ID: 1062280054

View in Genome Browser
Species Human (GRCh38)
Location 9:135747788-135747810
Sequence GGCTCCTGGGGCCAGGCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 539
Summary {0: 1, 1: 0, 2: 4, 3: 54, 4: 480}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062280054_1062280063 -4 Left 1062280054 9:135747788-135747810 CCCACTGCCTGGCCCCAGGAGCC 0: 1
1: 0
2: 4
3: 54
4: 480
Right 1062280063 9:135747807-135747829 AGCCCTGAGTATGCCCGGTGGGG No data
1062280054_1062280069 21 Left 1062280054 9:135747788-135747810 CCCACTGCCTGGCCCCAGGAGCC 0: 1
1: 0
2: 4
3: 54
4: 480
Right 1062280069 9:135747832-135747854 ACAAGCCTGCCCCCAGGACTTGG No data
1062280054_1062280060 -9 Left 1062280054 9:135747788-135747810 CCCACTGCCTGGCCCCAGGAGCC 0: 1
1: 0
2: 4
3: 54
4: 480
Right 1062280060 9:135747802-135747824 CCAGGAGCCCTGAGTATGCCCGG No data
1062280054_1062280062 -5 Left 1062280054 9:135747788-135747810 CCCACTGCCTGGCCCCAGGAGCC 0: 1
1: 0
2: 4
3: 54
4: 480
Right 1062280062 9:135747806-135747828 GAGCCCTGAGTATGCCCGGTGGG No data
1062280054_1062280068 15 Left 1062280054 9:135747788-135747810 CCCACTGCCTGGCCCCAGGAGCC 0: 1
1: 0
2: 4
3: 54
4: 480
Right 1062280068 9:135747826-135747848 GGGGTGACAAGCCTGCCCCCAGG No data
1062280054_1062280061 -6 Left 1062280054 9:135747788-135747810 CCCACTGCCTGGCCCCAGGAGCC 0: 1
1: 0
2: 4
3: 54
4: 480
Right 1062280061 9:135747805-135747827 GGAGCCCTGAGTATGCCCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062280054 Original CRISPR GGCTCCTGGGGCCAGGCAGT GGG (reversed) Intronic
900013080 1:132680-132702 GGCTCCTGGGCCCAGTAAGAAGG - Intergenic
900043146 1:488667-488689 GGCTCCTGGGCCCAGTAAGAAGG - Intergenic
900064583 1:723664-723686 GGCTCCTGGGCCCAGTAAGAAGG - Intergenic
900184578 1:1327104-1327126 AGCTGGTGGGGACAGGCAGTCGG - Intronic
900524909 1:3123826-3123848 GGGGTCTGGGGCAAGGCAGTTGG + Intronic
900549841 1:3248925-3248947 GGCTGCTGAGCCCAGGAAGTTGG + Intronic
900694983 1:4004238-4004260 GGCTCCTGAGGGCGGGCAGCAGG + Intergenic
900702623 1:4057764-4057786 GGCTCCTGGGGCCAAACTGTTGG + Intergenic
901195662 1:7438550-7438572 GGCCCCTGTGTCCAGGCAGGAGG + Intronic
901237079 1:7672897-7672919 GCCTTCTGGAGCCAGGCAGGTGG - Intronic
901275354 1:7986891-7986913 GGATGCTGGGGCCAGTCAGGTGG + Intergenic
901323158 1:8351462-8351484 GGCTCCTGTGGCCAGCCTGCGGG + Intergenic
902395777 1:16131903-16131925 TGGTCCTGGGGCCAGCCAGAGGG - Intronic
902792537 1:18778826-18778848 AGCTGCTGGGGCCAGGCAGGAGG + Intergenic
902814669 1:18909406-18909428 GTCTCCTGGGGACAGGCCCTGGG + Intronic
902835212 1:19043018-19043040 GGACTCTGGAGCCAGGCAGTTGG - Intergenic
903006760 1:20303766-20303788 GGCTCCTGGGGTCAAGGAGAAGG - Intronic
903158925 1:21470743-21470765 GCCCCCTGGGGTCAGGCAGGTGG + Intronic
903304471 1:22402920-22402942 GGCTGCTGGGGCTGGGCAGATGG - Intergenic
903778133 1:25806160-25806182 GGTCACTGAGGCCAGGCAGTGGG + Intronic
903988057 1:27243532-27243554 GACTCCAGGGGCCAGGCCATTGG - Intronic
904031653 1:27536962-27536984 GGTGCCTGCGGCCAGGCAGCAGG + Intronic
904274617 1:29372231-29372253 GGCTTCCCCGGCCAGGCAGTGGG - Intergenic
904311078 1:29629971-29629993 TGCTCCTATGGCCAGGCACTGGG + Intergenic
904533209 1:31182315-31182337 GGGTGCTGGGGCCAGGGACTGGG + Intronic
905356853 1:37390780-37390802 GCATCCTAGGGCCATGCAGTTGG - Intergenic
905898130 1:41562329-41562351 GGCTCCTGGGGTCTGGGGGTGGG + Intronic
906044384 1:42817006-42817028 CGCTCCTGGGGCCAGGGGGCCGG + Intronic
906288495 1:44603821-44603843 AGCGCCTGAGGCCAGGCAGCTGG + Intronic
906640174 1:47436993-47437015 GGCAACTGGGGCCAGGGAGAGGG + Exonic
907251011 1:53139472-53139494 GGTTCCTTGGGGCAGGCAGTGGG + Intronic
907405939 1:54253601-54253623 GGAACCTGGGGCCAGGAAGCAGG - Intronic
907418538 1:54330886-54330908 TGCTCCTGGTGCCAGGGAGCAGG + Intronic
910146515 1:84086305-84086327 GGCCCCAGGGGCCAGACAGGAGG - Intronic
910819283 1:91328726-91328748 GGCTGCTGGGGCCGAGCAGGTGG + Intronic
912861812 1:113219999-113220021 GGCCTCTGAGGCCAGGCAGAGGG + Intergenic
913090332 1:115472498-115472520 TGGTCCTGGGGTCAGGCACTTGG - Intergenic
913112739 1:115671093-115671115 GGCTCCGGGCGCAAGGCTGTGGG - Intronic
913265443 1:117038741-117038763 GGCTGCTGGGAACAGGCAATGGG - Intergenic
914689163 1:150010455-150010477 GGCTCCCGGGGCAAGGCCCTAGG + Exonic
915564953 1:156707979-156708001 GGAGGCTGGAGCCAGGCAGTGGG + Intergenic
915841807 1:159219057-159219079 GGCACCTGGGGCCAGGCACAAGG + Intergenic
917970292 1:180201769-180201791 TGCTGCTGGGGCCAGGCAGAGGG - Exonic
918174430 1:182030189-182030211 GGAGCCTGGGGCCGGGCGGTTGG + Intergenic
919730743 1:200912155-200912177 GGACCCCGGGGCCAGGCAGGAGG + Intronic
919938653 1:202271478-202271500 GGTTCCTGGGGGCAGGGAGCAGG + Intronic
921154997 1:212432757-212432779 GGCTACTCGGGCCACGCAGCTGG - Intergenic
921219154 1:212961090-212961112 AGCTTCTGGGGGCAGGCAGAGGG - Intronic
922099481 1:222469680-222469702 GGCTCCTGGGCCCAGTAAGAAGG - Intergenic
