ID: 1062280753

View in Genome Browser
Species Human (GRCh38)
Location 9:135750648-135750670
Sequence CAGGATAGGGATTGGGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 444
Summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 396}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062280753_1062280765 29 Left 1062280753 9:135750648-135750670 CCTGCTCCCCAATCCCTATCCTG 0: 1
1: 0
2: 2
3: 45
4: 396
Right 1062280765 9:135750700-135750722 ATCCCCTGCACCCCAAGTTCAGG No data
1062280753_1062280761 -3 Left 1062280753 9:135750648-135750670 CCTGCTCCCCAATCCCTATCCTG 0: 1
1: 0
2: 2
3: 45
4: 396
Right 1062280761 9:135750668-135750690 CTGTCCTCCAAGAAGTGGAGTGG No data
1062280753_1062280759 -8 Left 1062280753 9:135750648-135750670 CCTGCTCCCCAATCCCTATCCTG 0: 1
1: 0
2: 2
3: 45
4: 396
Right 1062280759 9:135750663-135750685 CTATCCTGTCCTCCAAGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062280753 Original CRISPR CAGGATAGGGATTGGGGAGC AGG (reversed) Intronic
900477170 1:2881469-2881491 CAGGGCAGGGAGTGGGGATCCGG + Intergenic
900637261 1:3672061-3672083 CAGGGTAGGGAGTGGTCAGCAGG + Intronic
901237490 1:7675249-7675271 CAGGATAGTGAGTGGGGTACGGG + Intronic
901529664 1:9844898-9844920 CAGGGCAGGGGCTGGGGAGCTGG + Intergenic
902996600 1:20230345-20230367 CAGAACAGGGATTGGGGAATAGG - Intergenic
903328679 1:22585990-22586012 CAGGCCAGGGATGGGGGTGCTGG - Intronic
904486870 1:30830706-30830728 AAGGAAAGGGGTTGGGGTGCAGG + Intergenic
904839623 1:33364005-33364027 GAGAATAGGGGTGGGGGAGCAGG - Intronic
905276926 1:36824450-36824472 CAGCACAGGGCCTGGGGAGCAGG + Intronic
905717256 1:40162143-40162165 CTGATTAGGGATTGCGGAGCCGG + Intronic
906043479 1:42807996-42808018 TAGAGTAGGGGTTGGGGAGCTGG + Intronic
906727666 1:48055638-48055660 CAGGATTGGGAGTGGTGACCTGG - Intergenic
907876940 1:58499221-58499243 CAGGCTGGGGATCGGGGAGTAGG + Intronic
908313454 1:62908899-62908921 CAGAGTATGGGTTGGGGAGCAGG - Intergenic
913073131 1:115318795-115318817 CATGTTTGGGAGTGGGGAGCAGG - Intronic
913647265 1:120870278-120870300 CAACATAGGGTTAGGGGAGCTGG - Intergenic
914079378 1:144392581-144392603 CAATATAGGGTTAGGGGAGCTGG + Intergenic
914099801 1:144573921-144573943 CAATATAGGGTTAGGGGAGCTGG - Intergenic
914174279 1:145261127-145261149 CAACATAGGGTTAGGGGAGCTGG + Intergenic
914299186 1:146363760-146363782 CAACATAGGGTTAGGGGAGCTGG + Intergenic
914350531 1:146835967-146835989 CAGGAGAGGGAGCTGGGAGCTGG - Intergenic
914528943 1:148502311-148502333 CAACATAGGGTTAGGGGAGCTGG + Intergenic
914637449 1:149564797-149564819 CAACATAGGGTTAGGGGAGCTGG - Intergenic
914838906 1:151231505-151231527 CAGCATAGGGATGGGGAAACTGG + Intronic
915119347 1:153618942-153618964 CTGGAGATTGATTGGGGAGCTGG - Exonic
915170313 1:153972905-153972927 CAGGAGAAGCATTGGGGAGTTGG + Intronic
915543636 1:156583697-156583719 CAGGAAAGGGAGGGGGGAGGGGG - Intronic
