ID: 1062280055

View in Genome Browser
Species Human (GRCh38)
Location 9:135747789-135747811
Sequence GGGCTCCTGGGGCCAGGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 909
Summary {0: 1, 1: 1, 2: 9, 3: 93, 4: 805}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062280055_1062280061 -7 Left 1062280055 9:135747789-135747811 CCACTGCCTGGCCCCAGGAGCCC 0: 1
1: 1
2: 9
3: 93
4: 805
Right 1062280061 9:135747805-135747827 GGAGCCCTGAGTATGCCCGGTGG No data
1062280055_1062280060 -10 Left 1062280055 9:135747789-135747811 CCACTGCCTGGCCCCAGGAGCCC 0: 1
1: 1
2: 9
3: 93
4: 805
Right 1062280060 9:135747802-135747824 CCAGGAGCCCTGAGTATGCCCGG No data
1062280055_1062280068 14 Left 1062280055 9:135747789-135747811 CCACTGCCTGGCCCCAGGAGCCC 0: 1
1: 1
2: 9
3: 93
4: 805
Right 1062280068 9:135747826-135747848 GGGGTGACAAGCCTGCCCCCAGG No data
1062280055_1062280069 20 Left 1062280055 9:135747789-135747811 CCACTGCCTGGCCCCAGGAGCCC 0: 1
1: 1
2: 9
3: 93
4: 805
Right 1062280069 9:135747832-135747854 ACAAGCCTGCCCCCAGGACTTGG No data
1062280055_1062280062 -6 Left 1062280055 9:135747789-135747811 CCACTGCCTGGCCCCAGGAGCCC 0: 1
1: 1
2: 9
3: 93
4: 805
Right 1062280062 9:135747806-135747828 GAGCCCTGAGTATGCCCGGTGGG No data
1062280055_1062280063 -5 Left 1062280055 9:135747789-135747811 CCACTGCCTGGCCCCAGGAGCCC 0: 1
1: 1
2: 9
3: 93
4: 805
Right 1062280063 9:135747807-135747829 AGCCCTGAGTATGCCCGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062280055 Original CRISPR GGGCTCCTGGGGCCAGGCAG TGG (reversed) Intronic
900105736 1:980302-980324 GGGGACCTGGGGCCAGGCTCAGG + Exonic
900195163 1:1372198-1372220 GGGCTCCTGGGTCCAGGGCTGGG - Intergenic
900203067 1:1419958-1419980 GGGCAGCTGGAGCCAGGCTGGGG - Intronic
900227099 1:1538411-1538433 GGGCTCCGCGGGGCAGGCAGAGG - Intronic
900417908 1:2543491-2543513 GGGCTCCAGGGGCTGGGCCGGGG - Intergenic
900435577 1:2629168-2629190 GGGCTCCCGGGGCCGAGCTGCGG - Intronic
900473832 1:2867157-2867179 GGACTCCAGGGGCCACCCAGAGG + Intergenic
900515020 1:3077578-3077600 GGGGTCCTGGAGCCAGGCTGGGG + Intronic
900577257 1:3389486-3389508 GGTCCCCTGGGGCCAGGAGGGGG - Intronic
900622781 1:3595036-3595058 GGTTTCCTGGGGCCATGCATTGG - Intronic
900694061 1:3999435-3999457 GAGCTCCTGGGGCACAGCAGTGG + Intergenic
900954607 1:5878793-5878815 GAGCTCCAGGAGCCAGGCTGAGG - Intronic
901063906 1:6485809-6485831 GGGTACCCCGGGCCAGGCAGAGG - Intronic
901123481 1:6913225-6913247 GGGGACTTGGGGCCAAGCAGTGG - Intronic
901212921 1:7536606-7536628 GGGCTGCTGGGGGCAGGGACGGG + Intronic
901323157 1:8351461-8351483 GGGCTCCTGTGGCCAGCCTGCGG + Intergenic
901466026 1:9421772-9421794 GGCCAGCTGGGGGCAGGCAGAGG - Intergenic
901532836 1:9864220-9864242 GGCCTCCTGGGGCCATGCCCTGG - Intronic
901659473 1:10789352-10789374 GGGGTGCGGGGGGCAGGCAGAGG - Intronic
901821742 1:11834758-11834780 GGGCTGCGGGGGCAGGGCAGGGG + Intronic
902331604 1:15733695-15733717 GGGCTCCGTGGCCAAGGCAGAGG + Intronic
902395778 1:16131904-16131926 ATGGTCCTGGGGCCAGCCAGAGG - Intronic
902619042 1:17639934-17639956 AGGCTCCTGGAGCCAGGCTGGGG + Intronic
902637482 1:17743961-17743983 CGGCTCCTGGGGACAGGGAAGGG + Intergenic
903128591 1:21263824-21263846 GGGCTCCTGGAACCAGGGGGAGG - Intronic
903684359 1:25120108-25120130 GGGCTCCAGGTGTGAGGCAGGGG - Intergenic
904045283 1:27604644-27604666 GGGCTGCTGGGGCGGGGGAGCGG + Intergenic
904493281 1:30873139-30873161 GGGCTGGTGGGGCCAGGCTGGGG + Exonic
904533208 1:31182314-31182336 GGGGTGCTGGGGCCAGGGACTGG + Intronic
904750750 1:32740500-32740522 GAGCCCCTGGGGACATGCAGGGG + Intergenic
904821279 1:33246261-33246283 GGGTGGCTGGGACCAGGCAGGGG + Intergenic
905186887 1:36203456-36203478 TGGGTCCTGGGGACAGGCACTGG + Intergenic
905224830 1:36472276-36472298 TCGCTCCAGTGGCCAGGCAGGGG + Exonic
905270606 1:36785166-36785188 GGGCTCCTGGTGCCAGGGCTTGG + Intergenic
905385881 1:37603721-37603743 GGGCTCAAGAGGCAAGGCAGGGG + Intergenic
905460994 1:38122945-38122967 GGGATTCTGGGGTCAGGCTGGGG + Intergenic
905800558 1:40839695-40839717 GGGCCCTTGGGGACAGGCAGAGG - Exonic
905885210 1:41488090-41488112 GGACACCTGAGGCCAGGGAGAGG - Intergenic
906200734 1:43958602-43958624 GAGCTCTGGGGGCCAGGGAGCGG + Intronic
906288217 1:44602334-44602356 ATGCTCCTCAGGCCAGGCAGTGG - Intronic
906535690 1:46549905-46549927 GGTCTGCTGGGGTCAGGGAGAGG + Intronic
906640173 1:47436992-47437014 GGGCAACTGGGGCCAGGGAGAGG + Exonic
906704925 1:47887951-47887973 GGGCTCCGGAGGGCAGGCACAGG - Intronic
906816540 1:48885986-48886008 GAGCTCGTGGGTCCTGGCAGAGG - Intronic
907251010 1:53139471-53139493 TGGTTCCTTGGGGCAGGCAGTGG + Intronic
910114531 1:83717448-83717470 CAGCTCATGGGGCCAGCCAGCGG - Intergenic
910265390 1:85332543-85332565 GGGCCCATGGGCCCAGGCTGTGG - Intronic
911144744 1:94541607-94541629 CGGGACCCGGGGCCAGGCAGGGG + Exonic
912470377 1:109902628-109902650 AGGGTCCTGGGGATAGGCAGGGG - Intergenic
912494436 1:110082467-110082489 GGGCATCTGGGGACAGACAGGGG - Intergenic
912797257 1:112700755-112700777 AGGAAGCTGGGGCCAGGCAGAGG - Intergenic
912861811 1:113219998-113220020 GGGCCTCTGAGGCCAGGCAGAGG + Intergenic
913112740 1:115671094-115671116 GGGCTCCGGGCGCAAGGCTGTGG - Intronic
914242022 1:145858775-145858797 GGGCTCCGGGGGCGGGGCTGCGG - Intronic
914447552 1:147762610-147762632 GACCTCCTGGGCCCAGGCAGAGG + Intronic
914971081 1:152308446-152308468 GGACACCCGGGGCCAAGCAGAGG - Exonic
915280469 1:154818914-154818936 GAGCTTCTGGGGCAAGGCTGGGG + Intronic
915309493 1:155000185-155000207 CGGCCCCTGGGGCCCAGCAGGGG + Intergenic
915456509 1:156044120-156044142 GGGCTCCAGGGGTTAGGGAGGGG + Exonic
915464700 1:156090012-156090034 GGGCACCTGGTGCCAGCCAGGGG + Intronic
915470088 1:156120788-156120810 GGGGTCCTGGGTCCAGGTATAGG - Intronic
915531486 1:156504897-156504919 GGGTGCCTGGGGCCAGGCCTGGG + Intergenic
915543580 1:156583377-156583399 GGGCTGCTGCAGCCAGGCTGGGG + Exonic
915564952 1:156707978-156708000 GGGAGGCTGGAGCCAGGCAGTGG + Intergenic
915570511 1:156743006-156743028 GGGCTTGTGGGGCCTGGGAGGGG - Intronic
916270239 1:162933156-162933178 GAGCTCCTAGTGCCAGACAGAGG - Intergenic
917970293 1:180201770-180201792 GTGCTGCTGGGGCCAGGCAGAGG - Exonic
917981432 1:180272014-180272036 GGGCTGGAGGGGCCAGGCCGAGG + Intronic
918276770 1:182960170-182960192 GGGGTCCGGGGGCCTGGCCGCGG - Intergenic
919878010 1:201884713-201884735 GGGCTCCTGAGGCCAGGCCTTGG + Intergenic
920040260 1:203090902-203090924 GGGCTGGAGGTGCCAGGCAGAGG + Intronic
920047183 1:203140869-203140891 GGCTTCCTGGGGAGAGGCAGAGG - Intronic
920051245 1:203166269-203166291 GGGCTTCTGCGGTGAGGCAGGGG + Exonic
920677066 1:208045567-208045589 GGGCTCCTGTGGCCACAGAGTGG + Intronic
921219155 1:212961091-212961113 CAGCTTCTGGGGGCAGGCAGAGG - Intronic
922005866 1:221530075-221530097 GGGATCCGGAGCCCAGGCAGAGG - Intergenic
922180052 1:223226438-223226460 GGGTCCCTGCTGCCAGGCAGGGG + Intronic
922234958 1:223715620-223715642 GGGGTCCAAGGGCCATGCAGGGG + Intronic
922698816 1:227746055-227746077 GGGCCCCTGGGGCATGGCTGAGG - Intronic
922743672 1:228031020-228031042 GGGCTGGTGGGGCCTGGCTGAGG + Intronic
922769215 1:228173175-228173197 GGGCTTCAGGTGCCAAGCAGGGG - Intronic
922785931 1:228282259-228282281 GGACTCCTGGGGACAGGCCCAGG - Intronic
922791551 1:228313939-228313961 GGGCTCCTGGGATCAGGAATTGG + Intronic
922809156 1:228406417-228406439 GCGCTGCTGGGGCCAGCCCGAGG - Exonic
1062840630 10:667334-667356 GGCCTCCTGGGGAGGGGCAGAGG + Intronic
1063366921 10:5496632-5496654 GAGCACCTGGGGCTAGGGAGAGG - Intergenic
1063430641 10:5985249-5985271 TGGCAGATGGGGCCAGGCAGAGG + Intergenic
1063454438 10:6173310-6173332 CAGCTGCTGGGGCCGGGCAGTGG + Intronic
1063786921 10:9395248-9395270 ATGCTCCAGGGACCAGGCAGTGG + Intergenic
1063973469 10:11397293-11397315 GGGCTCCTGGTCCCCAGCAGTGG + Intergenic
1064321018 10:14304717-14304739 AGGGCTCTGGGGCCAGGCAGTGG + Intronic
1064428871 10:15254342-15254364 GGGCTCGTGGGACGAGGCAGAGG + Intronic
1065106608 10:22394622-22394644 GGTTGCCTGGGGCTAGGCAGAGG - Intronic
1065188646 10:23192134-23192156 GAGCTCCTGGGGCGAGGAAAAGG - Intergenic
1066064094 10:31750017-31750039 AGGCGCCAGGTGCCAGGCAGGGG - Intergenic
1067342999 10:45419443-45419465 GGGAACCTGGGGGCAGGCAGAGG + Intronic