922261519 1:223949176-223949198 GGCTCCTGGGCCCAGTAAGAAGG - Intergenic
922735559 1:227976568-227976590 GGCTCCTGGGCCCAGTAAGAAGG + Intergenic
922808605 1:228403362-228403384 AGCACCTGGAGCCAGGCAGCTGG - Intronic
923053240 1:230403627-230403649 GGCTCCAGGGGCAAAGCAGCAGG + Intronic
923130363 1:231069616-231069638 GCTTCCTGGGGCCAGTGAGTGGG + Intergenic
924342682 1:243051352-243051374 GGCTCCTGGGCCCAGTAAGAAGG - Intergenic
924410130 1:243795862-243795884 TTCTCCTGAGGCCAGGGAGTTGG + Intronic
1063175672 10:3548858-3548880 GCCTCCTGTGGCCAGGCTGGAGG - Intergenic
1063430642 10:5985250-5985272 GGCAGATGGGGCCAGGCAGAGGG + Intergenic
1063482074 10:6384993-6385015 GGCACCTGGGGGCAGGCAGGTGG - Intergenic
1063672554 10:8111140-8111162 GGAACCTGGGGCCAGGCCGACGG + Intergenic
1063786922 10:9395249-9395271 TGCTCCAGGGACCAGGCAGTGGG + Intergenic
1063973470 10:11397294-11397316 GGCTCCTGGTCCCCAGCAGTGGG + Intergenic
1064321019 10:14304718-14304740 GGGCTCTGGGGCCAGGCAGTGGG + Intronic
1064428872 10:15254343-15254365 GGCTCGTGGGACGAGGCAGAGGG + Intronic
1066064093 10:31750016-31750038 GGCGCCAGGTGCCAGGCAGGGGG - Intergenic
1066156909 10:32687893-32687915 GGATCTTCTGGCCAGGCAGTAGG - Intronic
1067497443 10:46773509-46773531 GCCTCCGGGGGTCAGGCAGGAGG - Intergenic
1067597209 10:47566906-47566928 GCCTCCGGGGGTCAGGCAGGAGG + Intergenic
1069717369 10:70529793-70529815 GGCTCCAGGGGACAGGGAGGGGG - Intronic
1069840594 10:71337117-71337139 TGTTCCAGGGGCCAGGCAGGAGG - Intronic
1070150479 10:73802047-73802069 GGCCCCTTTAGCCAGGCAGTGGG - Exonic
1070528669 10:77317134-77317156 TCCTGCTGGGGCCTGGCAGTTGG - Intronic
1070645712 10:78200840-78200862 GCCTGCTGGGGCCAGGCAGGTGG - Intergenic
1070791193 10:79190315-79190337 GGCTCCTGAGGCCTGGGTGTGGG + Intronic
1071361647 10:84852070-84852092 GGCTGCAGGGGCCAGGGAGATGG - Intergenic
1071574595 10:86716339-86716361 GGCCCCTGGGGACGGGCTGTAGG - Exonic
1072252672 10:93593893-93593915 CGCTTCTGGGGGCAGGCCGTTGG + Exonic
1072437486 10:95427419-95427441 TTCTCCTGGGGGCAGGGAGTCGG + Intronic
1072451425 10:95542200-95542222 GGCTCCTGGGGACAGGGTGGGGG - Intronic
1072609421 10:97006674-97006696 GGCTCTTGGGGGCAGGCAGATGG + Exonic
1073152530 10:101321687-101321709 GGCTGCTGGGGCCAGGCATCGGG + Intergenic
1073293407 10:102424429-102424451 GGCTCTGGGGAGCAGGCAGTTGG + Intronic
1073451655 10:103613241-103613263 GGATCCTAGGGCCTGGGAGTGGG - Intronic
1074381657 10:112985703-112985725 GCCTCCTGGGGCGAGGCTGTGGG + Intronic
1074899060 10:117801272-117801294 GGCTGCAAGGGCCAGTCAGTGGG - Intergenic
1075019855 10:118943937-118943959 GGCTCCTGGGGCCTGGGGCTGGG - Intergenic
1075612356 10:123864030-123864052 GGCTCCTGGGGCCAGGCTGCAGG - Intronic
1075657486 10:124171816-124171838 GGCTCCAGTGTCCAGGCTGTAGG - Intergenic
1076572753 10:131443485-131443507 GGATCCTGGTCCCAGGCAGTGGG - Intergenic
1076783948 10:132739800-132739822 GGCCCCTGGGTCCTGGCAGGGGG - Intronic
1076856364 10:133117275-133117297 GGGTCTCGGGCCCAGGCAGTGGG - Intronic
1076948330 10:133666043-133666065 GGTTCCGGGGCCCAGGGAGTGGG + Intergenic
1076949319 10:133669353-133669375 GGTTCCGGGGCCCAGGGAGTGGG + Intronic
1076950303 10:133672652-133672674 GGTTCCGGGGCCCAGGGAGTGGG + Intergenic
1076951288 10:133675951-133675973 GGTTCCGGGGCCCAGGGAGTGGG + Intergenic
1076952278 10:133679261-133679283 GGTTCCGGGGCCCAGGGAGTGGG + Intergenic
1076953266 10:133682571-133682593 GGTTCCGGGGCCCAGGGAGTGGG + Intergenic
1076955234 10:133742222-133742244 GGTTCCGGGGCCCAGGGAGTGGG + Intergenic
1076956224 10:133745532-133745554 GGTTCCGGGGCCCAGGGAGTGGG + Intergenic
1076957212 10:133748841-133748863 GGTTCCGGGGCCCAGGGAGTGGG + Intergenic
1076958201 10:133752151-133752173 GGTTCCGGGGCCCAGGGAGTGGG + Intergenic
1076959185 10:133755450-133755472 GGTTCCGGGGCCCAGGGAGTGGG + Intergenic
1076960174 10:133758760-133758782 GGTTCCGGGGCCCAGGGAGTGGG + Intergenic
1076969417 11:124884-124906 GGCTCCTGGGCCCAGTAAGAAGG - Intergenic
1077081531 11:726601-726623 CGATCCTGGGGGCGGGCAGTTGG - Exonic
1077117244 11:890670-890692 GGCACCTGGGGACAGCCTGTTGG + Intronic
1077249711 11:1555593-1555615 GCCTCCGGGGGTCAGGCAGGAGG - Exonic
1077472849 11:2772324-2772346 GGCTCCTTGGGCCAGACACAGGG - Intronic
1077784666 11:5370019-5370041 CTCTCCTGGGGCCATGCAGAGGG - Intronic
1078128641 11:8593873-8593895 GTCTCCTGGGGCCCAGCCGTTGG - Intronic
1078739674 11:14054837-14054859 TGCTTCTGCGGCCAGGCAGCTGG + Intronic
1079173053 11:18114494-18114516 GGCTGCTGGGGGCAGGGGGTAGG + Intronic
1079464955 11:20721133-20721155 GGTTTCTGGAGCCATGCAGTGGG - Intronic
1080304930 11:30825979-30826001 TCCTCCAGGTGCCAGGCAGTGGG - Intergenic
1080317577 11:30967568-30967590 GGCTCCTGGGGCCTGGGATCTGG + Intronic
1081580031 11:44345877-44345899 GGCTCATTGGGCCATGGAGTGGG - Intergenic
1081781044 11:45712995-45713017 GGCTCCTGGCAGCAGGCAGTAGG - Intergenic
1082996143 11:59257115-59257137 GGCTCTTTGGGACAGGTAGTGGG - Intergenic
