAGACCAGGGG + Intronic
931570141 2:63659817-63659839 ACAACCTTGCCACAGACCAGGGG - Intronic
931747056 2:65299730-65299752 ACAACCTCCCCACAGACCTGTGG - Intergenic
932621227 2:73265817-73265839 ACAAGCCCCAGACAGGCCAGCGG + Intronic
934860304 2:97759175-97759197 ACCAGCCCACCACAGCCCAGAGG + Intronic
936775901 2:115972835-115972857 ACAATTCTTCCACGGACCAGGGG + Intergenic
937206045 2:120237829-120237851 CCAAGCCTGCCACAGACATGGGG - Intergenic
941203464 2:162543032-162543054 ACAAGCCTCCCACATGCAAGTGG - Intronic
943576250 2:189634075-189634097 ACAATTTTTCCACAGACCAGGGG - Intergenic
944443112 2:199762442-199762464 ACATGCATCCCACAGGCCATGGG + Intronic
946571598 2:221029774-221029796 CCATGCCTGCCACAGAGCAGAGG - Intergenic
947230268 2:227877597-227877619 ACAATTTTTCCACAGACCAGGGG + Intronic
947315761 2:228856172-228856194 ACATGCCTCCAACAGAAAAGTGG + Intronic
947439697 2:230108778-230108800 AAAAACCTCCCATAGGCCAGTGG - Intergenic
947704592 2:232264022-232264044 ACAATTTTTCCACAGACCAGGGG + Intronic
947798505 2:232910214-232910236 ACAATTCTTCCACAGACCAGGGG + Intronic
948263262 2:236620035-236620057 TTAAGCCTTGCACAGACCAGTGG + Intergenic
948615989 2:239199287-239199309 AAAAGCCACCCAGAGAGCAGGGG - Intronic
948737345 2:240017555-240017577 ACAAGGCTCCCACGGGCCCGGGG - Intronic
948977995 2:241475652-241475674 ACAATTTTTCCACAGACCAGAGG - Intronic
1171527968 20:25830656-25830678 ACCAGCCTCTCACAGCCCAGAGG + Intronic
1171548858 20:26025224-26025246 ACCAGCCTCTCACAGCCCAGAGG - Intergenic
1172345046 20:34191458-34191480 CCAGGCCTCCCACAGACCGCTGG - Intergenic
1174167017 20:48592345-48592367 ACAATTTTTCCACAGACCAGGGG + Intergenic
1174253521 20:49236864-49236886 ATAAGACCCCCACAGATCAGAGG - Intronic
1174972593 20:55293211-55293233 ACAAGCCTCCAAGAGACTACTGG - Intergenic
1175927462 20:62477920-62477942 CCAAGTCCACCACAGACCAGGGG - Intergenic
1176851721 21:13923372-13923394 ACATGCCTGCAGCAGACCAGAGG + Intergenic
1180012064 21:45058071-45058093 ACCTGCTTCCCACAGCCCAGCGG - Intergenic
1180249422 21:46571266-46571288 ACAATTATTCCACAGACCAGGGG - Intergenic
1181780568 22:25190016-25190038 ACAATTTTTCCACAGACCAGGGG + Intronic
1181828656 22:25540816-25540838 ACAACCCACCCACAAACCATGGG - Intergenic
1182623710 22:31631154-31631176 ACAGGCGGCTCACAGACCAGCGG - Intronic
1185246630 22:49776365-49776387 ACCAGCCTCCCACGGACCCAGGG + Intronic
950777922 3:15366265-15366287 ACCAGACTCCCAAAGACCTGGGG - Intergenic
951779778 3:26349363-26349385 ATGAGCCTCCCAATGACCAGTGG - Intergenic
953522943 3:43659973-43659995 ACAGGACTCCGACAGACCTGCGG + Intronic
954566245 3:51602601-51602623 GCAAGTCTCAAACAGACCAGGGG + Intronic
958056511 3:88419232-88419254 ACAATTTTTCCACAGACCAGGGG - Intergenic
960695093 3:120388159-120388181 ATCAGCCTTCCAGAGACCAGGGG - Intergenic
962754337 3:138456757-138456779 ACAATTTTCCCACAGACCGGGGG - Intronic
962890296 3:139666181-139666203 ACATGCCTCCCACAGAGAGGTGG + Intronic