1068006061 10:51393180-51393202 GGGGTCGCGGGGCCGGGCAGAGG + Intronic
1068142869 10:53028463-53028485 GGAATACTGTGGCCAGGCAGTGG + Intergenic
1068802638 10:61159625-61159647 GTGCTCATGAGGCCAGGAAGAGG + Intergenic
1069717370 10:70529794-70529816 GGGCTCCAGGGGACAGGGAGGGG - Intronic
1069828439 10:71268428-71268450 GGGACCCTGAGGCCAGACAGGGG - Intronic
1069961954 10:72084352-72084374 GGCATCCTGGGGCCAGTCAGCGG + Intronic
1070779358 10:79128536-79128558 GAGCCCCTGGGGCCAGGAGGAGG + Intronic
1070791192 10:79190314-79190336 GGGCTCCTGAGGCCTGGGTGTGG + Intronic
1070923818 10:80205296-80205318 GGGGGCCTGGGACCAGGCGGCGG - Intronic
1071292238 10:84196139-84196161 GGGCTCCTGGGTACAGGGAAGGG - Intronic
1071515562 10:86294524-86294546 GGGCTCCTGGGGATGGGAAGAGG + Intronic
1072207881 10:93220967-93220989 GGGCTCGGGGGGCCAGGCTGGGG + Intergenic
1072216425 10:93291153-93291175 GGGCTGCTGGGGACAGTCATGGG - Intergenic
1072451426 10:95542201-95542223 TGGCTCCTGGGGACAGGGTGGGG - Intronic
1072731538 10:97850111-97850133 GGGCGGCTGGGTCCAGGCAAGGG - Intergenic
1073026176 10:100488799-100488821 GGGGTCCTGGAGCCAGCGAGGGG + Intronic
1073030286 10:100520149-100520171 GGGCTCCTGGGGCCAGGGCCGGG - Intronic
1073152529 10:101321686-101321708 GGGCTGCTGGGGCCAGGCATCGG + Intergenic
1073381055 10:103078348-103078370 GGGCCCATGGGGCCCGGCAGTGG + Exonic
1074381656 10:112985702-112985724 AGCCTCCTGGGGCGAGGCTGTGG + Intronic
1074867725 10:117554501-117554523 GGACGTCTGGGGCCAGGCTGAGG - Intergenic
1074883664 10:117678095-117678117 GGCCTGCAGGGTCCAGGCAGAGG - Intergenic
1074899061 10:117801273-117801295 GGGCTGCAAGGGCCAGTCAGTGG - Intergenic
1075019856 10:118943938-118943960 GGGCTCCTGGGGCCTGGGGCTGG - Intergenic
1075684687 10:124355216-124355238 GCCCTCCTCGGGCCAGGCACGGG + Intergenic
1075692461 10:124407241-124407263 AGGTTCCTGAGGCTAGGCAGGGG - Intronic
1075877920 10:125823180-125823202 GGGGTCCTGGGGCCCGGCGCGGG - Exonic
1076001092 10:126913539-126913561 GAGCTCATGGGGCAAGGGAGGGG + Intronic
1076180361 10:128402296-128402318 GGGCCCCTGGGGCCATGCCAGGG + Intergenic
1076265160 10:129103958-129103980 GGGCTGGTGGGGCTGGGCAGGGG - Intergenic
1076456791 10:130605412-130605434 GTGATGCTGGGGCCTGGCAGCGG + Intergenic
1076572754 10:131443486-131443508 CGGATCCTGGTCCCAGGCAGTGG - Intergenic
1076722992 10:132400877-132400899 GGGCCCGGGAGGCCAGGCAGGGG + Intronic
1076783949 10:132739801-132739823 AGGCCCCTGGGTCCTGGCAGGGG - Intronic
1076791845 10:132780930-132780952 GAGGTCCAGGGGCCAGGCTGGGG + Intronic
1076850614 10:133090718-133090740 GGGCTCCTGACGCCTGCCAGGGG + Intronic
1076851748 10:133096669-133096691 TGGCTCCTGGGGCCATGTATCGG - Intronic
1077021967 11:420911-420933 GGGCTCCCGGGGCTGGGCGGGGG + Intronic
1077170362 11:1163417-1163439 GGGCTTCATGGGCCTGGCAGGGG - Intronic
1077289126 11:1780761-1780783 GGAGTCCTGGGGCCAAGCACAGG + Intergenic
1077300539 11:1844502-1844524 GGGTTCCTCGGGGGAGGCAGAGG + Intergenic
1077356768 11:2122367-2122389 GGGCTGCTGAGGCCGGGGAGAGG - Intergenic
1077375593 11:2203907-2203929 GGGATCCTGGGGCTGGGCTGGGG + Intergenic
1077472850 11:2772325-2772347 CGGCTCCTTGGGCCAGACACAGG - Intronic
1077550133 11:3196559-3196581 GGGTCCCTGGGCCCGGGCAGGGG + Intergenic
1077784667 11:5370020-5370042 ACTCTCCTGGGGCCATGCAGAGG - Intronic
1077847525 11:6041627-6041649 GGACTCCTGGGGAAAAGCAGAGG + Intergenic
1077926781 11:6689209-6689231 GGACTCCTGGGGAAAAGCAGAGG + Intergenic
1078164592 11:8871173-8871195 GGGCTGCTGGAGCCCGGCGGAGG + Intronic
1078454680 11:11465759-11465781 ATCCTCCTGGGGCCTGGCAGAGG - Intronic
1078542351 11:12222373-12222395 GGGCTCCTCCACCCAGGCAGGGG - Intronic
1079269930 11:18974774-18974796 GGGCTCCAGGGACCAGGGACTGG - Intergenic
1079284564 11:19117236-19117258 GGGCTCCTGGGGAGATGGAGGGG + Exonic
1080197820 11:29632416-29632438 GGGATGCTGGGTCCAAGCAGAGG - Intergenic
1080393737 11:31871433-31871455 CTGCTCCTGGGGACAGGAAGGGG + Intronic
1080683312 11:34495799-34495821 GGGCTCTTCAGGGCAGGCAGGGG + Intronic
1081545866 11:44071187-44071209 GGGCTCCTGGGGCCTTTCACTGG + Intronic
1081719080 11:45273443-45273465 GGCCTTCTGGGGCCAGGGTGTGG + Intronic
1081989499 11:47330198-47330220 GGGCTCCTAGAGCAAGGCTGCGG + Intergenic
1082821224 11:57545973-57545995 GGGCCCCCGGGGCCGAGCAGGGG - Exonic
1083155582 11:60820975-60820997 CAGCTCCTGGGGCCTGGCAAGGG - Intergenic
1083156373 11:60825814-60825836 TGGCTCCTAGGGCAAGTCAGTGG + Intergenic
1083234675 11:61343931-61343953 GGCCTCCTGGGGCTCGGCAGGGG - Exonic
1083235203 11:61346596-61346618 GGGCCAATGGGGCCAGGCCGGGG - Exonic
1083304604 11:61755896-61755918 GGGCTCCAGAGGCCGGGCAGAGG - Intronic
1083304765 11:61756535-61756557 GGTTTCCTGAGCCCAGGCAGGGG + Intronic
1083330487 11:61896143-61896165 ACACTCCAGGGGCCAGGCAGAGG - Intergenic
1083365047 11:62137421-62137443 GGGGTCCTGGGGCCTGGCCCAGG + Intronic
1083372370 11:62192514-62192536 GTGAGCCTGGGTCCAGGCAGGGG + Intronic
1083544636 11:63539047-63539069 TGGCTCTTGGGGCCATGGAGAGG + Intronic
1083545442 11:63545776-63545798 GAGCTCCAGGGGCCAGACTGGGG - Intronic
1083682512 11:64358039-64358061 GGGTACCTGGGGCCACCCAGGGG + Intergenic
1083714511 11:64567891-64567913 CAGCTCCTGGGGCCAGGGAGGGG - Intronic
1083726421 11:64630874-64630896 GGGCCACTGGGCCCAGACAGGGG + Intronic
1083791626 11:64989641-64989663 GGGCTGCTGGGACCAGGCTGAGG - Exonic
1083912565 11:65718817-65718839 GGGCTCCTGGGGACAGATAAAGG + Exonic
1083940018 11:65890731-65890753 GGGCTCCTGGGCCGCGGCGGCGG + Exonic
1084007840 11:66332563-66332585 GGGCCCCAGGGGGCAGGCGGTGG + Exonic
1084041022 11:66542823-66542845 GGACTCCTGGAGGGAGGCAGAGG + Intronic
1084051140 11:66600747-66600769 GTGCTCCTTGGGTCAGGCACTGG - Intronic
1084085450 11:66852983-66853005 GGCCTCCTGGGTACAGGCAGTGG + Intronic
1084089080 11:66868756-66868778 TGGCTCCTGGGGCCAGCCAGGGG - Intronic
1084111229 11:67015323-67015345 GCACTCATGGGGCCAGGCTGAGG - Intronic
1084174779 11:67417520-67417542 TGGCTCCTGGCGCCAGGACGTGG + Exonic
1084180463 11:67443333-67443355 GGGCTGCAGGGGCCGGGCTGAGG - Intronic
1084191254 11:67500027-67500049 GGGCTCCTGGGCTGAGGCTGAGG - Intronic
1084195761 11:67523073-67523095 GGGGACCTGGAGCCTGGCAGGGG + Intronic
1084212099 11:67629080-67629102 GGACTCTTGGGGCCACGGAGAGG + Intronic
1084462289 11:69302652-69302674 CGGGGCCTGGGGCCAGGCTGGGG + Intronic
1084660778 11:70545084-70545106 GGGCCACTGGGGCCTGGGAGGGG + Intronic
1084671178 11:70607471-70607493 GGGCACCTGAGGGCAGGGAGTGG - Intronic
1084954871 11:72685812-72685834 CAGCTCCCAGGGCCAGGCAGAGG + Intronic
1085032676 11:73282178-73282200 AGGCTCCAGGGACCAGCCAGTGG - Intronic
1085321414 11:75576386-75576408 AGGGGCCTGGGACCAGGCAGAGG - Intergenic
1085516893 11:77116720-77116742 GGGCCCCTGGAGGCAGGCTGAGG - Intronic
1085818560 11:79768304-79768326 GGGCTCCAGGGACCATGCTGAGG + Intergenic
1086006783 11:82047360-82047382 GGGGTACGGGGGGCAGGCAGGGG + Intergenic
1086112988 11:83218963-83218985 GGAATACTGTGGCCAGGCAGTGG + Intronic
1086334671 11:85788046-85788068 TGTCTCCTGAGCCCAGGCAGTGG + Intronic
1086443054 11:86847710-86847732 GGAATACTGTGGCCAGGCAGTGG - Intronic
1089189570 11:116644297-116644319 GGGGTCCTGGGGGTGGGCAGTGG - Intergenic
1089320650 11:117624650-117624672 GTGCTCCTGGGGCCAGGCTTAGG - Intronic
1089351180 11:117822541-117822563 GGGCTGCTGCGGGCAGGCTGCGG - Intronic
1089365250 11:117917479-117917501 TCGCTGCTGGTGCCAGGCAGGGG - Intronic
1089388643 11:118085026-118085048 GGGCTCCTGGGGGCTTGCAAAGG + Intronic
1089457366 11:118633502-118633524 TGGCTCCAGAGGGCAGGCAGGGG - Intronic
1089489068 11:118870464-118870486 GGACTCCTTGGGCTGGGCAGTGG - Intergenic
1089580568 11:119479390-119479412 GGTCTCCAGGGACCAGGGAGGGG - Intergenic
1090326196 11:125888065-125888087 GCGCCCCTGGGACCAGGCGGAGG + Intronic
1090823866 11:130369589-130369611 GGACTCCTGGTGGCAGGCATGGG + Intergenic
1091229857 11:133981318-133981340 GGGCTCCCAGGGCCTGGCTGCGG - Intergenic
1091282761 11:134391348-134391370 AGGGGCTTGGGGCCAGGCAGCGG + Exonic
1091284115 11:134398652-134398674 GGGCAGCAGTGGCCAGGCAGGGG + Intronic
1091295113 11:134468358-134468380 GGGGTCCCAGGGCCAGGCAGAGG - Intergenic
1091330671 11:134728896-134728918 GGGCCCCTCAGGCCAGGCAGGGG - Intergenic