1083155581 11:60820974-60820996 AGCTCCTGGGGCCTGGCAAGGGG - Intergenic
1083313079 11:61795706-61795728 GGCTGCTGGGGCCGAGCAGGAGG + Exonic
1083330486 11:61896142-61896164 CACTCCAGGGGCCAGGCAGAGGG - Intergenic
1083621239 11:64050388-64050410 GGGTCCTGGGGCCAGGCCCTTGG + Intronic
1083791625 11:64989640-64989662 GGCTGCTGGGACCAGGCTGAGGG - Exonic
1084014231 11:66369265-66369287 GACACCTGGGGCTGGGCAGTAGG + Intronic
1084030965 11:66480358-66480380 GGACCCCGAGGCCAGGCAGTTGG + Exonic
1084051139 11:66600746-66600768 TGCTCCTTGGGTCAGGCACTGGG - Intronic
1084085451 11:66852984-66853006 GCCTCCTGGGTACAGGCAGTGGG + Intronic
1084089079 11:66868755-66868777 GGCTCCTGGGGCCAGCCAGGGGG - Intronic
1084174780 11:67417521-67417543 GGCTCCTGGCGCCAGGACGTGGG + Exonic
1084220274 11:67673671-67673693 GGCATCTGGGGCCAGGTAGCTGG + Intronic
1084287589 11:68142047-68142069 GCCTCCTGGGGCCTGGCACCCGG - Intergenic
1084346451 11:68553045-68553067 GGCTCCTGATTCCAGTCAGTGGG + Intronic
1084366884 11:68707253-68707275 GGCTGCCGGGCCCAGGCACTGGG - Intergenic
1084368054 11:68716577-68716599 GACTCCTGGGGCCACACAGGTGG + Intronic
1084671177 11:70607470-70607492 GGCACCTGAGGGCAGGGAGTGGG - Intronic
1084954872 11:72685813-72685835 AGCTCCCAGGGCCAGGCAGAGGG + Intronic
1085549974 11:77360073-77360095 GGCTCCAGGTGTCAGGCAGGAGG - Intronic
1088217525 11:107529346-107529368 GCTTCCTGGGGCCAGTCAGATGG + Intronic
1088585814 11:111359363-111359385 GGCTGCAGGGGTCAGGCAGGAGG - Intronic
1088689340 11:112311790-112311812 CACTCCTGGAGCCAGGAAGTGGG + Intergenic
1088893913 11:114063958-114063980 GGCTCCTCGGGCCCTGCAGGTGG - Exonic
1089189569 11:116644296-116644318 GGGTCCTGGGGGTGGGCAGTGGG - Intergenic
1089365249 11:117917478-117917500 CGCTGCTGGTGCCAGGCAGGGGG - Intronic
1089489067 11:118870463-118870485 GACTCCTTGGGCTGGGCAGTGGG - Intergenic
1089711585 11:120318748-120318770 GGCTTCTGGGGACAGCCATTTGG + Exonic
1090284775 11:125490484-125490506 AACCCCTGGGGCCAGGCATTTGG - Intronic
1090959892 11:131546875-131546897 GGCTCCTGAGGCCTGGTAGATGG - Intronic
1091282762 11:134391349-134391371 GGGGCTTGGGGCCAGGCAGCGGG + Exonic
1091447811 12:553997-554019 CTCTCCTGGGGCCAGGGACTGGG + Intronic
1091601051 12:1918011-1918033 GGCTCCTGGGGAGAGGCAGGTGG + Intronic
1091603256 12:1930403-1930425 GGACCCTGGGGCCAGGCACAGGG - Intergenic
1094414396 12:30201861-30201883 GGTTCCTGGGACCAGGCGGGAGG + Intergenic
1096477582 12:51917792-51917814 GGCTCCTTGGACCAGGCTGCAGG + Intronic
1096482047 12:51948812-51948834 GCATCCTTGGGCCAGGCTGTGGG + Intergenic
1102027646 12:109722668-109722690 GGGTCCTGGGGACAGGCAGCAGG - Intronic
1104789467 12:131472799-131472821 GGCCCCAGAGGCCAGGCAGGAGG + Intergenic
1106107406 13:26744953-26744975 AGCTCGTGGGGCAGGGCAGTGGG - Intergenic
1106113988 13:26801438-26801460 GGTTCATGGAGCCAGGCAGGAGG - Intergenic
1106420301 13:29580281-29580303 GACTCCCGAGGCCAGGCAGGAGG + Intronic
1107560307 13:41551945-41551967 GGCTCCCAGGGGCAGGCAGGTGG + Intergenic
1113519506 13:110929527-110929549 GCCTCCTGGGCCTGGGCAGTGGG - Intergenic
1113647681 13:112010843-112010865 TGCGCCTGAGGCCAGGCAGGGGG - Intergenic
1114007676 14:18332422-18332444 GGATCCTGAGGCCTGGCAGCTGG + Intergenic
1114318014 14:21525075-21525097 GGCTCCTTAGGCCAGACGGTGGG - Exonic
1115183479 14:30656771-30656793 GGCTCCAGGGGTTAGCCAGTTGG + Intronic
1116856332 14:49955487-49955509 GGCTGCTAGGGGCATGCAGTTGG - Intergenic
1118514266 14:66508772-66508794 GGCTCCTGGGGCCTGGGGGAGGG - Intronic
1120016950 14:79484618-79484640 GTCTCCAGGGGTCAGGCAGATGG - Intronic
1121492291 14:94369202-94369224 GGCCCCTGGGGGCAGGAAGGTGG + Intergenic
1121860053 14:97308899-97308921 GTCTCCTGGGGTCAGGATGTGGG + Intergenic
1122207824 14:100156976-100156998 GGCACCTGGGGCCAGGGCTTGGG - Intronic
1122615236 14:103013202-103013224 GGCTCCTGCGTGCAGGCAGGTGG - Intronic
1122632168 14:103112023-103112045 GGGTCCTGGGGCAGGGCTGTGGG + Intergenic
1122767546 14:104082426-104082448 GGGGCCTGGGGCCAGGCAGAGGG - Intergenic
1122858742 14:104572593-104572615 GGCTCCTGGGCCATGGCAGCTGG - Intronic
1123000918 14:105293659-105293681 GGCTGGAGGGGCCAGGCAGACGG - Intronic
1123808302 15:23897591-23897613 GGCTCTTAGGGCAAGGGAGTTGG - Intergenic
1123827818 15:24101286-24101308 GGCTCCTGGGCTAAGTCAGTGGG + Intergenic
1124791401 15:32730840-32730862 GGTTCCTGGAGCCAGGCTGCTGG - Exonic
1125196653 15:37055282-37055304 GCATCCTGGGGACAGGCACTGGG + Intronic
1126096494 15:45094439-45094461 TCATCCTGGGGCCAGGCAATCGG + Intronic
1126097706 15:45100928-45100950 GGCTCCTGGTACCAGGCAGGGGG + Intronic
1126780956 15:52138477-52138499 GGGTCCTGTGGACAGCCAGTGGG - Intronic
1127823471 15:62682101-62682123 TGCCCCTAGGGCCAGGGAGTTGG - Intronic
1128312542 15:66640313-66640335 GGCTCTTGGGGCCAGGCCTGAGG + Intronic
1128378505 15:67094102-67094124 GGGTCCTCAGGGCAGGCAGTGGG + Intronic
1128865000 15:71108166-71108188 GGCTGCTGGGGCCTGGAGGTGGG + Intronic
1129198143 15:73983174-73983196 GGCTCCTGGGGGCATGGGGTGGG - Exonic