963710243 3:148739012-148739034 ACAAGCAACTGACAGACCAGTGG + Intronic
965220074 3:165918005-165918027 ACAAAGCTTCCACAGAGCAGAGG + Intergenic
965376412 3:167929884-167929906 ACATGCCCCTCACACACCAGCGG - Intergenic
967172505 3:186832991-186833013 ACCAGCCTGCAACAGAGCAGGGG + Intergenic
969208364 4:5665849-5665871 ACAAGCCTGTCAAAGACCTGAGG + Intronic
969606921 4:8206452-8206474 GCCAGCCTCCCACAGAGCCGCGG + Intronic
969682196 4:8649615-8649637 ACTGGCCTCCCCCAGGCCAGCGG + Intergenic
969702306 4:8774243-8774265 CCAGGTCTCCCCCAGACCAGGGG + Intergenic
971260673 4:25053953-25053975 TCCCCCCTCCCACAGACCAGTGG - Intergenic
973017746 4:45162896-45162918 ACAATTTTTCCACAGACCAGGGG + Intergenic
975381713 4:73707991-73708013 ACAATCTTTCCACAGACAAGGGG - Intergenic
977486225 4:97649803-97649825 ACAAGTTTTCCACAGACCAGGGG + Intronic
981000148 4:139821489-139821511 ACAATTTTTCCACAGACCAGGGG - Intronic
982721823 4:158867872-158867894 GCACGACTCCCACACACCAGGGG + Intronic
983439733 4:167766135-167766157 ACAAATTTTCCACAGACCAGTGG + Intergenic
983578746 4:169286639-169286661 ACAATTTTTCCACAGACCAGGGG + Intergenic
985832286 5:2242650-2242672 CCAAGGCTCCCTCACACCAGAGG + Intergenic
986793956 5:11191325-11191347 ACAAGCCTTCCACTGTCCTGTGG - Intronic
986918970 5:12661831-12661853 AGAAGGCTCCCACAGTGCAGCGG - Intergenic
987738335 5:21873478-21873500 ACAAGATTGTCACAGACCAGAGG + Intronic
988635666 5:32981400-32981422 TCAAGCCTACCACAGAGCTGAGG - Intergenic
995870969 5:116743029-116743051 CCAAGCCTGCCCCAGACCAGAGG + Intergenic
998381845 5:141731256-141731278 CCATGCCTCCCACAGCCCAGGGG - Intergenic
1000726962 5:164783418-164783440 TCAAGCCTACCACAGAGGAGAGG + Intergenic
1001044690 5:168362859-168362881 ACTAGGCCCCCACAAACCAGTGG - Intronic
1004513234 6:16299607-16299629 ATATGCCTCCCACAGGCCAAGGG - Exonic
1007136951 6:39531689-39531711 ACCAGCCACCCAGACACCAGGGG + Intronic
1007388396 6:41534983-41535005 AGATGCCTCCCACAGACCTATGG + Intergenic
1010828852 6:80506412-80506434 ACAAGCCTGCCTAAGACAAGTGG - Intergenic
1012261687 6:97094809-97094831 AAAAGACCCCCACACACCAGAGG + Intronic
1013193916 6:107828631-107828653 AACAGCCTCCCACACTCCAGAGG + Intergenic
1014285585 6:119493848-119493870 AAAAGCCTCCCACAGAATAGAGG - Intergenic
1015957630 6:138614934-138614956 ACAATTTTCCCACAGACCTGGGG - Intronic
1018887433 6:167951769-167951791 AAAAGCCTTCCACACTCCAGCGG + Exonic
1019320647 7:414031-414053 ACAGGCCTCCCAGAGCCCAAAGG - Intergenic
1020268440 7:6577511-6577533 CCAAGCTTCCCACAGCCCCGCGG - Exonic
1023840953 7:44097177-44097199 GCAGGCCTCCCACACACCTGGGG - Intergenic
1024286543 7:47762842-47762864 CCCAGCCCCCCACAAACCAGAGG - Intronic
1024523461 7:50327913-50327935 TCCATCCTCCCACACACCAGAGG - Intronic
1024573394 7:50744073-50744095 ACATGCCTACCACAGAGCAGGGG - Intronic
1025297671 7:57789227-57789249 ACCAGCCTCTCACAGCCCAGAGG - Intergenic