915675231 1:157523725-157523747 CAGGGCAGAGAGTGGGGAGCAGG - Intronic
915742552 1:158130207-158130229 GAGAATATGGAGTGGGGAGCTGG - Intergenic
915932672 1:160069919-160069941 CAGGGTAGGGACTGAGGATCTGG + Intronic
916030685 1:160875251-160875273 CAGGATAGAGAATGGGGACAAGG + Intergenic
916606012 1:166343137-166343159 CGGCATGGGGAGTGGGGAGCAGG + Intergenic
917454438 1:175174031-175174053 CAGGATGGGGACTGGGGTGTGGG - Intronic
917678297 1:177340827-177340849 CGGGAAAGGGAAAGGGGAGCGGG + Intergenic
917789841 1:178492471-178492493 CAGAAAAGGGAATGGGGAGCAGG + Intergenic
918043652 1:180928200-180928222 CTGGATGGGGGCTGGGGAGCTGG - Intronic
918073496 1:181151338-181151360 CAGAATATGGACTGTGGAGCCGG + Intergenic
918276597 1:182959040-182959062 CAGGATACTCTTTGGGGAGCAGG - Intergenic
919817033 1:201448163-201448185 CAGTTTAGGGAGTGGGGAGCTGG + Intergenic
920351249 1:205339423-205339445 CAGGATAGAGGTTGGGCAGAAGG + Intronic
921068106 1:211637145-211637167 GAGCATAGGGATGGGGGAGTGGG + Intergenic
921814683 1:219550171-219550193 CTGGAGGGGGATAGGGGAGCTGG - Intergenic
922531093 1:226345863-226345885 CTTGATAGGGACTGGGGAGCTGG + Intergenic
922597808 1:226827313-226827335 GAGGGTCGGGAATGGGGAGCAGG + Intergenic
922896825 1:229107288-229107310 GAGGAGAGGGATTGGGGAGTTGG + Intergenic
923701728 1:236306226-236306248 CAGGATTGGGAGTTGGGAGTTGG - Intergenic
1062793730 10:326382-326404 TAGGATAGGGGGTGGGGAGAGGG + Intronic
1062931330 10:1354620-1354642 GGGGAGAGGGATCGGGGAGCAGG + Intronic
1064161448 10:12950088-12950110 CAGGAAAGGGAATGGGAGGCTGG - Intronic
1064934914 10:20668881-20668903 CAGGAGAGGGAGTGTGAAGCGGG - Intergenic
1065092149 10:22245794-22245816 CAGGGTAGGGATGACGGAGCTGG - Intergenic
1066374573 10:34846079-34846101 CAGGATGGGGGTGGGGGAGAGGG - Intergenic
1069663681 10:70140297-70140319 CAGGAAAGGGTGTGGGCAGCAGG - Intronic
1069749675 10:70737188-70737210 CAGCATAGGGGTGGGGGAGTAGG - Intronic
1069820225 10:71222958-71222980 TGGGATAGGGATGGGGGAGGGGG - Intronic
1069935442 10:71912553-71912575 CATGATTGGGGTTGGGGAGGGGG - Intergenic
1071246726 10:83773251-83773273 CAGGCTAGGGATTGGAGATCTGG + Intergenic
1071328399 10:84538803-84538825 CAGGCCAGGGATTGGGGTGGGGG + Intergenic
1072523323 10:96249534-96249556 CAGGATAGGGAATTGGGAAAAGG + Intronic
1072814069 10:98487676-98487698 CAAAACAGGGATTGGGGAGAAGG - Intronic
1073112464 10:101070681-101070703 CTGGTTAGGGAGTGGGGTGCGGG + Intergenic
1074298006 10:112209021-112209043 AAGGACAGGGATTGGGGATGGGG + Intronic
1074627502 10:115207832-115207854 CAAGATCGGGATGGGGGAGTGGG - Intronic
1075162900 10:120040375-120040397 AACAATAGGGTTTGGGGAGCTGG + Intergenic
1075510424 10:123067758-123067780 CAACATAGGGATTTGGGAGGAGG + Intergenic
1076361678 10:129894072-129894094 CAGGAACAGGACTGGGGAGCAGG - Intronic
1076379573 10:130015794-130015816 CAGGCTGGGGATTGGGGAGCAGG + Intergenic