1129247585 15:74289059-74289081 GGCTCCTGGGGGAGGGGAGTTGG + Intronic
1129336020 15:74852707-74852729 AGCTCCTGGGGGCAGGCCATGGG - Intronic
1129467059 15:75730204-75730226 GGCAGCTGGGGCCAGGCTGAAGG - Intergenic
1129701840 15:77772789-77772811 GGCTGCTGGGGGCAGGCAGCTGG - Intronic
1131378890 15:91947802-91947824 GGCTGCTAGGGCCAAGCAGGGGG - Intronic
1131732923 15:95300958-95300980 GGATCCCGGGGACAGGCAGGAGG + Intergenic
1132546262 16:534757-534779 GGCCCCTGTGTCCAGGCAGCTGG - Intronic
1132580253 16:681378-681400 GGCCTCTGGGGCCAGGCGGGTGG + Intronic
1133207526 16:4242246-4242268 GCCTTCTGGGGCCTGGCAGCTGG - Intergenic
1133232278 16:4372372-4372394 CCCTCCTGGGGTCCGGCAGTAGG + Intronic
1133236418 16:4389317-4389339 TCCTCCTGGGCCCTGGCAGTGGG + Intronic
1133284631 16:4684872-4684894 GGGCCCTGGGGCCAGGAAGCGGG - Intronic
1133924380 16:10181832-10181854 GGCTCCTTGGGCCGGGGAGGAGG - Intronic
1135496558 16:22956713-22956735 GGCTCCTGGGGTCACTCTGTGGG - Intergenic
1135561888 16:23483056-23483078 GGCTCCTGGGGCCCTGGAGGGGG - Intronic
1136008385 16:27346684-27346706 GGCTCCTGGCTCCAGGGACTGGG - Intronic
1136077787 16:27828720-27828742 GGCCACTGAGGCCAGGCCGTGGG + Intronic
1136116762 16:28099451-28099473 GGCTGCTGGGGCCAGGAAATAGG - Intronic
1136241252 16:28945666-28945688 GCCTCCTGGGGCTGGGAAGTCGG + Intergenic
1136999303 16:35215724-35215746 GGCTCTAGGGGGCAGGCGGTAGG + Intergenic
1137270968 16:46901962-46901984 TGCCCTTGGGGCCAGGCAGAGGG - Intronic
1138350403 16:56343573-56343595 GGGTCCTGGATCCAGTCAGTGGG - Intronic
1138473942 16:57259529-57259551 GGCTCCTGGGGCCAAGCGTTTGG - Intronic
1140457149 16:75112148-75112170 GGCTCCTGGGGCCAGCCAGAGGG + Exonic
1141660527 16:85438926-85438948 GGCCCCTGGAGGCAGGCAGGAGG - Intergenic
1141666881 16:85470251-85470273 GGCACCTGGGGCCAGCCAGCGGG + Intergenic
1141717323 16:85734440-85734462 GGCTGCTGGGGTCAGGTAGGTGG + Intronic
1141968695 16:87465016-87465038 GGTTGCAGGGGCCAGGCAGAGGG - Intronic
1142227361 16:88884187-88884209 GGTTCCAGGGCCCAGGCAGCAGG - Intronic
1142293121 16:89201711-89201733 GGCTCCTGGGGCGGGGCTTTGGG + Intergenic
1142451255 16:90174238-90174260 GGCTCCTGGGCCCAGTAAGAAGG + Intergenic
1142753798 17:2003669-2003691 GGGCCCTGGGGCCAGGCAGGCGG - Intronic
1143026101 17:3942795-3942817 CTCTCTTGGGGCCAAGCAGTTGG - Intronic
1143248578 17:5505398-5505420 GGCTCCACGGGGCAGACAGTGGG + Intronic
1143554562 17:7652112-7652134 GGCTCCCAAGGCCAGGCGGTGGG - Intronic
1143575897 17:7792865-7792887 GGATCCAGGGGCCAGGCTGCCGG + Intronic
1144655499 17:17032626-17032648 GGCCTCTAGGGCCAGGCAGGTGG - Intergenic
1145264911 17:21375255-21375277 GGATCCTGGCCCCAGGCAGCTGG - Intergenic
1145289304 17:21530634-21530656 GGATGCTGGGGCCAGGATGTGGG - Exonic
1145981540 17:29015268-29015290 TGCTCCTGGAGGCAGGCAGATGG - Intronic
1146457812 17:33020859-33020881 GGATCCTGGGGCCATGGAGAGGG - Intronic
1148475087 17:47923283-47923305 GGCCCCTGTGGCCAGGGTGTTGG + Intronic
1148478049 17:47941909-47941931 GGCTTCTGGGGCCACCCGGTGGG + Intronic
1150895649 17:69207735-69207757 GGCTACCAGGGCCTGGCAGTGGG + Intronic
1151169157 17:72232236-72232258 GGTTCCTGTGGGCAGGAAGTAGG - Intergenic
1151318534 17:73338623-73338645 GGAGCCTGGGGCCAGGCTGCTGG + Exonic
1151388636 17:73770810-73770832 GGCTGCTGAGGCCAGGCAGGCGG + Intergenic
1151389712 17:73777740-73777762 GGCCCTTGAGGCCAGGCAGTGGG - Intergenic
1151554323 17:74839004-74839026 GGCATCTGGGGCCATGCAGGTGG - Exonic
1151820357 17:76493635-76493657 GGCTCCTGGAGACAGACAGCTGG - Intronic
1151884070 17:76913164-76913186 GGCACCTGGCCCCAGGCAGGAGG - Intronic
1152130365 17:78472603-78472625 AGCCCCCGGGGCCAGGCGGTGGG - Intronic
1152330505 17:79669950-79669972 GGCTCCTGGGGAGAAGCTGTGGG + Intergenic
1152372951 17:79901878-79901900 GGTTCCTGGGGCTAGGCCTTCGG + Intergenic
1152716404 17:81902729-81902751 GGCTCAGGCGGCGAGGCAGTCGG - Exonic
1153053841 18:926242-926264 GGCTCCTGGGATCAGGCTGCTGG + Intergenic
1153607742 18:6851870-6851892 GGCTCCTGGGGACAGGAGGGAGG + Intronic
1153907923 18:9679338-9679360 GGGTCCGGGGGCCTGGCTGTGGG - Intergenic
1154176845 18:12091645-12091667 GGGGGCTGGGGCCAGGCAGCAGG + Intergenic
1154198263 18:12281692-12281714 GGCTCATGTGCCAAGGCAGTGGG + Intergenic
1154529787 18:15331541-15331563 GGATCCTGAGGCCTGGCAGCGGG - Intergenic
1157094626 18:44676713-44676735 GGCTCCTGGGCCCTGGAAATGGG + Intergenic
1157197415 18:45630786-45630808 GGCAGCTGGAGACAGGCAGTGGG - Intronic
1157411356 18:47465787-47465809 GGCTCCAGGGGACAGAGAGTGGG + Intergenic
1158626846 18:59078911-59078933 TGTTCCTGGGGCCAGACACTAGG + Intergenic
1158934215 18:62349598-62349620 GGCTCCTCAGGCCACGCAGCTGG - Intronic
1160011125 18:75107765-75107787 GGCTGCTGTGTCCACGCAGTGGG - Intergenic
1160316556 18:77853363-77853385 GGCTCTTCAGGGCAGGCAGTGGG - Intergenic
1160405213 18:78640887-78640909 GGCTCCTGTGGACAGACAGCAGG + Intergenic
1160646222 19:194810-194832 GGCTCCTGGGCCCAGTAAGAAGG - Intergenic