1091447810 12:553996-554018 GCTCTCCTGGGGCCAGGGACTGG + Intronic
1091587831 12:1826415-1826437 GGGCTCCTGGTGCCAGTTGGCGG - Intronic
1091603257 12:1930404-1930426 TGGACCCTGGGGCCAGGCACAGG - Intergenic
1096113306 12:49041209-49041231 GGGCTCCAGGGGATAGGCAGGGG + Exonic
1096649582 12:53055463-53055485 GGGGTCCGGGGGCAAGGCTGGGG - Intronic
1096651467 12:53063951-53063973 GGTCTCCTGGGTCCAGGCCAGGG - Exonic
1097069278 12:56343106-56343128 GGGGTCCTGGGGGCAGGCCAGGG - Exonic
1097088596 12:56487911-56487933 AGGCTCCTGGGACAGGGCAGGGG - Intronic
1097247506 12:57614672-57614694 GAGCTCCTGGGGACAGGGACAGG - Exonic
1098243610 12:68492758-68492780 AGGCTCCTGGAGCCAGGCTACGG - Intergenic
1098956678 12:76695827-76695849 GGAATACTGTGGCCAGGCAGTGG + Intergenic
1100052843 12:90471272-90471294 TGGCTCCAGGGGCAGGGCAGTGG + Intergenic
1100591594 12:96035238-96035260 GGGGACGTGGGGCTAGGCAGGGG + Intronic
1101469044 12:104977833-104977855 GGGGTCCGGGGGCCTGGCCGCGG - Intergenic
1101916014 12:108896665-108896687 GGGCTCCTGGGGCCAAGAGGGGG + Intronic
1102005734 12:109588169-109588191 GGGCTCCTGAAGACAGGCCGGGG - Intronic
1102030473 12:109737394-109737416 GGGGTGTTGGAGCCAGGCAGGGG + Intronic
1102083065 12:110113974-110113996 GGTTGCCAGGGGCCAGGCAGAGG - Intergenic
1102506475 12:113387577-113387599 GGGGTCCGGGCCCCAGGCAGAGG + Intronic
1103063359 12:117876372-117876394 GGATCCCTGAGGCCAGGCAGAGG + Intronic
1103711803 12:122918234-122918256 GGGCTCCTGGGGCCATGGCGAGG - Intergenic
1103743537 12:123107234-123107256 AGGGTCCTGGGCCCAGGCAGTGG - Intronic
1103856414 12:123973405-123973427 GGGGGCCGGGGGCCAGGGAGCGG + Exonic
1103993014 12:124811829-124811851 GGGCCCCTGTCGCCAGGGAGAGG - Intronic
1104408724 12:128540710-128540732 GGACTCCTGTGGCCAAGCATGGG + Intronic
1104670495 12:130676844-130676866 GGGCTGCTGGGGTCAGGGTGAGG + Intronic
1105773974 13:23639478-23639500 GGGCTCCTGAGGGGAGGCAAAGG - Intronic
1106222160 13:27755246-27755268 GGGTTCCAGTGGCCAAGCAGAGG - Intergenic
1106437387 13:29735543-29735565 CGGCTGCTGGGGCCAGGCAAGGG - Intergenic
1106554175 13:30796056-30796078 AGACTCCTGGAGCCTGGCAGTGG + Intergenic
1107342034 13:39417741-39417763 GAGCTCCTGGGCCGGGGCAGGGG + Intronic
1107978620 13:45713820-45713842 GGCCTACTGGGCGCAGGCAGAGG + Exonic
1110208669 13:72947357-72947379 GGTTTCCTGGGGCCAGGCCCAGG - Intronic
1112325260 13:98439523-98439545 GGGCCCCTGGGGCCAGGCACAGG - Intronic
1112560336 13:100507306-100507328 GGGGCACTTGGGCCAGGCAGAGG + Intronic
1112811477 13:103223737-103223759 GGACTCCGGGGACCAGGCTGTGG + Intergenic
1113495553 13:110725627-110725649 GGCCTCCGGGTGCCAGGCGGTGG - Intergenic
1113647682 13:112010844-112010866 CTGCGCCTGAGGCCAGGCAGGGG - Intergenic
1113695602 13:112343275-112343297 GGGCCCGCGGGGCCAGGCCGGGG + Intergenic
1113702245 13:112396374-112396396 GGGCAAATGGGGGCAGGCAGAGG - Intronic
1114036657 14:18636044-18636066 GGGATCCTGTAGCCAGGCATTGG - Intergenic
1114121978 14:19678993-19679015 GGGATCCTGTAGCCAGGCATTGG + Intergenic
1114517322 14:23308398-23308420 GGGCTCATGGTCCCAAGCAGAGG + Intronic
1118381664 14:65222606-65222628 GGCCTCCTGGGGCCAGCCAGGGG + Intergenic
1118404843 14:65412871-65412893 GGTCGGCTGGGGCCAGGCGGCGG - Intronic
1118514267 14:66508773-66508795 CGGCTCCTGGGGCCTGGGGGAGG - Intronic
1118997540 14:70850291-70850313 GGGTTCCTGGGGCTGGGAAGAGG + Intergenic
1119175339 14:72564505-72564527 GGGATCCTTGGGCAAGGCTGGGG - Intronic
1119720318 14:76885563-76885585 GGGGTCCTGAGGCCAGGGAGTGG - Intergenic
1121020277 14:90575636-90575658 GGGCTCCTGGGGACAGGCTGGGG + Intronic
1121021929 14:90585514-90585536 GGGGTCCAGGGCACAGGCAGAGG - Intronic
1122113005 14:99514757-99514779 GGGGGCCTGGGGCCAGGCCACGG + Exonic
1122279080 14:100610653-100610675 GGCCTCCTGGAGCCAGGCCAAGG + Intergenic
1122292466 14:100687062-100687084 GGGATCCCGGGACCAGGAAGAGG - Intergenic
1122317712 14:100835687-100835709 TGGCTCCTGGGGCAGGGGAGTGG - Intergenic
1122364629 14:101187291-101187313 GGTCTGCTGGGGCCAGGTCGTGG + Intergenic
1122643694 14:103177520-103177542 GGCCTCCTGGGTGCAGGGAGGGG - Intergenic
1122655788 14:103258468-103258490 GGCCTCCTGGGTGCAGGAAGGGG + Intergenic
1122767547 14:104082427-104082449 TGGGGCCTGGGGCCAGGCAGAGG - Intergenic
1122858515 14:104571703-104571725 GGGCACGAGGGGCCAGGCTGGGG - Intronic
1122860948 14:104582153-104582175 GGGCGGCACGGGCCAGGCAGAGG + Intronic
1122920386 14:104877522-104877544 GGGCTCATGGGGCCAAGGTGGGG + Intronic
1122975827 14:105170366-105170388 GGGCCTCTGGAGCCGGGCAGGGG - Intergenic
1123047799 14:105527050-105527072 GGTCTCCTGGGCCCCGGCCGAGG - Intronic
1123067822 14:105627165-105627187 GGGGCCCTGGGGCCGAGCAGAGG - Intergenic
1123089055 14:105734080-105734102 GGGCTGCTGGGGGCGTGCAGGGG + Intergenic
1123477396 15:20599290-20599312 GGGCTCCTGGGGGCAGGGGAGGG + Intergenic
1123640620 15:22401092-22401114 GGGCTCCTGGGGGCAGGGGAGGG - Intergenic
1123941232 15:25217596-25217618 GGTCTCCTGGGGCCTGGTTGGGG + Intergenic
1124004251 15:25783876-25783898 GGGGTCCTCTGGCCATGCAGAGG + Intronic
1124340590 15:28886975-28886997 GGGCGCCATGGGCCGGGCAGCGG + Intronic
1125181187 15:36882420-36882442 GCGCTCCTAGGGCAAGGCAGAGG - Intergenic
1126097705 15:45100927-45100949 TGGCTCCTGGTACCAGGCAGGGG + Intronic
1126780957 15:52138478-52138500 GGGGTCCTGTGGACAGCCAGTGG - Intronic
1127142732 15:55993755-55993777 GCGCTCCTGGGGCTGGGCGGGGG + Intergenic
1127668120 15:61169123-61169145 GGATCCCTGGGGCCAGTCAGAGG - Intronic
1127671155 15:61196427-61196449 GGGCTTGTGAGGCCAGGCACAGG - Intronic
1127968906 15:63944058-63944080 GAGCTCCTGAGGCCAGGGATGGG - Intronic
1128308436 15:66615286-66615308 AGGCTTCCGGAGCCAGGCAGAGG + Intronic
1128378504 15:67094101-67094123 GGGGTCCTCAGGGCAGGCAGTGG + Intronic
1129198144 15:73983175-73983197 GGGCTCCTGGGGGCATGGGGTGG - Exonic
1129413979 15:75364612-75364634 GGGCTCCTGGGGGCCGGGAAGGG - Exonic
1129516499 15:76160631-76160653 GGGGTCACAGGGCCAGGCAGTGG + Intronic
1129671318 15:77609403-77609425 GGGCTCCTGATACCAGCCAGGGG + Intergenic
1129682117 15:77663851-77663873 TGAGTCCTGGGGCCTGGCAGAGG + Intronic
1129851488 15:78796430-78796452 AAGCTCCTGAGGCCAGGAAGGGG - Intronic
1130892191 15:88142554-88142576 ACAGTCCTGGGGCCAGGCAGTGG + Intronic
1131266569 15:90918902-90918924 GAGCTCCGGAGGCCTGGCAGGGG + Intronic
1131378891 15:91947803-91947825 TGGCTGCTAGGGCCAAGCAGGGG - Intronic
1131437425 15:92434568-92434590 TGGCGACTGGGGCCAGGCGGTGG + Intronic
1132204600 15:99977804-99977826 GGGCTCCTGGGAGAAAGCAGGGG - Intronic
1132251736 15:100340353-100340375 GAGCTCCTGGGGGCAGGAATAGG + Intronic
1132546625 16:536163-536185 GGCCTGCTGCGGCCAGCCAGAGG - Intronic
1132558903 16:584650-584672 GGGCAGCTGGGGGGAGGCAGGGG - Intergenic
1132649310 16:1013453-1013475 GGGCACCTGCGTGCAGGCAGAGG - Intergenic
1132673521 16:1112336-1112358 GGGCACCTGGGGCCTGCCGGGGG - Intergenic
1132695626 16:1200595-1200617 GGGACCCTGGGGCACGGCAGGGG + Intronic
1132743486 16:1427403-1427425 GGGCGGCCGGGGCCAGGCCGAGG - Intergenic
1132885268 16:2179595-2179617 GGGCTGCCAGGGCCTGGCAGCGG + Exonic
1132897621 16:2236490-2236512 GGGATCCCGGGTCCAGGCTGCGG - Exonic
1132993785 16:2812132-2812154 TTGCTCCTGGGGCCAAGCAGTGG - Intergenic
1133013578 16:2928751-2928773 GGGGGCCTGGGGGCAGTCAGTGG - Intronic
1133108769 16:3533199-3533221 GCCCTCCCGGGGCCAGCCAGGGG + Intronic
1133141379 16:3747091-3747113 GAGCTTTTGGAGCCAGGCAGGGG - Intronic
1133236417 16:4389316-4389338 GTCCTCCTGGGCCCTGGCAGTGG + Intronic
1133284632 16:4684873-4684895 TGGGCCCTGGGGCCAGGAAGCGG - Intronic
1133867255 16:9655753-9655775 GAGGTCCTGGGGCCAGGGAAGGG + Intergenic
1134285892 16:12862050-12862072 GGACTCTTGGGGTCAGGCTGGGG - Intergenic
1134615797 16:15650365-15650387 GGGATCCTGGGGCGGGGCAGAGG - Intronic
1134629018 16:15743583-15743605 GGCTTCCTTGTGCCAGGCAGGGG - Intronic
1135197232 16:20404521-20404543 GGGTTCCTGGGGCCAAGGTGGGG + Exonic
1135496559 16:22956714-22956736 GGGCTCCTGGGGTCACTCTGTGG - Intergenic
1135561889 16:23483057-23483079 AGGCTCCTGGGGCCCTGGAGGGG - Intronic
1136412102 16:30083581-30083603 GGGCTCCATGGGACAGGGAGAGG + Intronic
1136552574 16:30989478-30989500 GGACTCCTGGGGCCTGGCTGGGG - Exonic
1137003652 16:35252283-35252305 GGGCTCTGGGGGGCAGGCTGGGG - Intergenic