1076490839 10:130860250-130860272 CAGGAGAGGGCTTGAGGAACTGG - Intergenic
1077060070 11:614083-614105 GGGGCTGGGGATTGGGGAGCTGG - Intronic
1077191213 11:1256577-1256599 CAGGATGGGCAGTGGGGAGCAGG - Intronic
1077896484 11:6457194-6457216 TAGGCTGGGGAATGGGGAGCTGG + Intronic
1078006733 11:7537825-7537847 AAGGAGAGGGATTGGGGAGTGGG - Intronic
1079316443 11:19411585-19411607 AGGGATAGGGATTGGGGAGAGGG + Intronic
1079348184 11:19670950-19670972 GAGGAGAGGGGCTGGGGAGCTGG - Intronic
1081752017 11:45518144-45518166 CAAGAGAGGGTTTGGAGAGCAGG - Intergenic
1081809237 11:45905962-45905984 AGGGACAGGGCTTGGGGAGCAGG + Exonic
1081850841 11:46274189-46274211 CAGGACAGGGCCTGGGGAGCAGG - Intergenic
1082961381 11:58921616-58921638 CTGGAAAGGGATTCGAGAGCCGG - Intronic
1083626201 11:64073324-64073346 CAGGATGGGCATGGGGGAGTGGG - Intronic
1083780916 11:64916873-64916895 CAGGATCGGGCTGGGGGATCAGG - Intronic
1083900878 11:65642701-65642723 AAGGCTAGGGGTTTGGGAGCTGG - Intronic
1084174510 11:67416331-67416353 CAGGGTGGGGGTGGGGGAGCTGG - Intronic
1084725554 11:70939564-70939586 CAGGAGAGGCCTTGGTGAGCAGG - Intronic
1084804804 11:71571488-71571510 CAGGCCAGGGATGGAGGAGCGGG + Intergenic
1084805651 11:71577035-71577057 CAGGCCAGGGATGGAGGAGCGGG - Intergenic
1084892276 11:72242520-72242542 GAGGGTAGGGATTGGGAAGAGGG - Intronic
1085196925 11:74678347-74678369 CAGGATGGGGCTTGGGGCACTGG + Intergenic
1085237277 11:75024883-75024905 GAAGATAGGGAGTGGGGGGCAGG + Intergenic
1085388646 11:76171181-76171203 CAGGAGAGGGCGTGGGGAACAGG + Intergenic
1085388791 11:76171824-76171846 CAGGATGGGGATTGGGGGTAGGG - Intergenic
1086182342 11:83968279-83968301 CAGGTTAGGGACTGTGGAACTGG + Intronic
1086942563 11:92813578-92813600 GGGGTTAGGGATTGGGAAGCAGG - Intronic
1087212127 11:95455284-95455306 TAGGACAGGGAATGGGGAGCTGG + Intergenic
1089319716 11:117617175-117617197 CTGGTAAGGGGTTGGGGAGCTGG + Intronic
1089347913 11:117803135-117803157 CAGGATAGGGAATGGCTTGCAGG + Intronic
1090096112 11:123742921-123742943 CTGGAAAGGGATTGAGGTGCTGG + Intergenic
1090240760 11:125179982-125180004 CAGGACATGAATTGGGGAGGAGG - Intronic
1090480250 11:127061518-127061540 CAGGAGACGGGTTTGGGAGCAGG - Intergenic
1090779899 11:129998632-129998654 TAGTTTAGGGAATGGGGAGCGGG - Intronic
1091172657 11:133532185-133532207 CAGGAGAGGCAGTGGGGAGATGG - Intronic
1091337913 11:134786280-134786302 CAGGGTAGGGGGTGGGAAGCAGG - Intergenic
1091743698 12:2977455-2977477 CAGGATGGGGAACGGGGAGCAGG - Intronic
1091798035 12:3308501-3308523 CAGGACAGGGAATGGGCATCGGG - Intergenic
1092933585 12:13339705-13339727 CAGCACTGGGATTGGGGAGCTGG + Intergenic
1093016548 12:14161155-14161177 CAGGAGAGGGAGGGGGGAGGAGG + Intergenic
1094497307 12:30996332-30996354 CAGGGCAGGGTATGGGGAGCAGG - Exonic
1094727420 12:33134351-33134373 CAAGATAGCTGTTGGGGAGCTGG - Intergenic
1095955601 12:47803979-47804001 CTGGGTAGGGACTGGGGAGGTGG - Intronic