1160717437 19:582682-582704 GGCTCCTGGGTCCCGCCTGTGGG + Intronic
1160732982 19:649589-649611 GCTTCGTGGGTCCAGGCAGTGGG + Intronic
1161038377 19:2097585-2097607 GGCACCTGGCACCAGGCAGCTGG + Intronic
1161391663 19:4024316-4024338 GGCTGCAGGGCACAGGCAGTGGG - Intronic
1161870803 19:6868237-6868259 GGCCCCTGAGACCAGGCAGACGG - Intergenic
1162105689 19:8368355-8368377 GGATGCTGGTGCCAGGCTGTGGG + Intronic
1162500412 19:11050315-11050337 GGCTGCTGCCTCCAGGCAGTGGG - Intronic
1163287444 19:16357461-16357483 GGCTCCTTGGGCGAGCGAGTTGG + Intronic
1163421400 19:17215581-17215603 GGCTACTGGGGCCGGGGAGTCGG - Intronic
1165039654 19:33060004-33060026 GGCTGCTGGGCCCATGGAGTGGG + Intronic
1165149431 19:33752139-33752161 GGCTCCCGGGCTCAGGCAGCTGG - Intronic
1165393621 19:35551929-35551951 GACTCCAGGGGCCAGGCAGATGG + Intronic
1165995780 19:39842955-39842977 GTCTGCAGGAGCCAGGCAGTGGG - Intronic
1166504324 19:43361772-43361794 GGCTCCTGGTCCCAGGGAGGAGG + Intronic
1166546172 19:43635902-43635924 GGCTCCTGGGTCCAGGGAGGAGG - Intronic
1166663278 19:44661393-44661415 GGCTCCTGAGGCCGGGCCGTGGG - Intronic
1167070829 19:47221293-47221315 GCCTCCTGGAGCCAGAGAGTGGG - Exonic
1167719919 19:51172259-51172281 TGGTCCTGGGGCCAGGCTGGAGG + Intergenic
925732487 2:6929396-6929418 GGCTCCTGGAGCTAAGCCGTGGG + Intronic
925749810 2:7077847-7077869 GGCTCCTGGAGCCAGAGAGATGG - Intergenic
925905835 2:8539307-8539329 GGTTCCTGGGACTGGGCAGTGGG - Intergenic
925944131 2:8845152-8845174 AGCAGCTGTGGCCAGGCAGTGGG - Intergenic
926678950 2:15649653-15649675 GGCTGCTGGAGCCTGGCAGGGGG - Intergenic
927496566 2:23555312-23555334 GGGTTCTAGGGACAGGCAGTGGG + Intronic
928324640 2:30309806-30309828 GCCTCCTGGGACCAGGAAGCTGG - Intronic
928495132 2:31823664-31823686 GGCTACTGGGGACAGGCTGAGGG - Intergenic
929121860 2:38490127-38490149 GGCTCCAAGGGCCAGGCAGTTGG - Intergenic
929668488 2:43851890-43851912 GGGTCCTGAGGCAAGGCAGCAGG - Intronic
932104813 2:68932678-68932700 GGCTCCAGGCACCAGGCAGCTGG + Intergenic
932667201 2:73707666-73707688 GGCTCTGGGGGTCAGGCAGCTGG + Intergenic
933285790 2:80383318-80383340 GGCACCTGGGGATAGGCAGCAGG - Intronic
934557250 2:95294022-95294044 GGCAGCTTGGGGCAGGCAGTGGG - Intergenic
934670681 2:96210317-96210339 GGCTCCTGGGGCATCCCAGTTGG + Intergenic
935351505 2:102155027-102155049 AGCTCCTGGAGCCAGGCCCTGGG + Intronic
936462609 2:112723835-112723857 GTCCCCTGGGGCCAGGAAGGAGG - Intronic
936533030 2:113290202-113290224 GGCTCTTGGGGCCCAGCAGGTGG + Intergenic
936543958 2:113374158-113374180 GTTTCCTGGGGCCAGGCCGAGGG - Intergenic
937325037 2:120985308-120985330 GCCTCCTAGGCCCAGGCAGGTGG + Intronic
937909554 2:127068819-127068841 GCCACCTGGGGCCAGGCAGGAGG + Intronic
937982646 2:127624394-127624416 GGCTTCTGAGGCCAGGTAGAAGG + Intronic
938243645 2:129761495-129761517 GGCACCTGGGTCCAGGAAGATGG + Intergenic
938408412 2:131045316-131045338 TGCACCTGGGGCCACGAAGTGGG + Intronic
938528881 2:132162981-132163003 GGATCCTGAGGCCTGGCAGCGGG - Intronic
939044867 2:137238287-137238309 GACTCCTGGGCACAGGAAGTTGG + Intronic
942721296 2:178956150-178956172 GGATCCTGGGGCCAGACTGTTGG - Intronic
944669105 2:201980681-201980703 GTCTCCTGCTGGCAGGCAGTGGG - Intergenic
944873268 2:203935343-203935365 GGCTCCTGGGTCTCAGCAGTGGG - Intergenic
945338392 2:208619772-208619794 AGCTCCTGGGCCCAGGAGGTCGG + Intronic
945776070 2:214107802-214107824 TGCTGCTGGGGGTAGGCAGTGGG - Intronic
947329109 2:229009649-229009671 GGGAACTGGGGCCAGGAAGTTGG + Intronic
947564525 2:231185595-231185617 GGCTCCTGGGGCCAGAATGGAGG + Intergenic
947573242 2:231251656-231251678 GGCTGATGGGGGCAGTCAGTAGG + Intronic
947611564 2:231528046-231528068 GGCTCCTGGGGCCTGGGAGAAGG - Intronic
947645603 2:231737101-231737123 GACTCCTGGTGCCATTCAGTGGG - Intronic
948059211 2:235031134-235031156 GGCTTCTGGGCCCTGGGAGTGGG + Intronic
948115707 2:235493647-235493669 GGCTCCTGGAGCCAGCCGCTTGG + Intergenic
948423920 2:237876312-237876334 GGCCCAGGGGGCCAGGCGGTGGG + Intronic
948425558 2:237884906-237884928 GGCTCCAGGCCCCAGGGAGTGGG + Intronic
948625093 2:239263797-239263819 GACAGCTGGGGCCAGGCAGGCGG - Intronic
948868393 2:240786540-240786562 GGCCCCTGAGGCGAGGGAGTGGG + Intronic
1169123237 20:3109851-3109873 GGGTCCTGGGCTCAGGCAGGGGG + Exonic
1170230888 20:14045073-14045095 GGCTCCTCGGGCCCCGCACTCGG - Intronic
1171121055 20:22568934-22568956 GGTACCCGGGGCCAGGCAGCCGG - Intergenic
1171891881 20:30724665-30724687 GGATCCTGGGCCCTGGCACTGGG + Intergenic
1172081033 20:32340759-32340781 GGCAGCTTGGACCAGGCAGTGGG + Intergenic
1172449170 20:35009740-35009762 CTCACCTGGAGCCAGGCAGTGGG - Intronic
1173160119 20:40646441-40646463 GGCTAATGGGGCCTGGCAGGTGG - Intergenic
1173224654 20:41155195-41155217 GGCCCCAGGTGCCAGGCAGCAGG + Intronic
1173392122 20:42644679-42644701 TGCTCCTGGGGCCAGGCTCTGGG - Intronic
1173732344 20:45337705-45337727 GGCTTCTGGGGAGAGGCAGGTGG + Intronic
1173743064 20:45416194-45416216 TGCTCCTGGGGCCCGGCGGCTGG + Exonic