1025785143 7:64637162-64637184 ACAAGCCTCCCATCTCCCAGTGG + Intergenic
1026497969 7:70919848-70919870 TCAACCCTCCCACAGGGCAGAGG - Intergenic
1029287936 7:99478940-99478962 ACACCCATCCCACAGCCCAGTGG - Intronic
1032792934 7:135255723-135255745 ACAATTTTCCCACAGACCTGGGG - Intronic
1033281662 7:140010199-140010221 ACAATTCTCACCCAGACCAGAGG + Intronic
1034128709 7:148697500-148697522 AGAAGGATCACACAGACCAGTGG + Intergenic
1034908604 7:154973232-154973254 ACAGGCCTGCCACTGACCATGGG - Intronic
1035879101 8:3224469-3224491 TCAAGCCTTCCATACACCAGGGG - Intronic
1038403036 8:27299924-27299946 ACAAGTCACCCACAGAGGAGGGG - Intronic
1039424770 8:37476869-37476891 TCAGGACTCTCACAGACCAGTGG + Intergenic
1039571428 8:38589676-38589698 CCAAGACTCCCACAGGCCATGGG - Intergenic
1039896920 8:41723461-41723483 ACAAGCCTCACCCAGAGCAGCGG - Intronic
1041437497 8:57858646-57858668 ACAATCCTCTTACAAACCAGAGG - Intergenic
1045470111 8:102504815-102504837 ACAAAACTGTCACAGACCAGAGG - Intergenic
1048258421 8:132923939-132923961 ACAATTTTTCCACAGACCAGAGG + Intronic
1048323721 8:133422570-133422592 CCAAGCCTCCCACAGAGGAAAGG + Intergenic
1049129887 8:140828964-140828986 ACAAGTAGCCCACAGACCATTGG - Intronic
1050061355 9:1712967-1712989 ACAGGCATTCCACAGAGCAGGGG + Intergenic
1050272078 9:3957066-3957088 ACCTGCCTCCCACAGTGCAGCGG + Intronic
1053795932 9:41726804-41726826 ACCAGCCTCTCACAGCCCAGAGG + Intergenic
1054149248 9:61588069-61588091 ACCAGCCTCTCACAGCCCAGAGG - Intergenic
1054184338 9:61938875-61938897 ACCAGCCTCTCACAGCCCAGAGG + Intergenic
1054654167 9:67649620-67649642 ACCAGCCTCTCACAGCCCAGAGG - Intergenic
1054872118 9:70057117-70057139 ACAATTTTCCCACAAACCAGGGG - Intronic
1055752398 9:79521474-79521496 GCAAGCCTCCCGCAGGCCATGGG + Intergenic
1059759774 9:117326987-117327009 ACAATTTTTCCACAGACCAGGGG + Intronic
1062058650 9:134482694-134482716 ACAACCCTCCCTCATTCCAGAGG + Intergenic
1062280051 9:135747765-135747787 ACAAGCCTCCCACAGACCAGTGG - Intronic
1062543251 9:137050817-137050839 AGAAGCCTTCCACAGCACAGTGG + Intronic
1062701832 9:137910416-137910438 ACAATTTTTCCACAGACCAGAGG + Intronic
1187460702 X:19484378-19484400 ACAATTTTTCCACAGACCAGAGG - Intronic
1187557744 X:20368217-20368239 ACAATTTTTCCACAGACCAGGGG - Intergenic
1190621386 X:52289914-52289936 CCATGCCACACACAGACCAGTGG - Intergenic
1193103585 X:77643095-77643117 AGTATCCTCCCACAAACCAGAGG + Intronic
1194559503 X:95403503-95403525 ACCACCCTCCCCCCGACCAGTGG + Intergenic
1195761283 X:108249165-108249187 ACAATTTTACCACAGACCAGGGG - Intronic
1196414137 X:115453408-115453430 ACAAGCCTCCCAAATAACACAGG + Intergenic
1196456267 X:115893526-115893548 ACCAGCATCCCACAGGCCACTGG + Intergenic
1197549591 X:127873563-127873585 ACAATTCTTCCACAGACCAGGGG + Intergenic
1200038233 X:153346884-153346906 ACAAGCTTCCCAAGGGCCAGTGG + Exonic
1201605139 Y:15775796-15775818 CCAAGCCTCCCATATGCCAGAGG - Intergenic