1137251135 16:46741691-46741713 GGGCTTCTGTGGCAAGGCAGGGG - Intronic
1137270240 16:46898243-46898265 GGCCTCCTGGGGCCCAGCACAGG + Intronic
1137270969 16:46901963-46901985 TTGCCCTTGGGGCCAGGCAGAGG - Intronic
1137725610 16:50654812-50654834 GGGCTGTGGGTGCCAGGCAGGGG - Intergenic
1138350404 16:56343574-56343596 GGGGTCCTGGATCCAGTCAGTGG - Intronic
1138583391 16:57955991-57956013 AGGCTCATGGGGACAGGGAGAGG - Intronic
1139364535 16:66425806-66425828 GCTTCCCTGGGGCCAGGCAGGGG - Intergenic
1139454670 16:67063714-67063736 GAGCTGCTGCGGCCAGCCAGAGG + Intronic
1139509906 16:67421543-67421565 GGGCTCCTGGGAGCTGCCAGAGG + Intergenic
1139570086 16:67806361-67806383 GGGCTCCAGGAGCGCGGCAGCGG + Exonic
1139752916 16:69120058-69120080 GGCCTCTTGGGGCCAGGCCCAGG - Exonic
1139911142 16:70398407-70398429 GGGCCCCTGAGTCCAGGTAGGGG + Exonic
1140457148 16:75112147-75112169 AGGCTCCTGGGGCCAGCCAGAGG + Exonic
1141120863 16:81355108-81355130 AGGCACCTGAGGCCTGGCAGAGG - Intronic
1141203648 16:81915789-81915811 GAGCTCCTCAGGGCAGGCAGGGG - Intronic
1141205965 16:81933384-81933406 GGGCACTTAGGGACAGGCAGAGG - Intronic
1141464361 16:84196379-84196401 GGCCCCCTGGGGCCGGGCTGTGG + Intronic
1141666880 16:85470250-85470272 GGGCACCTGGGGCCAGCCAGCGG + Intergenic
1141718485 16:85741233-85741255 GCGTTCCTGGGGCCAGGCTCTGG + Intronic
1141879199 16:86846674-86846696 GGGACCCTGGGGACAAGCAGAGG - Intergenic
1141892410 16:86935276-86935298 GGGATCCTGGGGCTGGGAAGGGG - Intergenic
1141910777 16:87056999-87057021 GGGATTCTGGAGCCAGGCAGGGG + Intergenic
1141959999 16:87399297-87399319 TGGCACCTGAGGCCAGCCAGTGG - Intronic
1141968696 16:87465017-87465039 AGGTTGCAGGGGCCAGGCAGAGG - Intronic
1142060787 16:88027811-88027833 GGGCGCACGGGGCCAGGCACAGG - Intronic
1142228228 16:88887700-88887722 GGGCTCCTGGGGACAGAGTGGGG - Intronic
1142260784 16:89041645-89041667 GGGCTGGTGGGGCCAGACAGCGG - Intergenic
1142293120 16:89201710-89201732 GGGCTCCTGGGGCGGGGCTTTGG + Intergenic
1142376906 16:89711254-89711276 CGGCACCTGGCACCAGGCAGAGG + Intronic
1142493491 17:293474-293496 GGGCTCCGGGGGTGGGGCAGCGG + Intronic
1143248577 17:5505397-5505419 GGGCTCCACGGGGCAGACAGTGG + Intronic
1143476808 17:7207917-7207939 GGGCTCCTGGGGTCTGGGGGAGG - Intronic
1143725689 17:8843864-8843886 TGCCTCCAGGGGCCAGGCAGAGG - Intronic
1143894935 17:10128345-10128367 TGGCTCCTGGGAGCAGCCAGAGG - Intronic
1145241514 17:21243243-21243265 GAGCACGTGGGGCCAGGCAAAGG + Exonic
1145269279 17:21396086-21396108 GGGCCCCCGGGCGCAGGCAGGGG + Intronic
1145289305 17:21530635-21530657 GGGATGCTGGGGCCAGGATGTGG - Exonic
1145755923 17:27390021-27390043 GGCCTCCTGGGGCCTGGTGGAGG - Intergenic
1145974004 17:28973852-28973874 GGGACCTGGGGGCCAGGCAGGGG + Intronic
1146059682 17:29597931-29597953 GGAGCCCTGAGGCCAGGCAGCGG + Intronic
1146163413 17:30571683-30571705 GGGCTCCTCCGGCCTGGGAGTGG - Intergenic
1146457813 17:33020860-33020882 AGGATCCTGGGGCCATGGAGAGG - Intronic
1146653649 17:34622575-34622597 GGGCTCCTGGCACCAGGCCTAGG - Intronic
1146735165 17:35232612-35232634 GGCCTACAGGGGCCATGCAGGGG - Intergenic
1147051222 17:37796440-37796462 TTGCTGCTGTGGCCAGGCAGAGG - Intergenic
1147051301 17:37796851-37796873 TTGCTGCTGTGGCCAGGCAGAGG - Intergenic
1147161127 17:38569896-38569918 GGACACGTGGGGGCAGGCAGAGG + Intronic
1147216830 17:38905236-38905258 GTGCTCCTTGGGCCGGGCCGTGG + Intronic
1147265283 17:39231091-39231113 GGGCTGGTGGGGGGAGGCAGGGG - Intergenic
1147382209 17:40062762-40062784 GGGGTCCCGGGGCGCGGCAGGGG + Intronic
1147402673 17:40190590-40190612 GGGCTCCTGGTGGCAGGGTGAGG - Intronic
1147402684 17:40190623-40190645 GGGCACCTGGTGGCAGGCAGGGG - Exonic
1147445266 17:40471446-40471468 AGGCTCCCAGGGCCAGCCAGGGG - Intergenic
1147562803 17:41519440-41519462 GGGCCCCTGGGGGCAGGTGGAGG + Exonic
1147635580 17:41961910-41961932 GGGCTCCTCTGGGGAGGCAGAGG + Intronic
1147880724 17:43651734-43651756 GGGCACTTGGGCCCAGGGAGGGG - Intronic
1147938231 17:44025916-44025938 GGGCTCCTAGAGCAAGGCAGAGG - Intergenic
1147946765 17:44084759-44084781 GATCTCCTGAGGCCAGGAAGTGG - Intronic
1148242664 17:46010745-46010767 GGGCTCCTGGGGACAGGGCTGGG - Intronic
1148326336 17:46785493-46785515 GGGCTCCTGGGGCCTGTCCTCGG - Intronic
1148328910 17:46801245-46801267 GGGCGGCAGGGGCCAGGCTGAGG + Intronic
1148478048 17:47941908-47941930 GGGCTTCTGGGGCCACCCGGTGG + Intronic
1148493382 17:48037526-48037548 CGGGTCCTGGGGCCAGTCAGGGG + Intronic
1148674712 17:49438685-49438707 GGGGGCCTGTGGCCAGGCACGGG - Intronic
1148690680 17:49525119-49525141 GGGCTGAGGGGTCCAGGCAGGGG - Intergenic
1148808724 17:50277506-50277528 GGGGAGCTGGGGCCAGCCAGGGG + Intronic
1148849971 17:50549896-50549918 GGAGGCCTTGGGCCAGGCAGAGG - Intronic
1150213475 17:63454192-63454214 GGACTTCTGGGGCCAGGCTGAGG - Intergenic
1150213554 17:63454722-63454744 GGGCTTGGGGGGCCACGCAGGGG + Intergenic
1150302492 17:64057892-64057914 GGGGGCCTCGGGCCGGGCAGGGG + Exonic
1151331349 17:73411063-73411085 GGGACCCTGGGGGGAGGCAGAGG - Intronic
1151389713 17:73777741-73777763 AGGCCCTTGAGGCCAGGCAGTGG - Intergenic
1151561461 17:74872128-74872150 AGAAGCCTGGGGCCAGGCAGAGG + Exonic
1151679123 17:75614619-75614641 GGGGTCCTGGGGGCAGTGAGGGG - Intergenic
1151724933 17:75878252-75878274 GGGCTCCGGGGCCAGGGCAGGGG + Exonic
1151728985 17:75899928-75899950 CGGCTCCCGGGGCCTGGAAGCGG - Intronic
1152235763 17:79137576-79137598 AGGCCCCGGGGGGCAGGCAGTGG - Intronic
1152321593 17:79611006-79611028 GAGCTGCTGGGGCCCGGCTGGGG + Intergenic
1152330504 17:79669949-79669971 GGGCTCCTGGGGAGAAGCTGTGG + Intergenic
1152360031 17:79828409-79828431 GGGCTCCTGGGGGCAGCCCTGGG + Intergenic
1152511602 17:80793517-80793539 GGGCTCCTGCTACCAGGCGGAGG - Intronic
1152612411 17:81322354-81322376 GGGCACCGGGAGCCAGGCTGCGG - Intronic
1152637410 17:81435780-81435802 GGGCTGCTGCGGCCGGGCCGGGG - Intronic
1152794177 17:82298759-82298781 GGGCTCCAGGGGGGCGGCAGGGG + Intergenic
1152844792 17:82593187-82593209 GGTCTCCCTGTGCCAGGCAGAGG + Intronic
1152844800 17:82593238-82593260 GGTCTCCCTGTGCCAGGCAGAGG + Intronic
1153653247 18:7260179-7260201 GGGCTCCTGAGCACAGGGAGTGG + Intergenic
1153907924 18:9679339-9679361 GGGGTCCGGGGGCCTGGCTGTGG - Intergenic
1154151395 18:11908922-11908944 GGGCTTCTGGGGCGCGGAAGCGG - Exonic
1154198262 18:12281691-12281713 GGGCTCATGTGCCAAGGCAGTGG + Intergenic
1154529788 18:15331542-15331564 GGGATCCTGAGGCCTGGCAGCGG - Intergenic
1156468800 18:37364498-37364520 GGGCTCCAGGCTCCAGGCTGTGG + Intronic
1156859467 18:41818959-41818981 GGGATGCTGGGGCTTGGCAGCGG + Intergenic
1157094625 18:44676712-44676734 GGGCTCCTGGGCCCTGGAAATGG + Intergenic
1157197416 18:45630787-45630809 GGGCAGCTGGAGACAGGCAGTGG - Intronic
1157411355 18:47465786-47465808 GGGCTCCAGGGGACAGAGAGTGG + Intergenic
1157687085 18:49651166-49651188 GTGCCCCTGGGGCCTGGCATGGG + Intergenic
1159743810 18:72207656-72207678 GAGCTCCTGTGGCCAGCTAGTGG + Intergenic
1160237436 18:77097263-77097285 GGTCTGCAGGAGCCAGGCAGAGG + Intronic
1160335127 18:78031772-78031794 GGTCTCCTGGGGCCCAGCTGGGG - Intergenic
1160499593 18:79395507-79395529 GGAATCCGGGGGCCGGGCAGGGG - Intergenic
1160523596 18:79522741-79522763 GGACTCCTGGGGCCAGGAGCTGG + Intronic
1160540935 18:79622165-79622187 CGGCTGCGGGAGCCAGGCAGAGG - Intergenic
1160717436 19:582681-582703 GGGCTCCTGGGTCCCGCCTGTGG + Intronic
1160732981 19:649588-649610 GGCTTCGTGGGTCCAGGCAGTGG + Intronic
1160738144 19:674135-674157 GGGCCGCAGGGGCCAGGCTGCGG + Intergenic
1160756179 19:758140-758162 GGGCATCTGGGGCCGGGCTGAGG - Exonic
1160813990 19:1027001-1027023 GGGGTCCTGGGGCCATGGCGAGG - Intronic
1160975266 19:1789842-1789864 GGGGTCCCGGCGCCAGGGAGGGG - Intronic
1161007844 19:1945259-1945281 GGGAGCCTGGGGCCAGCCCGGGG - Intronic
1161137333 19:2627368-2627390 GTGCCCCTGGAGCCATGCAGGGG - Intronic
1161370967 19:3910752-3910774 GGGCTCCTGGGGCGAGCCCTGGG - Intronic
1161406730 19:4095086-4095108 GGGGTCCGGGGACCAGACAGAGG + Intronic
1161726535 19:5932581-5932603 AAGCGCCTGGGGGCAGGCAGGGG - Intronic
1161770570 19:6228695-6228717 GGCTTCCCGGGACCAGGCAGTGG - Intronic
1161851488 19:6740033-6740055 GGAATCCTGGGGCCAGGCCGGGG + Intronic