1174171585 20:48621076-48621098 GGCTCCTGGGTGCAGGTATTTGG - Intergenic
1175093673 20:56524720-56524742 GGCACCTGGTGCCAGGCCCTTGG - Exonic
1175094864 20:56533253-56533275 GGCACCTGGTGCCAGGCCCTTGG - Exonic
1175336431 20:58199219-58199241 GGCCCCTTGGGGCAGGGAGTGGG - Intergenic
1175514798 20:59562201-59562223 GGTTCTGGGGGCCAGGCAGGTGG + Intergenic
1175846799 20:62064073-62064095 GGCTCCCTGGGCCAGGCGATGGG - Intronic
1176127993 20:63484467-63484489 GGCACCTGAGGCCAGGCAATGGG - Intergenic
1176145300 20:63562737-63562759 GGCTGCTGGGCCCAGGGCGTGGG + Exonic
1176149983 20:63585821-63585843 GGCTCCTGGGGACACTCAGTGGG + Intergenic
1176279284 20:64291406-64291428 GGCTCCTGGGCCCAGTAAGAAGG + Intergenic
1176285203 21:5015776-5015798 AGCCTCTGGGGCCAGGCAGCAGG - Intergenic
1176767624 21:13036931-13036953 GGATCCTGAGGCCTGGCAGCGGG + Intergenic
1177166307 21:17608763-17608785 GCCTCCTGTGTCCAGGCAGTGGG + Intronic
1179871978 21:44247699-44247721 AGCCTCTGGGGCCAGGCAGCAGG + Intronic
1179980505 21:44893289-44893311 GGGTCCTGGGGACAGCCAGAAGG - Intronic
1180244469 21:46537805-46537827 GCCTCCTGGGACCAAGCAGGAGG + Intronic
1180432183 22:15263232-15263254 GGATCCTGAGGCCTGGCAGCTGG + Intergenic
1180514750 22:16131169-16131191 GGATCCTGAGGCCTGGCAGCTGG + Intergenic
1180594969 22:16967167-16967189 GGATGCTGGGCCCAGGCAGAAGG + Intronic
1180847600 22:18992585-18992607 GGCTCCTGGGCCCAGTCTCTGGG - Intergenic
1180854316 22:19036699-19036721 GGCACGTTGGGCCAGGCAGAAGG - Exonic
1180855747 22:19043705-19043727 GTCTCCTTGGGGCAGGCAGTAGG - Intronic
1181168460 22:20995439-20995461 GGCACCAGAGGCCATGCAGTGGG + Intronic
1181287157 22:21761280-21761302 TGCTCTTGGGCACAGGCAGTGGG - Exonic
1181851102 22:25750574-25750596 GGTTCCTGGAGGCAGGCAGAGGG - Intronic
1182069791 22:27455463-27455485 GCCTCCTGGTGCCTAGCAGTGGG + Intergenic
1182476539 22:30579653-30579675 AGCTCCAGGGAACAGGCAGTAGG - Intronic
1183411158 22:37655642-37655664 GGCTCCTGGGGCGGGGCTGAGGG - Exonic
1183508681 22:38222850-38222872 GCCTCCTGGGGCCTGGCAGGGGG + Intronic
1183546946 22:38459387-38459409 GGCAACTTGGGCCAGGCAGGTGG + Intergenic
1184052725 22:42020401-42020423 GGCCTTTGTGGCCAGGCAGTTGG + Intronic
1184517800 22:44973476-44973498 GGCTGCTGGAGCCAGGAACTGGG + Intronic
1184652841 22:45926978-45927000 AGCTCCTGGAGCCAGGGGGTGGG - Intronic
1184690133 22:46113753-46113775 GGCTCCTCAGGGAAGGCAGTAGG - Intronic
1184736003 22:46398173-46398195 GGCTCCAGGGGACAGGCACGGGG + Intronic
1185069517 22:48648353-48648375 GGCTCCTGGGCAGAGGCGGTGGG - Intronic
1185301830 22:50084889-50084911 GGCTCCTGGGTCATGGCACTTGG + Exonic
949526526 3:4910219-4910241 AGGCCCCGGGGCCAGGCAGTAGG + Intergenic
950207483 3:11092041-11092063 GGCTCCTGGAGGCAGGCTCTGGG - Intergenic
950870109 3:16220833-16220855 GGTTCCTGGGGGCAGGCTGTGGG + Intronic
950872022 3:16237763-16237785 GGCACCTGGGTCTAGGTAGTGGG + Intergenic
954373908 3:50184366-50184388 GGCACCTGAGGCCAGGGAGGTGG + Intronic
954629158 3:52038913-52038935 GGCATCTGGGCCCAGGCAGCAGG + Intergenic
955071670 3:55577050-55577072 GGCCTCTGGGGCCTGGAAGTTGG - Intronic
956406432 3:68932707-68932729 GGCGCCTGGAGGCCGGCAGTGGG - Intergenic
961379440 3:126487567-126487589 GGCCACTGGAGCCAGGCAGGGGG + Intronic
961467144 3:127088919-127088941 GGCCCCAGGGGCCAGGCGGGAGG - Intergenic
964451377 3:156816555-156816577 GGCTCCCGGCTCCAGGCAGGCGG + Intergenic
966837399 3:184059673-184059695 GGCACCCGGGGCCAGGGAGGAGG + Intronic
967787107 3:193509157-193509179 GGCTGCTGGGGGCAGGCACATGG - Intronic
968076926 3:195821137-195821159 GGATCATGAGGCCAGGCAGATGG + Intergenic
968371459 3:198224716-198224738 GGCTCCTGGGCCCAGTAAGAAGG + Intergenic
968570505 4:1338064-1338086 GGCACCTAGGAACAGGCAGTGGG - Intronic
968863082 4:3188158-3188180 CTGTCCTGGGGGCAGGCAGTAGG + Intronic
968916888 4:3500511-3500533 GCCTCCTGGGGGGAGGCTGTAGG - Intronic
968995433 4:3942307-3942329 GGCACCTGGGGTCAGCCAGGTGG + Intergenic
969131948 4:4996552-4996574 GGGGCCTGGGGCCTGTCAGTGGG - Intergenic
969262543 4:6043163-6043185 CGCAGCTGGGGCCTGGCAGTGGG - Intronic
969336651 4:6514498-6514520 GGGCCCTGGGGCCAGCCACTGGG - Intronic
969646554 4:8433123-8433145 GGCTGCTGGGTCCAGGGAGCAGG - Intronic
971330202 4:25675773-25675795 GGCTCCAGAGGCCAGGCGCTTGG - Intronic
971814306 4:31466839-31466861 GGCTCCTGGGGCATGTCGGTTGG - Intergenic
975582382 4:75918650-75918672 GGCTCCTGTAACCAGGCTGTGGG - Intronic
979260145 4:118637189-118637211 GGCTCCTGGGCCCAGTAAGAAGG + Intergenic
979328230 4:119403439-119403461 GGCTCCTGGGCCCAGTAAGAAGG - Intergenic
980180083 4:129392170-129392192 TGCTCTTGGGGCCAGGGAGCAGG + Intergenic
985451784 4:190066847-190066869 GGTTCCGGGGCCCAGGGAGTGGG + Intergenic
985452772 4:190070139-190070161 GGTTCCGGGGCCCAGGGAGTGGG + Intergenic
985453758 4:190073432-190073454 GGTTCCGGGGCCCAGGGAGTGGG + Intergenic
985454747 4:190076725-190076747 GGTTCCGGGGCCCAGGGAGTGGG + Intergenic