1095971486 12:47904899-47904921 CAGGATAGGGACTCGGGGTCGGG - Exonic
1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG + Intronic
1097073835 12:56377303-56377325 CAGGAAAGGTCTTTGGGAGCAGG + Intergenic
1097526419 12:60741549-60741571 CAGGAAAAGAATTGGGGAGAGGG - Intergenic
1097645749 12:62233892-62233914 CAGGGTAGGGGTGGGAGAGCAGG + Intronic
1098846723 12:75546149-75546171 CAGGAAAGGGAATTGGGAGGAGG + Intergenic
1101046406 12:100810591-100810613 CAGGATAGTGATTCTGGAGGTGG + Intronic
1101519494 12:105468400-105468422 CAGGATACGGGTGGGGGCGCTGG - Intergenic
1102164646 12:110796676-110796698 CAAGAGAGGGAGTAGGGAGCAGG + Intergenic
1102652025 12:114448812-114448834 AAGGATGGGGGTTGGGGAGGCGG - Intergenic
1103029227 12:117599203-117599225 CACGATAGGGATTGAGAAGCTGG + Intronic
1104729738 12:131098238-131098260 CGGGATTGGACTTGGGGAGCTGG - Intronic
1106806192 13:33309838-33309860 CAAGAGAGGGATTGGGGATGGGG + Intronic
1107274813 13:38666497-38666519 CATCATAGGGAGTGGGGAGAAGG - Intergenic
1111127528 13:83930714-83930736 CAGGCTGGGGGATGGGGAGCGGG - Intergenic
1112468465 13:99666590-99666612 AAGGTTAGAGATTCGGGAGCTGG - Intronic
1113527549 13:110992373-110992395 CAGAGCAGGGATGGGGGAGCGGG - Intergenic
1114192055 14:20447166-20447188 CAGGATAGAGATTGAGGCACGGG + Exonic
1114270011 14:21094714-21094736 GAGGATAGGGGTTGGGGGGGGGG + Intronic
1114308509 14:21444962-21444984 TGGGATAGGGATGGGGGAACTGG - Intronic
1114532519 14:23404664-23404686 CAGAACAGGGGTTGGGGGGCAGG - Intronic
1116621292 14:47207211-47207233 CATGATAGAGGATGGGGAGCAGG + Intronic
1116765217 14:49062240-49062262 CAGGAAAGGAGTTGGGGAGAAGG + Intergenic
1117758789 14:59004439-59004461 CAGGATGGGGACTGGTGACCAGG - Intergenic
1121462677 14:94094065-94094087 CAGGACTGGGGTTGGGGTGCAGG - Intronic
1121675175 14:95746536-95746558 CAGGGGAGGGGTTGGGGTGCTGG + Intergenic
1121686319 14:95837962-95837984 CAGCATAGTGCTTGGGGAGCAGG - Intergenic
1123876523 15:24629196-24629218 CAGGGTAGGGAGTGGGGGGTGGG - Intergenic
1124940436 15:34212632-34212654 CAGGGGAGGGATGGTGGAGCTGG + Intergenic
1126528768 15:49688840-49688862 CAGGACAGGGAATGGGGAAGTGG - Intergenic
1128675597 15:69606363-69606385 GAGGATGGGGATCGGTGAGCTGG - Intergenic
1128770553 15:70278548-70278570 CAGGATGGGGATGGGGGAGTGGG + Intergenic
1129174896 15:73832790-73832812 GAGGATTGGGATTTGGGGGCAGG - Intergenic
1129232378 15:74203899-74203921 CAGGATGGGGATGGGGGTGGGGG + Intronic
1129351024 15:74956109-74956131 CAGGATGGGGATTCGGGGGCTGG + Exonic
1130484683 15:84392151-84392173 CAGGAGAGGTTTTCGGGAGCAGG + Intergenic
1131105690 15:89732782-89732804 CTGGAGAGGAATTGGGGAGGGGG - Intronic
1131359768 15:91780301-91780323 CAGGAAAGGTATTTGGGGGCAGG + Intergenic
1131833226 15:96367341-96367363 CAAGATGGGGGTTGGGGAGGTGG - Intergenic
1132582454 16:691232-691254 CAGGAAAGGGCTTGGTGGGCTGG - Intronic
1133601419 16:7343418-7343440 CAGCAGTGGGATTTGGGAGCTGG + Intronic