1162039095 19:7958454-7958476 GGGCTCCCGGGACCTGGCACAGG + Intergenic
1162281336 19:9700345-9700367 GGGGTCCTGGAGACAGGCGGGGG - Intronic
1162500413 19:11050316-11050338 GGGCTGCTGCCTCCAGGCAGTGG - Intronic
1162558977 19:11405075-11405097 AGGGACTTGGGGCCAGGCAGGGG - Intronic
1162584824 19:11552272-11552294 GGGCTCATGAGGCCAGGTGGAGG + Intronic
1162747474 19:12806803-12806825 GCGCCCCTAGGGCCAGGGAGGGG + Intronic
1162806199 19:13139098-13139120 GGTCTCCTGGGGGCAGACCGAGG + Exonic
1162971446 19:14183506-14183528 GTGCTGCTGGGGCCGGGGAGGGG - Intronic
1163499356 19:17666655-17666677 TGGTTGCTGGGGACAGGCAGAGG + Exonic
1163510622 19:17733140-17733162 GAGCTCCTGGGGCTGGGGAGGGG - Intronic
1163518803 19:17779972-17779994 GGGCTCCTGGGGGCTGTCTGAGG + Intronic
1163612194 19:18307507-18307529 GGGATCCCGGGCACAGGCAGAGG - Exonic
1164590737 19:29505409-29505431 GGGCAGGTGGGGCCAGGAAGAGG + Intergenic
1164769692 19:30799190-30799212 GGAGTCCAGGGGCCAGGCTGGGG - Intergenic
1164799363 19:31063300-31063322 GGGCACCTGGGGTAAAGCAGAGG + Intergenic
1164833132 19:31338348-31338370 GGTCTGCTGGGGCCCTGCAGAGG + Intronic
1165062468 19:33211532-33211554 AGGTTCCTGGTGACAGGCAGTGG + Exonic
1165700245 19:37932119-37932141 GGGCTCCTTGGCCCGTGCAGAGG - Intronic
1165749872 19:38253192-38253214 GGGCCCATGGGCCCAGGCATCGG - Intronic
1165941549 19:39417009-39417031 GGGCCCCTGGAGCCAGGCTGGGG + Intronic
1166080602 19:40441838-40441860 GGGCTCGGGGGGCAGGGCAGGGG + Exonic
1166142042 19:40810490-40810512 GGGCTCCTGGGGGTAGGAACAGG + Intronic
1166185478 19:41136304-41136326 GGGCTCCTGGGGGTAGGAACAGG - Intergenic
1166185675 19:41137326-41137348 GGGCACCTTTGGCCAGACAGTGG - Intergenic
1166300136 19:41908407-41908429 GCGCCCCTCGGGCCTGGCAGCGG - Intronic
1166391729 19:42412309-42412331 TAGGTCCTGGGGCCTGGCAGCGG + Intronic
1166410313 19:42552318-42552340 GGGCTGGAGGGGCCAGGTAGAGG + Intronic
1166423965 19:42659562-42659584 GGAATACTGGGACCAGGCAGAGG + Intronic
1166663279 19:44661394-44661416 AGGCTCCTGAGGCCGGGCCGTGG - Intronic
1166984642 19:46652620-46652642 GGGGCCCTGGGGCCAGGGAAAGG - Intronic
1167006433 19:46779053-46779075 GGGCTTCAGGGGCCAGGCCTGGG - Intronic
1167645403 19:50702819-50702841 GGGCAGCTGCGGGCAGGCAGAGG - Intronic
1167752459 19:51389105-51389127 GGGGTCCTGGGGCCAGCCCCAGG + Exonic
1167913937 19:52725310-52725332 AGGCTCCCAGGACCAGGCAGAGG + Intronic
1167999366 19:53432401-53432423 AGGATCCTAGGACCAGGCAGAGG - Intronic
1168107633 19:54174142-54174164 GGGCTGCCAGGGCCAGGAAGTGG + Exonic
1168240490 19:55086646-55086668 GGGGTCCTGGGGCCAGAGGGCGG - Intronic
1168335201 19:55593376-55593398 GGGCAGCTGGGGGCTGGCAGAGG - Exonic
1168554141 19:57323895-57323917 AGGCTCCTGGCACCACGCAGGGG + Intronic
925353887 2:3223677-3223699 GGGCTGCTGGGGCCAGGTCAAGG + Intronic
925411408 2:3641931-3641953 CCGATCCTGGGGACAGGCAGAGG + Intronic
925436553 2:3843179-3843201 GGAGTCCTGGACCCAGGCAGGGG + Intronic
925732486 2:6929395-6929417 GGGCTCCTGGAGCTAAGCCGTGG + Intronic
925745729 2:7042013-7042035 GAGATTCTGGGGCCAGCCAGGGG + Exonic
925923309 2:8652681-8652703 GGGCTCCTGGGTCCTGGAAATGG - Intergenic
926062201 2:9811765-9811787 CGCCTCGTGGGGACAGGCAGAGG + Intergenic
926172150 2:10559190-10559212 GGGGTCCTGGGGCTGGGCAGGGG - Intergenic
926631892 2:15144132-15144154 GGGCCCTGGGGGCCAGGCTGTGG - Intergenic
926678951 2:15649654-15649676 GGGCTGCTGGAGCCTGGCAGGGG - Intergenic
927393292 2:22620599-22620621 GGGCTTCTGAGGCCAGGCCCAGG + Intergenic
927475379 2:23410486-23410508 GGACTCCTGAGGCATGGCAGTGG + Intronic
927708455 2:25311169-25311191 GGCCACATGGGGCCAGGCAGTGG + Intronic
927791259 2:26011565-26011587 GGGCTCCTGGAGACCTGCAGAGG + Intergenic
927930473 2:27040457-27040479 GTGCTCCTGGGCCCAGGCCAGGG - Exonic
927940918 2:27102327-27102349 GGGCTGATGGGGCCAGGGACGGG - Intronic
928495133 2:31823665-31823687 CGGCTACTGGGGACAGGCTGAGG - Intergenic
928872150 2:35992597-35992619 GGAGTCCTGGGGCGGGGCAGAGG + Intergenic
929560854 2:42955573-42955595 GAGCTCTTGGGGGCAGGAAGGGG - Intergenic
929950854 2:46408669-46408691 GGGCATCTGGGGCTGGGCAGAGG + Intergenic
930203828 2:48568881-48568903 GAGCTCCTGGCTCCAGGAAGTGG + Intronic
930896427 2:56451959-56451981 GGCCTCCTGGGGCCCAGAAGAGG - Intergenic
930897656 2:56464290-56464312 GGCCTCTTGGGGTCAGGCACTGG - Intergenic
931254348 2:60556833-60556855 GGGCACCAGGGGCCGGGGAGGGG - Intergenic
935250012 2:101252924-101252946 GGGCCCCTCGGGCCGGGAAGAGG + Exonic
935305665 2:101733924-101733946 GGACTGCTGTGGCCAGGCTGTGG - Intronic
935351504 2:102155026-102155048 GAGCTCCTGGAGCCAGGCCCTGG + Intronic
935926037 2:108069712-108069734 GGGCTCCTGCAGGCAGGAAGAGG + Intergenic
936119379 2:109728169-109728191 TGGCTTCTGAGGCAAGGCAGAGG - Intergenic
936231088 2:110700075-110700097 GGGCTCCTGGGCCCTGGTGGAGG + Intergenic
936543959 2:113374159-113374181 GGTTTCCTGGGGCCAGGCCGAGG - Intergenic
936556838 2:113503686-113503708 GGGCTCCTGGGGACCGCGAGAGG - Intergenic
937242943 2:120474265-120474287 GGGCTGCTGGGGCCAGTGGGGGG + Intergenic
937449120 2:121986370-121986392 CTGCTCCTGGGGACAAGCAGTGG + Intergenic
937467362 2:122146157-122146179 GGCCAGCTGGGGCCAGGGAGTGG - Intergenic
937869480 2:126777112-126777134 TGGACCCTGGGGCCACGCAGGGG + Intergenic
938528882 2:132162982-132163004 GGGATCCTGAGGCCTGGCAGCGG - Intronic
938722680 2:134080224-134080246 AGGCTCCTGGGACCAGGACGGGG + Intergenic
940332597 2:152491302-152491324 AGGGTCAGGGGGCCAGGCAGGGG + Intronic
941383544 2:164824991-164825013 GGGGTCATGTGGCCAGGCAGTGG - Intronic
942248174 2:174026036-174026058 GGCCTCCTGGGCCCTGGCTGCGG - Intergenic
942250165 2:174040460-174040482 GGGCTCCTGGGATCAAGCGGAGG + Intergenic
943544234 2:189254709-189254731 TGGCCCCTGGTGACAGGCAGAGG - Intergenic
944873269 2:203935344-203935366 GGGCTCCTGGGTCTCAGCAGTGG - Intergenic
946053177 2:216880711-216880733 AGGCTCCTGGAGGCAGGAAGGGG - Intergenic
946134076 2:217631285-217631307 GGGCTGCTGGGGAAAGCCAGTGG + Intronic
946167732 2:217875727-217875749 GGATTCCTGGCTCCAGGCAGAGG + Intronic
946194006 2:218022574-218022596 GTGCTCCCAAGGCCAGGCAGGGG - Intergenic
946231227 2:218292325-218292347 GGGCTCCTTGGGCCCAGGAGCGG + Intronic
946398031 2:219453123-219453145 GGGGTCCTGGAGCCAGGCCTGGG - Intronic
946409147 2:219507808-219507830 GGGGTCCTGGCAGCAGGCAGGGG + Intergenic
946410478 2:219512996-219513018 CCTCCCCTGGGGCCAGGCAGAGG + Intergenic
946727022 2:222671393-222671415 GGGCTCCTGCCGCCTGGCTGAGG - Intergenic
947645604 2:231737102-231737124 GGACTCCTGGTGCCATTCAGTGG - Intronic
947729432 2:232419893-232419915 GGCCCCCCGGGGCCATGCAGAGG - Intergenic
948054177 2:234998975-234998997 GGGCACTTGAGGCCATGCAGCGG + Intronic
948425557 2:237884905-237884927 GGGCTCCAGGCCCCAGGGAGTGG + Intronic
948482958 2:238261934-238261956 GGGCTGCAGGGGAGAGGCAGAGG - Intronic
948604024 2:239123435-239123457 GGGCAGCAGGGGCCAGGCTGTGG + Intronic
948641787 2:239379683-239379705 GGGCTCCTTGGGGCTGCCAGGGG - Intronic
948692796 2:239717477-239717499 GGGCACCTGGGACGAGTCAGGGG - Intergenic
948765197 2:240215857-240215879 GGGTGCCTGGGGCCAGCCTGAGG - Intergenic
948868392 2:240786539-240786561 GGGCCCCTGAGGCGAGGGAGTGG + Intronic
948871131 2:240798754-240798776 GGGCTCCTGGGCACAGGGACAGG + Intronic
948904942 2:240975297-240975319 GGGACTCTGGGGCCAGACAGAGG - Intronic
1169123236 20:3109850-3109872 TGGGTCCTGGGCTCAGGCAGGGG + Exonic
1169221251 20:3824313-3824335 GTGCTTCTGAGGGCAGGCAGAGG + Exonic
1169379812 20:5096624-5096646 GGGCTCCTTGGCCTGGGCAGAGG + Intronic
1169849637 20:10035184-10035206 GGGCTCCCGGAGCCCGGCGGAGG - Exonic
1170570576 20:17629956-17629978 GGACGCCTGGGGACGGGCAGGGG + Exonic
1170781655 20:19430980-19431002 GGGGTCCTGAGGGCAGGCAGAGG - Intronic
1172081032 20:32340758-32340780 GGGCAGCTTGGACCAGGCAGTGG + Intergenic
1172389072 20:34553955-34553977 GGGCTCCTGGGCACACACAGTGG + Intronic
1172443072 20:34979258-34979280 GAACTCCTGGGTCCTGGCAGAGG + Intronic
1172711637 20:36929173-36929195 AGGCTCCTGGGGACTGGCAAAGG + Intronic
1172836911 20:37878977-37878999 AGGCTCCCAGGGCCAGCCAGGGG - Intergenic
1172924373 20:38517874-38517896 GGTCTCCGAGGGGCAGGCAGTGG - Exonic
1173077128 20:39829824-39829846 GGTGTACTGGGGGCAGGCAGGGG - Intergenic