985455737 4:190080022-190080044 GGTTCCGGGGCCCAGGGAGTGGG + Intergenic
985456720 4:190083316-190083338 GGTTCCGGGGCCCAGGGAGTGGG + Intergenic
985457707 4:190086612-190086634 GGTTCCGGGGCCCAGGGAGTGGG + Intergenic
985458695 4:190089909-190089931 GGTTCCGGGGCCCAGGGAGTGGG + Intergenic
985459684 4:190093209-190093231 GGTTCCGGGGCCCAGGGAGTGGG + Intergenic
985634560 5:1029727-1029749 GGCTCCTGAGGACAGGCAGCGGG - Intronic
987489045 5:18553798-18553820 GGCTCGGGGGGCGAGGGAGTGGG + Intergenic
988583725 5:32491001-32491023 GCCTCCTGGGGCGAGGCAAGAGG + Intergenic
990028234 5:51222515-51222537 TACTTCTGGGGCCAGGCAGGTGG + Intergenic
990584998 5:57202206-57202228 AACTCCTGGGCCCAAGCAGTCGG + Intronic
998477380 5:142433181-142433203 GGCTGCAGGGGCCAGGCCGCAGG - Intergenic
999226772 5:150032167-150032189 GCCTTCAGGGTCCAGGCAGTTGG - Intronic
1000040606 5:157481877-157481899 GGCTCCTGCGGCCTGGCACTGGG + Exonic
1001564300 5:172689696-172689718 GGGACTTGGAGCCAGGCAGTGGG - Exonic
1001567215 5:172707353-172707375 GTCTCCTGGGGGCCGGCAGATGG + Intergenic
1001930570 5:175670022-175670044 TGCTTCTGAGGCCAGGCAGGGGG + Intronic
1002052846 5:176581393-176581415 GGCTGTAGGGGCCAGGCAGCAGG - Exonic
1002566826 5:180116823-180116845 GACTCCTGTTCCCAGGCAGTGGG - Intronic
1002571633 5:180143016-180143038 GGGGCTGGGGGCCAGGCAGTGGG - Intronic
1002730697 5:181330262-181330284 GGCTCCTGGGCCCAGTAAGAAGG + Intergenic
1002753833 6:143842-143864 GGCTCCTGGGCCCAGTAAGAAGG - Intergenic
1003050628 6:2777877-2777899 GGCTCTGGGGCCCAGGCAGTTGG + Intronic
1003185081 6:3823353-3823375 AGTCCCTGGGGCCATGCAGTTGG - Intergenic
1003197602 6:3928932-3928954 TGTCCCTGGGGCCAGGCAGTTGG - Intergenic
1005083390 6:21980088-21980110 GTCTCCTGGCTCCAGGCAGCAGG - Intergenic
1005992897 6:30914389-30914411 GGGTCCTGGGCCCAGGCCTTGGG + Exonic
1006130073 6:31863777-31863799 GGACCCTGGGGCCAGGAAATCGG + Intronic
1006153324 6:32000999-32001021 GGCTGCAGGGCCCAGGGAGTGGG + Intronic
1006159632 6:32033736-32033758 GGCTGCAGGGCCCAGGGAGTGGG + Intronic
1006699120 6:35957509-35957531 GGTCACTGGGGCCAGGCATTTGG + Intronic
1007584151 6:42978689-42978711 GGCTGCTGGGCCCAGGGACTCGG - Exonic
1007634825 6:43293057-43293079 GGCTCCTGGGGGCAGGAGGTAGG - Intergenic
1008726451 6:54427249-54427271 GGAGCCTGGGGAAAGGCAGTAGG + Intergenic
1010999690 6:82573770-82573792 AGCTCCTGGTGACAGGCTGTGGG - Intergenic
1011300144 6:85865177-85865199 TGCTCCTGCAGCCAGCCAGTGGG + Intergenic
1011732559 6:90280714-90280736 TGGTCCAGGGACCAGGCAGTGGG + Intronic
1013086072 6:106858919-106858941 GGGTCGTGGGGCCAGTGAGTCGG - Intergenic
1014802358 6:125791027-125791049 GGCTCCTGGGGTCCGGGAGAAGG - Exonic
1015204140 6:130616035-130616057 GGGCCTTGGGGCCAGGGAGTGGG + Intergenic
1017817505 6:158026518-158026540 GGCTCCTGGGTCCAGGGAGGAGG - Intronic
1018396211 6:163379804-163379826 GGCTCCTGGGGCCCATTAGTGGG + Intergenic
1018424963 6:163671702-163671724 GGCTACTGGGGCCAAGTCGTGGG + Intergenic
1018574455 6:165244787-165244809 AGCTCCTGCAGCCAGGAAGTGGG - Intergenic
1019435386 7:1019870-1019892 GGCCTCTGGGTCCAGGCTGTGGG - Intronic
1019809960 7:3158060-3158082 GGCAGATGGGGCCAGGCAGGAGG - Intronic
1019811830 7:3170633-3170655 GGCTGCTCCGGCCAGGCAGGTGG - Intronic
1020023435 7:4882966-4882988 AGCTCCTGGGGCCTCGCAGGAGG - Intronic
1020086563 7:5313613-5313635 GGGTGCTGGGGCCAGGGAGGTGG + Exonic
1020895450 7:13933507-13933529 TGCTCCTGGGGCCAGCCCTTTGG - Intronic
1022491695 7:30825460-30825482 GGCTCCTGAGGGTAGGCAGGTGG - Intronic
1023401861 7:39796790-39796812 GGCTCCTGGGCCCAGTAAGAAGG + Intergenic
1023818927 7:43969699-43969721 GGGGCCTGGGGGCGGGCAGTGGG - Intergenic
1023865375 7:44235830-44235852 GGGTCCTGGAGCCAGGCGGTGGG - Intronic
1024075842 7:45817432-45817454 GGCTCCTGGGCCCAGTAAGGAGG + Intergenic
1024647757 7:51383872-51383894 GGCTCCTGGGCCCAGTAAGAAGG - Intergenic
1025051595 7:55738359-55738381 GGCTCCTGGGCCCAGTAAGGAGG - Intergenic
1025106301 7:56174587-56174609 GGCTCCTGGGGCCAGCGGGGAGG + Intergenic
1025128558 7:56364026-56364048 GGCTCCTGGGCCCAGTAAGGAGG - Intergenic
1025176940 7:56806909-56806931 GGCTCCTGGGCCCAGTAAGAAGG - Intergenic
1025203777 7:56979642-56979664 GGCACCTGGGGCCAGGAACGTGG - Intergenic
1025668164 7:63597288-63597310 GGCACCTGGGGCCAGGAACGTGG + Intergenic
1025694852 7:63769477-63769499 GGCTCCTGGGCCCAGTAAGAAGG + Intergenic
1026233360 7:68504931-68504953 GGCTCCTGTGTGCAGGCACTTGG + Intergenic
1026554728 7:71397385-71397407 TGCTCCTGAGGATAGGCAGTAGG - Intronic
1027174470 7:75894333-75894355 GGCCCATGGGGCCGGGGAGTGGG + Intergenic
1028147650 7:87336149-87336171 GGTTCCTGGTGCCAGGTACTAGG + Intergenic
1029043970 7:97607737-97607759 TGCCCCTGGGCCTAGGCAGTGGG + Intergenic
1029341258 7:99946492-99946514 GGATCCTGGAGCCAGGTGGTGGG + Intergenic
1029375335 7:100173993-100174015 GGCACCTGGGGGCAGAGAGTGGG + Exonic
1029406133 7:100374914-100374936 GGCTCCCAGGGCCAGCCACTGGG - Intronic
1029743977 7:102506662-102506684 GGGGCCTGGGGGCGGGCAGTGGG - Intronic
