ID: 1062280061

View in Genome Browser
Species Human (GRCh38)
Location 9:135747805-135747827
Sequence GGAGCCCTGAGTATGCCCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062280054_1062280061 -6 Left 1062280054 9:135747788-135747810 CCCACTGCCTGGCCCCAGGAGCC 0: 1
1: 0
2: 4
3: 54
4: 480
Right 1062280061 9:135747805-135747827 GGAGCCCTGAGTATGCCCGGTGG No data
1062280051_1062280061 17 Left 1062280051 9:135747765-135747787 CCACTGGTCTGTGGGAGGCTTGT 0: 1
1: 0
2: 1
3: 29
4: 188
Right 1062280061 9:135747805-135747827 GGAGCCCTGAGTATGCCCGGTGG No data
1062280055_1062280061 -7 Left 1062280055 9:135747789-135747811 CCACTGCCTGGCCCCAGGAGCCC 0: 1
1: 1
2: 9
3: 93
4: 805
Right 1062280061 9:135747805-135747827 GGAGCCCTGAGTATGCCCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062280061 Original CRISPR GGAGCCCTGAGTATGCCCGG TGG Intronic
No off target data available for this crispr