1173160295 20:40647362-40647384 GGGCTCCAGAGGCCAGGTTGAGG + Intergenic
1173392123 20:42644680-42644702 GTGCTCCTGGGGCCAGGCTCTGG - Intronic
1173732498 20:45338494-45338516 TGGCTCCTGGGGGCAGTGAGGGG - Intronic
1173809656 20:45948173-45948195 GACCTCCTGAGCCCAGGCAGAGG - Intergenic
1174049354 20:47757103-47757125 AGGCTCCTGAGGCAAGGCGGTGG - Intronic
1174306304 20:49616490-49616512 GGGCTTCCAGGTCCAGGCAGAGG - Intergenic
1175167256 20:57053674-57053696 AGGCTCCTGGAGACAGGCACAGG - Intergenic
1175174413 20:57102362-57102384 GGGCTCCTGAGGCCTGGCATTGG + Intergenic
1175257711 20:57657082-57657104 GGGATCCTGCTGCCAGGAAGGGG - Intronic
1175539714 20:59740922-59740944 GGCCTCCTTGGGGCAGCCAGTGG + Intronic
1175708132 20:61196439-61196461 GGGCAGCAGGAGCCAGGCAGGGG - Intergenic
1175715522 20:61252475-61252497 GGGCTCCCGGTGCCGGGCACCGG + Exonic
1175783059 20:61695932-61695954 GGGTGCCTGAGGCCTGGCAGCGG - Intronic
1175795091 20:61766115-61766137 GGGCTCCTGGACCCAGACCGAGG - Intronic
1175800462 20:61798330-61798352 AGGCCCGTGGGGCCAGGGAGAGG - Intronic
1175846800 20:62064074-62064096 GGGCTCCCTGGGCCAGGCGATGG - Intronic
1175898512 20:62350815-62350837 GTGCTCCTGAGGCCGGGCTGGGG + Intronic
1175904041 20:62371180-62371202 AGGGGCCAGGGGCCAGGCAGCGG - Intergenic
1175905310 20:62376675-62376697 GGCCGCCTGGGGGCAGGCCGAGG - Intergenic
1175924027 20:62463225-62463247 GGGCACCTGGGGGGACGCAGGGG + Intergenic
1175929676 20:62487807-62487829 GGCCTGCAGGGGCCAGGGAGGGG - Intergenic
1175940996 20:62537489-62537511 GCGTTCCTGGGGCCTGGCAGGGG - Intergenic
1176050715 20:63118120-63118142 GGCCTCCTGGGGGCTGGAAGTGG - Intergenic
1176092754 20:63326195-63326217 GTGTTCCAGGGGTCAGGCAGAGG + Intronic
1176107165 20:63394874-63394896 GGGGTCCTGAGTCCAGGCGGGGG + Intergenic
1176125054 20:63471569-63471591 GGGTTCGCGGGGCCAGGGAGGGG + Intronic
1176127994 20:63484468-63484490 TGGCACCTGAGGCCAGGCAATGG - Intergenic
1176149982 20:63585820-63585842 CGGCTCCTGGGGACACTCAGTGG + Intergenic
1176157373 20:63628301-63628323 GGGATCCTGCAGACAGGCAGCGG - Intergenic
1176232528 20:64039489-64039511 GGGTTCCAGGGGCCAGAAAGCGG - Intronic
1176767623 21:13036930-13036952 GGGATCCTGAGGCCTGGCAGCGG + Intergenic
1177166306 21:17608762-17608784 GGCCTCCTGTGTCCAGGCAGTGG + Intronic
1177887799 21:26766662-26766684 GGCCTCCTGGGACCAAGCAAGGG + Intergenic
1177943621 21:27440917-27440939 GGGATCATGGAGACAGGCAGAGG - Intergenic
1179171675 21:38977672-38977694 GGGCTCCAGGAGGCAGGCATGGG + Intergenic
1179717972 21:43299757-43299779 GAGCTCCTGGGGAAAGGCTGGGG - Intergenic
1179954030 21:44727921-44727943 GGGCTCCCAGGGCCTGGCACTGG + Intergenic
1179961572 21:44770058-44770080 GGGCCCCTGGGCCCAGGCTGGGG - Exonic
1180041754 21:45283769-45283791 GGCCTGCTGCAGCCAGGCAGGGG - Intronic
1180131402 21:45829384-45829406 GGGAGCCCGGGACCAGGCAGAGG + Intronic
1180460783 22:15563092-15563114 GGGATCCTGTAGCCAGGCATTGG - Intergenic
1180581675 22:16844721-16844743 GGCCTCCTGGTGCCCAGCAGGGG + Intergenic
1180834786 22:18924548-18924570 GGGCTGCTGGGGCCAGCATGGGG + Intronic
1180847601 22:18992586-18992608 GGGCTCCTGGGCCCAGTCTCTGG - Intergenic
1181055379 22:20258377-20258399 GGACACCTTGGGCAAGGCAGTGG - Intronic
1181065076 22:20301789-20301811 GGGCTGCTGGGGCCAGCATGGGG - Intergenic
1181370451 22:22410855-22410877 GGGCTGCTGGGGTTAGTCAGAGG - Intergenic
1181414526 22:22749785-22749807 GGGCTCCTGAGCCTTGGCAGAGG - Intronic
1181423411 22:22817584-22817606 GGCCTCCTGGGTCCAGGCATAGG - Intronic
1181590534 22:23882475-23882497 GGGCTCCGGGGACTTGGCAGGGG + Exonic
1181696307 22:24594540-24594562 GGGCCCCTGAGACAAGGCAGAGG + Intronic
1181851103 22:25750575-25750597 AGGTTCCTGGAGGCAGGCAGAGG - Intronic
1182449829 22:30412936-30412958 GAGCTCCTGGTGTCTGGCAGAGG + Intronic
1183032674 22:35117473-35117495 GGGGTGCTGAGGGCAGGCAGAGG - Intergenic
1183294750 22:37022893-37022915 GGGCCCCTTCTGCCAGGCAGAGG - Intronic
1183411159 22:37655643-37655665 AGGCTCCTGGGGCGGGGCTGAGG - Exonic
1183505318 22:38205511-38205533 GGACTGGTGGGGCCAGGGAGGGG + Intronic
1183508680 22:38222849-38222871 TGCCTCCTGGGGCCTGGCAGGGG + Intronic
1183583811 22:38740603-38740625 TAGCTCCTTGGGACAGGCAGGGG - Intronic
1184119618 22:42441360-42441382 GGCCTCCTGGGGCCCAGAAGGGG - Intergenic
1184149382 22:42629540-42629562 GGGCTCCTGAGGCCAGGCCTGGG + Intronic
1184387028 22:44182181-44182203 GAGGCCCTGGGGCCAGGAAGGGG + Intronic
1184452611 22:44591877-44591899 GGCCTCCTGGTGCCAGGGGGAGG - Intergenic
1184473575 22:44709130-44709152 GGGGGCCTGGGGCCAGTGAGGGG + Intronic
1184488784 22:44797047-44797069 TGGACCCTGGGGCCTGGCAGGGG + Intronic
1184620421 22:45672242-45672264 CGGCGCCTGGGTCCAGGCCGGGG - Intronic
1184736002 22:46398172-46398194 TGGCTCCAGGGGACAGGCACGGG + Intronic
1184960405 22:47924417-47924439 GGACTCATGGGGCCAGGAACAGG - Intergenic
1185080627 22:48707631-48707653 GGGCACCTGGGTCCTGGCACTGG - Intronic
1185173816 22:49307847-49307869 GGGCTCCTGAGGGCAGTGAGGGG + Intergenic
1185206582 22:49542155-49542177 GGGTGCCTGGGGCCAGGCTTCGG - Intronic
1185211760 22:49574472-49574494 GGACTCCAGGGGCCAGGAAGAGG - Intronic
1185399789 22:50609871-50609893 GGTCTCCAGTAGCCAGGCAGAGG + Intronic
1203284875 22_KI270734v1_random:149847-149869 GGGCTGCTGGGGCCAGCATGGGG + Intergenic
949943512 3:9172670-9172692 CAGCTCCTGGGGCCAGAAAGGGG - Intronic
949998568 3:9638664-9638686 GGTCTCCTGGGGAAAAGCAGAGG - Intergenic
950305933 3:11915381-11915403 GGGGTCCTGGGGACCCGCAGGGG + Intergenic
950452120 3:13071467-13071489 AGGCTCCTGGGCCCAGGCAAAGG + Intronic
950570603 3:13797471-13797493 GGGGTTTTGGGGCCAGACAGTGG - Intergenic
950613041 3:14138384-14138406 AGGCTCCTGCGGGCAGACAGTGG + Intronic
950628826 3:14267870-14267892 AGGCTCCAGGGCTCAGGCAGGGG - Intergenic
950870108 3:16220832-16220854 GGGTTCCTGGGGGCAGGCTGTGG + Intronic
953366803 3:42352194-42352216 AGGCTCCTGGGACTAGGGAGTGG + Intergenic
953747058 3:45583216-45583238 GGGCTCCAGCAGCCTGGCAGAGG + Intronic
954030856 3:47818879-47818901 GGGCTCCTTCTGCTAGGCAGAGG - Intronic
954377881 3:50204585-50204607 GGTGTCCTGGGGACAGACAGGGG - Intergenic
954583733 3:51717576-51717598 GGGGTCCTGGGGTCAGGCCCAGG + Intronic
954868938 3:53752184-53752206 GGCCTCCTGTGGCCAGCTAGTGG + Intronic
955223810 3:57044810-57044832 GGCATCCTGGAACCAGGCAGGGG - Intronic
955406158 3:58627022-58627044 GGGCTGCAGGGGCCAGGCTGGGG + Exonic
955410100 3:58649938-58649960 GGGGCCCAGGGGCCAGGCACCGG - Intronic
958466395 3:94464787-94464809 TGGCTTCTGAGGCCAGGCAGAGG - Intergenic
960143471 3:114173526-114173548 GGGTTCCTGGGGCCAAGTGGTGG + Intronic
961358082 3:126351501-126351523 GCGGTCTAGGGGCCAGGCAGCGG - Intronic
961379439 3:126487566-126487588 TGGCCACTGGAGCCAGGCAGGGG + Intronic
961414544 3:126747850-126747872 GGGCTCCTGGGGGCCGCTAGAGG + Intronic
961468798 3:127098337-127098359 GGGCTCCTGGGGGCAGGCAGCGG + Intergenic
961551260 3:127671836-127671858 GGGCTGGTGGTGCCAGGGAGGGG - Intronic
961579616 3:127869340-127869362 GGGCACCTGAGCCCAGGCAGTGG - Intergenic
961634759 3:128326233-128326255 TGGCTCCTGGGCCCAGCCTGTGG + Intronic
963732437 3:148986663-148986685 GGGCTCCAGGGGTTAGGGAGGGG + Intergenic
964743145 3:159988288-159988310 AGGCTCCCGGGAGCAGGCAGGGG - Intergenic
966823376 3:183942848-183942870 TCCCTCCTGGGGCCAGTCAGGGG + Exonic
966874596 3:184314950-184314972 GGCCTCCTCGGGTCAGGCCGAGG - Intronic
966878773 3:184338190-184338212 GGGCCCCTGGGGCCATTCTGTGG - Intronic
967074620 3:185990877-185990899 GGGCTCCTGGATGCTGGCAGTGG - Intergenic
967808017 3:193732197-193732219 GGGCTCCTTGGCTCAGGCTGAGG + Intergenic
968478727 4:824866-824888 AGGCGCCTGGCGCCAGGCTGCGG + Intronic
968506916 4:974942-974964 GGGGTCTTGGGGCCTGGCTGAGG - Intronic
968671934 4:1856572-1856594 GGGCTCCAAGGGCAAGTCAGGGG + Intergenic
968699531 4:2047987-2048009 TGGCTGCTGGGGCCGAGCAGTGG + Intergenic
968844878 4:3035415-3035437 GGGCTGCAGGGGCGAGGGAGCGG + Exonic
969232461 4:5841258-5841280 GGGCAGCTGGGGCCTGGAAGGGG - Intronic
969292959 4:6252373-6252395 GTGCCCCTGGAGCCAAGCAGAGG - Intergenic
969313887 4:6370134-6370156 GGGCTGCAGGGGGCAGGCCGAGG + Intronic
969532182 4:7736204-7736226 ATGCCCCTGGGGCCCGGCAGGGG + Intronic
969605485 4:8200224-8200246 GGCCTCCCAGCGCCAGGCAGCGG + Intronic