1029761966 7:102605825-102605847 GGGGCCTGGGGGCGGGCAGTGGG - Intronic
1031867776 7:127058211-127058233 CCTTCCTGGGGCCAGGCTGTGGG - Intronic
1032052373 7:128657182-128657204 GGCTCCTGGGCCCAGTAAGAAGG + Intergenic
1032424431 7:131810343-131810365 GAATCCTGTAGCCAGGCAGTGGG + Intergenic
1034404817 7:150896365-150896387 TGCTCCTGGGGCCAGGATGGAGG - Intergenic
1034434600 7:151057347-151057369 GGCTCCAGGGGCTCGGCAGGAGG + Intronic
1035074513 7:156169156-156169178 GGCTCCTGGGGGTGGGTAGTAGG + Intergenic
1035221431 7:157408660-157408682 AGCTCCTGGGGGCAGGCCCTGGG + Intronic
1035315873 7:157997428-157997450 GGCTCCAGGCGCCAGCCAGGGGG - Intronic
1036195134 8:6707920-6707942 GGCACCTGGGCCCAGGTTGTAGG - Intergenic
1036453750 8:8891571-8891593 GGCCCCTGGGGACAGGAAGAAGG + Exonic
1036695879 8:10974809-10974831 GGCTCCTGGGGGATGGCAGTTGG + Intronic
1037374321 8:18211589-18211611 GCCGACTGGGGCCAGGCAGGTGG - Intronic
1038121100 8:24616404-24616426 ATCTCCTGTGGGCAGGCAGTAGG - Intergenic
1038326589 8:26577226-26577248 GGCTCCTGGGGGCGGGGAATGGG - Intronic
1044335848 8:90984768-90984790 AGCACCTGGTGCCAGGCGGTGGG - Intronic
1047501317 8:125443937-125443959 GGCTGATGGGGCCAGGAAGCGGG + Intergenic
1048335118 8:133496859-133496881 GGCTCCTGGGGCCAAGAACTCGG - Intronic
1048987472 8:139742452-139742474 GGAGCCTGGGGCCAGACAGCAGG + Intronic
1049202243 8:141346021-141346043 GGCCCCTTGGGTCAGGCAGAGGG - Intergenic
1049618728 8:143588351-143588373 GGTCTCTGGGGCCAGGCAGGTGG - Intronic
1049632061 8:143664296-143664318 GGCTCCTGCAGCAAGGCAGTCGG - Intergenic
1049655329 8:143794622-143794644 GGGTGCTGGGGACAGGCAGGAGG - Intronic
1049681396 8:143920154-143920176 GGCTGCTCGGGCCCGGCAGGAGG - Exonic
1049708970 8:144055229-144055251 CTTTCCTGGGGCCAGGCTGTGGG - Intronic
1050285460 9:4097194-4097216 GGCTTCTGGTGGCAGGCAGATGG - Intronic
1050388173 9:5111783-5111805 GGCTCCGGGGGCCAAGGAGAAGG - Intronic
1050815361 9:9805109-9805131 GGATTCTGGGGCCAGGCTTTGGG + Intronic
1053707495 9:40769310-40769332 GGATCCTGAGGCCTGGCAGCTGG - Intergenic
1054417407 9:64890078-64890100 GGATCCTGAGGCCTGGCAGCTGG - Intergenic
1056683721 9:88742462-88742484 GGCTTCCAGGGTCAGGCAGTGGG - Intergenic
1056737174 9:89219885-89219907 AGCTCCTGGGGCCAAGCACAGGG - Intergenic
1057217488 9:93237096-93237118 GGCTCCTGGCTTCAAGCAGTGGG + Intronic
1057438466 9:95063833-95063855 AGCACCTGGGGCCAGGCATGAGG - Intronic
1057758094 9:97853132-97853154 GGCCCCGGGGGGCGGGCAGTCGG + Intergenic
1057826912 9:98378447-98378469 GTCTCCTGGGGCCCAGCTGTGGG - Intronic
1059234646 9:112751162-112751184 GGCGCCTGGGGCCGGGGAGTGGG + Intronic
1059741222 9:117151891-117151913 GGAGAGTGGGGCCAGGCAGTAGG - Intronic
1060110204 9:120901530-120901552 GCCTCCTTGGGCCAAGCACTTGG + Intergenic
1060110923 9:120905654-120905676 ACCTCCTGGGGCAAGGCAGAAGG + Intronic
1060742672 9:126109875-126109897 GGCTCTAGGGTCCAGGGAGTGGG + Intergenic
1060752558 9:126182923-126182945 GACCCCTGGGACCTGGCAGTTGG + Intergenic
1061328531 9:129878538-129878560 GGCACCTGGGGGCAGGCATGGGG - Intronic
1061624673 9:131834795-131834817 GCCTCCTGGGACCAGGCAGAGGG - Intergenic
1061711873 9:132493547-132493569 GGCTCCTGGGGGAGGGCAGCAGG + Intronic
1061718621 9:132537519-132537541 GGCTCCCGGGGGCGGGCGGTGGG + Intronic
1061727349 9:132589140-132589162 GGCTCTCTGGGCCAAGCAGTGGG + Intronic
1061747859 9:132753357-132753379 TGCCACTGGGGCCAGGCAGAGGG - Intronic
1061855158 9:133437952-133437974 GGCTCCTGGGGGCAGGTTGGTGG + Intronic
1062064122 9:134517240-134517262 GGCTGCTGGGGCCAAGGAGAGGG - Intergenic
1062280054 9:135747788-135747810 GGCTCCTGGGGCCAGGCAGTGGG - Intronic
1062317577 9:135975993-135976015 GGTGCCAGGGGCCAGGAAGTGGG - Intergenic
1062422144 9:136487906-136487928 GTCTGCTGGGGACAGGCAGGAGG + Intergenic
1062449459 9:136609430-136609452 GGGGCCCGGGGCCAGTCAGTGGG - Intergenic
1062755106 9:138282772-138282794 GGCTCCTGGGCCCAGTAAGAAGG + Intergenic
1203579014 Un_KI270745v1:26941-26963 GGCTCCTGGGCCCAGTAAGAAGG + Intergenic
1185722762 X:2395324-2395346 GGCCACTGGGGCCAGCCAGGGGG + Intronic
1186489637 X:9961412-9961434 GGCTTCTTGGTCCAGGCAGCTGG - Intergenic
1186728480 X:12382727-12382749 GGATGCTGGGGCTGGGCAGTGGG - Intronic
1192917295 X:75666292-75666314 GGCTGCTGGTGCCAGCAAGTGGG + Intergenic
1195021544 X:100833379-100833401 GTCCTCTGGGGCCAGGCACTGGG - Exonic
1197289952 X:124643324-124643346 GGCTAAAGGGGCCAGGCAGGTGG + Intronic
1197769981 X:130083423-130083445 GTTTCCTGGGGGCAGGCAGAAGG - Intronic
1199991082 X:152988127-152988149 GTGTCCTGGGAGCAGGCAGTGGG - Intergenic
1200072134 X:153534458-153534480 GGCGTCTGGGGACAGGCATTGGG - Intronic
1200123237 X:153801018-153801040 GGCTTCTGGGAACAGGCACTGGG + Intergenic
1201904856 Y:19077628-19077650 GCCTTCTGGGGCCTGGCAATTGG + Intergenic
1202381634 Y:24279559-24279581 GGCTCCTGGGCCCAGTAAGAAGG + Intergenic
1202489151 Y:25390567-25390589 GGCTCCTGGGCCCAGTAAGAAGG - Intergenic