969638284 4:8382067-8382089 GAGGTCCAAGGGCCAGGCAGGGG - Intronic
971200851 4:24507991-24508013 GGGAGTTTGGGGCCAGGCAGGGG + Intergenic
972381661 4:38525322-38525344 GGGCTGCAGAGGCCAGGCTGGGG - Intergenic
973853531 4:54986689-54986711 GAGCTCCTGCAGCCAGGCTGAGG + Intergenic
974188501 4:58472075-58472097 GGGTTCCTGGGGCCAGGAGTGGG - Intergenic
974968946 4:68802098-68802120 GGAATACTGTGGCCAGGCAGTGG - Intergenic
975000954 4:69223167-69223189 GGAATACTGTGGCCAGGCAGTGG + Intergenic
975004488 4:69269101-69269123 GGAATACTGTGGCCAGGCAGTGG - Intergenic
975582383 4:75918651-75918673 GGGCTCCTGTAACCAGGCTGTGG - Intronic
975949350 4:79749112-79749134 GGGCTGCTGTGGCCAGCAAGGGG - Intergenic
976226651 4:82799320-82799342 GGGCTCCTCGGGCCAGGGGAGGG + Intergenic
977527146 4:98159328-98159350 GGACTCCTGGGGAAAAGCAGAGG + Intergenic
978609798 4:110525274-110525296 CAGCTCCTGGGGCCAGGCCCGGG - Intronic
980321780 4:131289115-131289137 GGACTCCTGGGGAAAAGCAGAGG - Intergenic
982350426 4:154409182-154409204 GGGCTGCTGAGTCCAGGGAGTGG + Intronic
982668232 4:158291831-158291853 CAACTCCAGGGGCCAGGCAGGGG + Intergenic
983310916 4:166060073-166060095 GTACTCCTTGGGCCAGCCAGGGG - Exonic
985634561 5:1029728-1029750 TGGCTCCTGAGGACAGGCAGCGG - Intronic
985776536 5:1847123-1847145 GGGCACCTGGGGCCAGGTTGTGG + Intergenic
985814923 5:2120083-2120105 GCACTCCTGGGGGCTGGCAGGGG - Intergenic
992813214 5:80409769-80409791 AGGCTCCTGGGGACATCCAGGGG + Intronic
996123270 5:119695112-119695134 GGGTTCCTGTGCCCAGGCAGGGG - Intergenic
996531569 5:124532866-124532888 GGGCTCCTGGAGCTGGGAAGGGG + Intergenic
997297605 5:132777503-132777525 AGGCTCCAGGGGACACGCAGAGG - Intronic
997503700 5:134398836-134398858 GGACTCCTGGGGCTAGGTGGTGG - Intergenic
997584400 5:135035800-135035822 GGGCTGCTGGGGCCAGGGTCGGG + Intronic
997647648 5:135491653-135491675 GGGCGCGTGGGGCGGGGCAGGGG + Intergenic
997652812 5:135535086-135535108 GGGCTACTGGGGTCAGAGAGCGG + Exonic
998364301 5:141618877-141618899 GGGAGCCTGGGGCCCGGCCGCGG - Exonic
998684305 5:144506227-144506249 AGGCACATGGGGTCAGGCAGGGG - Intergenic
999265710 5:150265482-150265504 AGGCCCCTGGCGGCAGGCAGGGG + Intronic
999426023 5:151488374-151488396 GGTATCCAGGTGCCAGGCAGAGG - Exonic
999443555 5:151621133-151621155 GGGCTCCTGCAGCCAGTGAGGGG + Intergenic
1000040605 5:157481876-157481898 AGGCTCCTGCGGCCTGGCACTGG + Exonic
1000160652 5:158594162-158594184 TGCCTCCTGGGGCCAGGAACTGG - Intergenic
1000267029 5:159647520-159647542 GGGCTCCATGGGCCAGGCCCGGG - Intergenic
1001043186 5:168351597-168351619 GCTCTCCTGGGGCCTGGCAAAGG + Intronic
1001263724 5:170256613-170256635 GGGGTGATGGGGCCAGACAGGGG + Intronic
1001627025 5:173144645-173144667 GGGCTGCTGGAGCCCGGCAGGGG - Intronic
1001930569 5:175670021-175670043 ATGCTTCTGAGGCCAGGCAGGGG + Intronic
1002054209 5:176589472-176589494 GGGACCCTGGGGGCTGGCAGAGG - Intronic
1002102072 5:176862607-176862629 GGGCACCTGCGGCAGGGCAGAGG - Exonic
1002163667 5:177332045-177332067 TGGCTCCTGGGCCCAGGGACAGG + Exonic
1002299105 5:178247606-178247628 GGGCCCCAGGGGCCAGTGAGTGG - Intronic
1002319457 5:178366273-178366295 GGGAACCTCGGGCAAGGCAGCGG - Intronic
1002605037 5:180377926-180377948 GGGCTCCAGGGCCCACGCAAAGG - Intergenic
1003107742 6:3228477-3228499 GGGCTCCTGGGTACCAGCAGGGG - Intronic
1003263345 6:4544925-4544947 GGGCTCCAGAGGCCAGGCGTGGG + Intergenic
1003466306 6:6383233-6383255 AGGTTCCTGAGGCCAGGCAGTGG + Intergenic
1003641530 6:7879300-7879322 AGGCTCCTGGAGTAAGGCAGAGG + Intronic
1004000427 6:11592472-11592494 GGAGCCCAGGGGCCAGGCAGAGG - Intergenic
1004105655 6:12665360-12665382 GGAGTCATGGGGCCAGACAGAGG + Intergenic
1004216695 6:13710994-13711016 GGGCTCCAGGACCGAGGCAGCGG + Exonic
1006152932 6:31998925-31998947 GAGGCCTTGGGGCCAGGCAGGGG + Intronic
1006153323 6:32000998-32001020 GGGCTGCAGGGCCCAGGGAGTGG + Intronic
1006159240 6:32031662-32031684 GAGGCCTTGGGGCCAGGCAGGGG + Intronic
1006159631 6:32033735-32033757 GGGCTGCAGGGCCCAGGGAGTGG + Intronic
1006582865 6:35086792-35086814 AGGCCCCTGGGGGCAGGCGGAGG - Intronic
1006837194 6:37006048-37006070 GGACACCAGGAGCCAGGCAGGGG + Intronic
1006865137 6:37203343-37203365 GGGCAGGTGGGGCCAGGCTGAGG + Intergenic
1006898135 6:37483703-37483725 GGCCTCCTTGGGCCTGACAGTGG + Intronic
1007072913 6:39049471-39049493 TGGCTCCTGGGGCCCTGCGGTGG + Intronic
1007395540 6:41575736-41575758 GGGCTCCTGGGGGCAGTTGGGGG - Intronic
1007397332 6:41585338-41585360 GGGCTCCTGGGGGCAGGAGAAGG - Intronic
1007685398 6:43664592-43664614 GTGCCCCAGGGGCCAGGCAATGG + Intronic
1007709081 6:43810291-43810313 GGGCTCCTGGGGCTGGGCTGGGG + Intergenic
1007737596 6:43991175-43991197 GGGTTCCTGGGGCAGGGCTGAGG - Intergenic
1010676676 6:78753740-78753762 GGGTCCCTGGGTCCAGGCATAGG + Intergenic
1011228860 6:85137514-85137536 GGGCTCCGCGGGACAGGCACAGG + Intergenic
1013793620 6:113860207-113860229 GGCCTCCGGGGAGCAGGCAGCGG + Exonic
1015152222 6:130052999-130053021 GTGCTCCTGGTGTCAGGCAGAGG - Intronic
1015625891 6:135181062-135181084 GGGAGCCCGGGGCCAGGGAGGGG - Intergenic
1015664691 6:135615640-135615662 GGGTGCCTTGGGCAAGGCAGTGG + Intergenic
1015882020 6:137879232-137879254 GGACTCCTGGGGACAGGACGGGG + Exonic
1015910222 6:138161994-138162016 AGGCGCCCAGGGCCAGGCAGCGG + Exonic
1017042055 6:150315612-150315634 AGGCTCCTGGGCCCAGGGATGGG - Intergenic
1017379741 6:153814214-153814236 GAGCTCCAGGGCCCAGGGAGTGG + Intergenic
1017817891 6:158028311-158028333 GGGGTCCTGAGTCAAGGCAGTGG + Intronic
1018309232 6:162491406-162491428 GGTCTCCAGGGCCCAGACAGAGG + Intronic
1018886691 6:167944262-167944284 TGGCTCCTGGTGACAGGGAGGGG - Intronic
1019102226 6:169640814-169640836 GGCCTCTTGCAGCCAGGCAGTGG - Intronic
1019322895 7:423670-423692 GGAAGCCGGGGGCCAGGCAGGGG - Intergenic
1019424459 7:967599-967621 GAGCTCCCGGGCCCAGGCCGGGG - Exonic
1019435387 7:1019871-1019893 GGGCCTCTGGGTCCAGGCTGTGG - Intronic
1019493170 7:1324463-1324485 GGGCTACAGGGCACAGGCAGGGG + Intergenic
1019603356 7:1896157-1896179 AGGCTCCTGAGGTCAGGGAGAGG - Intronic
1019912179 7:4107163-4107185 GGGCTGCAGGGGCCAACCAGAGG + Intronic
1020002218 7:4762435-4762457 GGCCCCCAGGGGCCAGGCACCGG + Exonic
1020055893 7:5117399-5117421 GCCCTCCAGGGGCCAGGCTGTGG + Intergenic
1020087928 7:5321425-5321447 AGACATCTGGGGCCAGGCAGGGG - Intronic
1023146238 7:37153558-37153580 GGGATGCTGGAGCCTGGCAGGGG + Intronic
1023822527 7:43988059-43988081 GTGCTGCTGGGGCCAGGCCTCGG - Intergenic
1023865376 7:44235831-44235853 AGGGTCCTGGAGCCAGGCGGTGG - Intronic
1024222433 7:47299022-47299044 GGCCTCCTGGGGCAGGGCACAGG + Intronic
1025738317 7:64174480-64174502 GGGAGCATAGGGCCAGGCAGGGG + Intronic
1026805799 7:73429179-73429201 GGGCCCCTCGGCCCAGGGAGGGG + Intergenic
1026879153 7:73897757-73897779 GGGCACATGGGGGCAGGCAGAGG - Intergenic
1026939579 7:74279558-74279580 GGGCTCCAGGGGCCTGGGAAAGG + Intergenic
1026949567 7:74338378-74338400 GTGCTCCTGGGGCCACCCAGGGG + Intronic
1027187865 7:75982469-75982491 AGTCTCCTGGGGCCGGGCCGTGG - Intronic
1029341257 7:99946491-99946513 GGGATCCTGGAGCCAGGTGGTGG + Intergenic
1029406134 7:100374915-100374937 GGGCTCCCAGGGCCAGCCACTGG - Intronic
1029439298 7:100578332-100578354 GGGTGCCTGGGGCCGGGAAGGGG + Intronic
1029598286 7:101549128-101549150 GGTCACCTGGGGCCAGAGAGGGG - Intronic
1029687594 7:102159491-102159513 GGGCTCCTGGGGGGAGGAAGGGG - Intronic
1029750790 7:102541474-102541496 GTGCTGCTGGGGCCAGGCTTCGG - Intronic
1029768745 7:102640585-102640607 GTGCTGCTGGGGCCAGGCTTCGG - Intronic
1031086333 7:117305062-117305084 GGGCTCCAAGGGCCAGCCTGTGG + Intronic
1031390722 7:121211297-121211319 GAACACCTGGGGCAAGGCAGAGG + Intronic
1031966594 7:128031789-128031811 GCGCGCCGGGGGCCGGGCAGCGG - Intronic
1032391202 7:131556463-131556485 TGGCTCCGGAGGCCAGGCTGTGG + Exonic
1032540029 7:132695146-132695168 GGGGTCCCAGAGCCAGGCAGGGG - Intronic
1033842755 7:145395294-145395316 GGGCTCCTGGGGCAAGGGACAGG + Intergenic
1034087634 7:148334687-148334709 GTGCTTCTGGGGCCTGGCAAAGG - Intronic
1034203245 7:149295391-149295413 GGTGCCCTGGGGACAGGCAGCGG + Intronic
1034347671 7:150397252-150397274 GGGCTGGTGGGGCCAGCCCGGGG + Exonic
1034513335 7:151553703-151553725 GGGGGCCTGGGTGCAGGCAGAGG + Intergenic
1034745939 7:153524092-153524114 GGGCTCCTGAGGCCATGCCAGGG - Intergenic
1034880580 7:154759484-154759506 GGACTCTCGAGGCCAGGCAGAGG + Intronic
1035020571 7:155797780-155797802 GGGCTCCTGGGCACACCCAGGGG + Intergenic
1035221430 7:157408659-157408681 GAGCTCCTGGGGGCAGGCCCTGG + Intronic
1035240191 7:157524174-157524196 GGGCTCCTCAGGCCAGGCCTGGG - Intergenic
1035315874 7:157997429-157997451 GGGCTCCAGGCGCCAGCCAGGGG - Intronic
1035397874 7:158546901-158546923 GGGCACCTGGGGCAGGGCTGGGG + Intronic
1035671264 8:1419005-1419027 GGGCACATGGGGCGAGGCAGAGG + Intergenic
1036822148 8:11949919-11949941 GCGCTCTTGGGGCCTGGGAGGGG + Intergenic
1036998488 8:13688585-13688607 GGGCACCCTGGGCCTGGCAGGGG - Intergenic
1037832700 8:22198730-22198752 GGCATCCGGGGGTCAGGCAGGGG - Intronic
1037865822 8:22441376-22441398 GGGCTCCTGGAGCCTGGAGGAGG + Exonic
1037890437 8:22621257-22621279 GGGCTCCTGGTGCCAGGCTCAGG + Exonic
1037925268 8:22839309-22839331 GGGCTCTTGGGAAGAGGCAGGGG + Intronic
1038218542 8:25585666-25585688 GGGCTTGAGGGGCCAGGGAGGGG - Intergenic
1038529738 8:28308544-28308566 GGACTCCTGGAGCCAGGCCTGGG + Intergenic
1038554070 8:28494364-28494386 GGGCCCCTGGGCCGGGGCAGCGG + Intronic
1039944549 8:42118225-42118247 GGGCTCTTGTTGCCAGGCTGAGG + Intergenic
1040312411 8:46243626-46243648 GGGCGCATGGAGGCAGGCAGAGG + Intergenic
1040315295 8:46257760-46257782 GGGCACATGGAGACAGGCAGAGG + Intergenic
1040330663 8:46384151-46384173 GGGGACCTTGGGGCAGGCAGAGG + Intergenic
1040549915 8:48429789-48429811 GGGCTGCCGCGGCCAGGAAGAGG - Intergenic
1041228760 8:55728359-55728381 GGACTCCTGGGGAAAAGCAGAGG - Intronic
1041971386 8:63746954-63746976 GGGTTCCTGGGGCTAGGCCTGGG + Intergenic
1042705140 8:71658953-71658975 GTGCCCCTGGGCCCAGGGAGTGG - Intergenic
1043582741 8:81732679-81732701 GGCCTCCTGGGGACTGGGAGCGG - Exonic
1045196463 8:99935793-99935815 GGTTTCCTGGGGCCAGGGGGAGG + Intergenic
1045198070 8:99950124-99950146 AGGTTCCTGTGGCCAGGAAGAGG + Intergenic
1045929411 8:107604919-107604941 GGAATACTGTGGCCAGGCAGTGG + Intergenic
1047501316 8:125443936-125443958 AGGCTGATGGGGCCAGGAAGCGG + Intergenic
1048888586 8:138928652-138928674 AGGCTCCCTGGGCAAGGCAGGGG + Intergenic
1049202244 8:141346022-141346044 TGGCCCCTTGGGTCAGGCAGAGG - Intergenic
1049290175 8:141797619-141797641 GGGTTCCTGTGGGAAGGCAGGGG + Intergenic
1049412860 8:142481199-142481221 GGGATTCCTGGGCCAGGCAGCGG + Intronic
1049424528 8:142532213-142532235 GGCCTCCTGCGGGCAGGCACAGG + Intronic
1049492306 8:142911915-142911937 GGTGGCCTGGGGTCAGGCAGAGG + Exonic
1049623177 8:143608241-143608263 GGGTTCCTGGGGCCAGGAGGGGG - Intronic
1049636037 8:143689986-143690008 GGGCTCCTGGGGTCAGGTGCGGG + Intronic
1049896177 9:113651-113673 GGGCTCCTGGGGACCGCGAGAGG + Intergenic
1052387244 9:27836303-27836325 GGGCACCTGGGGCCACTTAGTGG + Intergenic
1053013549 9:34648910-34648932 AGGATCCTGGGGCTAGGCACTGG + Intronic
1054805071 9:69389642-69389664 GGGCTATTGGGGCCGGACAGAGG - Intronic
1055708913 9:79037503-79037525 GGGGTCCGGGGGCCTGGCCGCGG - Intergenic
1056737175 9:89219886-89219908 CAGCTCCTGGGGCCAAGCACAGG - Intergenic
1057304001 9:93902122-93902144 GAGCTCCTGGGCCCAGGCCAGGG + Intergenic
1057306028 9:93912448-93912470 CGTTTGCTGGGGCCAGGCAGGGG + Intergenic
1057441636 9:95087885-95087907 TGCCCCCTGGAGCCAGGCAGAGG - Intergenic
1057444366 9:95103581-95103603 GGACGGCTGGGGCAAGGCAGAGG + Intronic
1057619176 9:96619651-96619673 GGGCACCTGGGGGCGGGCTGGGG - Exonic
1057709657 9:97427985-97428007 GGGCTCAGAGGGCCAGGGAGGGG - Intronic
1057739479 9:97699094-97699116 GGGTTCCGGGGGCCTGGCCGCGG + Intergenic
1057826913 9:98378448-98378470 GGTCTCCTGGGGCCCAGCTGTGG - Intronic
1058157586 9:101532760-101532782 GTGTTCCTGGTGCCTGGCAGTGG - Exonic
1059234645 9:112751161-112751183 GGGCGCCTGGGGCCGGGGAGTGG + Intronic
1059333937 9:113556774-113556796 GGGCTACTGAGGCCAGAGAGGGG + Intronic
1059429835 9:114243423-114243445 GGGCTCCAAGGGCCTGGCACAGG - Intronic
1060198820 9:121640122-121640144 GGGCTCCTGGGGCGATGCACAGG - Intronic
1060407845 9:123381645-123381667 GGGCTGCTGAGACCAAGCAGGGG - Exonic
1060554997 9:124503604-124503626 GGGAGCGTGGGGCCTGGCAGGGG - Intronic
1060588200 9:124799805-124799827 GGTCTCTGAGGGCCAGGCAGGGG - Intronic
1060721992 9:125985727-125985749 GGGGGTCAGGGGCCAGGCAGAGG - Intergenic
1060748701 9:126154786-126154808 GGGCTCGTGGGTCCTGGCAGAGG + Intergenic
1060776306 9:126377171-126377193 AGGGCCCTAGGGCCAGGCAGTGG - Intronic
1060964907 9:127706994-127707016 GGGCTCCAGGCCCCAGGAAGAGG - Exonic
1060997588 9:127883980-127884002 GGGAACCTGGGTCCAGGCAGAGG - Intergenic
1061092395 9:128434004-128434026 GGCCAACTGAGGCCAGGCAGAGG + Intronic
1061178114 9:129009408-129009430 GGGCTCCTGGGGCTGGGGAGGGG - Intronic
1061328532 9:129878539-129878561 TGGCACCTGGGGGCAGGCATGGG - Intronic
1061400384 9:130365197-130365219 GGGTTGCTGGGGCTAGGCTGTGG - Intronic
1061495713 9:130973229-130973251 GGGAGTCTGGGGCCAGGCTGCGG - Intergenic
1061498027 9:130986692-130986714 GGGCACCTCAGGCCAGGCTGGGG - Intergenic
1061624674 9:131834796-131834818 GGCCTCCTGGGACCAGGCAGAGG - Intergenic
1061747860 9:132753358-132753380 CTGCCACTGGGGCCAGGCAGAGG - Intronic
1062014703 9:134285211-134285233 AGGGTCCTGGGGACACGCAGAGG - Intergenic
1062059259 9:134486197-134486219 AGGCTGGTGGGGCCTGGCAGGGG + Intergenic
1062064123 9:134517241-134517263 TGGCTGCTGGGGCCAAGGAGAGG - Intergenic
1062130846 9:134892306-134892328 GGGCTCCTGCGCCCAGGGAAAGG - Intergenic
1062249410 9:135586853-135586875 GGGAGCCTGGTGCCAGGCAGGGG - Intergenic
1062280055 9:135747789-135747811 GGGCTCCTGGGGCCAGGCAGTGG - Intronic
1062317578 9:135975994-135976016 GGGTGCCAGGGGCCAGGAAGTGG - Intergenic
1062356858 9:136169195-136169217 GGACTCCTGTGGCCAAGGAGGGG + Intergenic
1062384538 9:136303959-136303981 GGGCATCCGGAGCCAGGCAGTGG - Exonic
1062440701 9:136568020-136568042 GCGGTCCTGGGGACCGGCAGAGG + Intergenic
1062449843 9:136610835-136610857 GGGCAGGTGCGGCCAGGCAGGGG + Intergenic
1062449887 9:136610943-136610965 GGGCAGGTGCGGCCAGGCAGGGG + Intergenic
1062449904 9:136610979-136611001 GGGCAGGTGCGGCCAGGCAGGGG + Intergenic
1062449921 9:136611015-136611037 GGGCAGGTGCGGCCAGGCAGGGG + Intergenic
1062449973 9:136611123-136611145 GGGCAGGTGCGGCCAGGCAGGGG + Intergenic
1062449990 9:136611159-136611181 GGGCAGGTGCGGCCAGGCAGGGG + Intergenic
1062581468 9:137230943-137230965 GAGCTCCTAGGACCAGGCTGAGG + Intronic
1062613963 9:137387738-137387760 GGGCTTCTGGGGCCGGAGAGCGG - Intronic
1062688034 9:137826381-137826403 GGCCTCCTGGTGCCTGGAAGTGG - Intronic
1203792613 EBV:159883-159905 TGGCTCCCGGGGCCACGGAGCGG - Intergenic
1185504031 X:619170-619192 GGGGCCCCGGGGCGAGGCAGGGG - Intergenic
1185722761 X:2395323-2395345 CGGCCACTGGGGCCAGCCAGGGG + Intronic
1186448851 X:9655305-9655327 AGGCCCCAGGAGCCAGGCAGGGG - Intronic
1186728481 X:12382728-12382750 GGGATGCTGGGGCTGGGCAGTGG - Intronic
1187551098 X:20306742-20306764 TGGCTCCTGAGCCCAGCCAGAGG + Intergenic
1187561799 X:20410482-20410504 GGTTTCCTGGGGACAGGTAGTGG - Intergenic
1189173747 X:38933769-38933791 GGGCTTGGGGAGCCAGGCAGAGG + Intergenic
1190679544 X:52813123-52813145 GGGCTCCTGGGACAAGGGCGGGG - Exonic
1191753693 X:64571134-64571156 GGGCTCCTGACACCAGGGAGGGG + Intergenic
1192534730 X:71917618-71917640 AGGCTACCGGGGCAAGGCAGAGG + Intergenic
1195021545 X:100833380-100833402 GGTCCTCTGGGGCCAGGCACTGG - Exonic
1195386549 X:104318939-104318961 TGTCTGCTGGGGCAAGGCAGAGG + Intergenic
1196576649 X:117325961-117325983 GGGGTCCTGGAGCCAGGCCTAGG - Intergenic
1197304934 X:124830211-124830233 GGACTCAGGGAGCCAGGCAGAGG - Intronic
1197693122 X:129523414-129523436 GGGCTCCTGGGCGGCGGCAGTGG + Exonic
1197779741 X:130147746-130147768 GGGATCCTGGGGCCAGGGTAAGG - Exonic
1197870316 X:131057986-131058008 GGGCTCCTGGGGTGGGGCTGGGG + Intergenic
1197925991 X:131647314-131647336 GGGCTTGTGGGGCCTGGGAGGGG + Intergenic
1200090647 X:153634325-153634347 GAGCGCAGGGGGCCAGGCAGTGG + Intergenic
1200156713 X:153980450-153980472 GAGCACCTGGGGCCAGGAGGCGG + Intronic
1200157672 X:153985889-153985911 GAGCACCTGGGGCCAGGAGGCGG - Intergenic
1200951451 Y:8903049-8903071 GGCCTCCTGGGGCCAGGGACAGG + Intergenic