1134052220 16:11145135-11145157 CAGGACAGGTAATCGGGAGCAGG - Intronic
1134865337 16:17601916-17601938 CAGGCTAGGGTTTGGGGGGAGGG - Intergenic
1138091011 16:54174579-54174601 CAGCAGAGGGCTTGGGGAGGGGG + Intergenic
1138228923 16:55323977-55323999 CAGGCCAGGGCTTGGAGAGCCGG + Exonic
1138261854 16:55629496-55629518 CAGGAGAGTGAATGGGGAGAAGG - Intergenic
1138510376 16:57505272-57505294 CAGGAGTGGGATTGGGGTGTTGG + Intergenic
1138849232 16:60605949-60605971 AATGATAGGGGTTGGGGAGCAGG - Intergenic
1139504768 16:67393330-67393352 CAGGATACTGATTGGGGTGGCGG + Intronic
1139547368 16:67655974-67655996 AAGGCTAGGGTGTGGGGAGCGGG + Intronic
1139983507 16:70879572-70879594 CAGGAGAGGGAGCTGGGAGCTGG + Intronic
1140306377 16:73806807-73806829 CTGGAGAGGGCTTGGGGAGATGG - Intergenic
1141574871 16:84957436-84957458 GAGGATAGGGAGAGGGGAGGCGG - Intergenic
1141592782 16:85079631-85079653 GAGGGTGGGGAATGGGGAGCAGG + Intronic
1141783478 16:86181587-86181609 CAGGCTGAGGGTTGGGGAGCTGG - Intergenic
1142015256 16:87742573-87742595 CAGGATAGGGATCGTGGAGAGGG + Intronic
1142688851 17:1592839-1592861 CAGGCTGGGGGTTGGGGAGCAGG + Intronic
1142867553 17:2799880-2799902 CAGGCTGGGGATGGAGGAGCTGG + Intronic
1143252311 17:5532763-5532785 CAGGATGGGCAGTGGGGTGCGGG + Intronic
1143544986 17:7590428-7590450 CAGGAAAGGGGTTGGGGTGGTGG - Intronic
1143631444 17:8142595-8142617 TAGGGCAGTGATTGGGGAGCCGG - Intronic
1144356198 17:14448770-14448792 TAGGATGGGGAGTGGGGAACTGG + Intergenic
1144768324 17:17745126-17745148 CAGGACAGGGAATGGGGATCGGG + Intronic
1146140798 17:30366314-30366336 AAAGATAGGGAATGGGGAGCAGG + Intergenic
1146171623 17:30638861-30638883 TAGGAGAGGAAATGGGGAGCAGG - Intergenic
1146175549 17:30663936-30663958 CAGGAAAGGGATGAGGGAGTAGG + Intergenic
1146263179 17:31434779-31434801 CAAGACAGGGTATGGGGAGCAGG + Intronic
1146296361 17:31653660-31653682 CAGGATACGGAGAGGGGAGAGGG - Intergenic
1146345084 17:32054882-32054904 TAGGAGAGGAAATGGGGAGCAGG - Intergenic
1146375136 17:32288764-32288786 CAGGAAATGGAGTGGGGAGAGGG - Intronic
1147044358 17:37742646-37742668 AGGGAGAGGGACTGGGGAGCCGG - Intronic
1148147060 17:45372709-45372731 AAGGCTAGGGCCTGGGGAGCTGG - Intergenic
1148161530 17:45453126-45453148 CAGGAGAGGGACGGGTGAGCAGG + Intronic
1148180309 17:45600606-45600628 AGGGACAGGGCTTGGGGAGCAGG - Intergenic
1148268591 17:46245288-46245310 AGGGACAGGGCTTGGGGAGCAGG + Intergenic
1148633871 17:49132610-49132632 CAGGGTAGAGATGGGGGCGCTGG + Intronic
1150160490 17:62893965-62893987 CAAGGTAGGGATGGGGGAGGCGG + Intergenic
1150392766 17:64799771-64799793 CAGGAGAGGGACGGGTGAGCAGG + Intergenic
1151207656 17:72519661-72519683 GTGGATAGGGGTTTGGGAGCTGG - Intergenic
1152089993 17:78241107-78241129 CAGCACAGGGAGTGGGGAGGGGG + Intergenic
1152166695 17:78712938-78712960 CAGGAATGGGACTGGAGAGCAGG - Intronic
1152200574 17:78943582-78943604 GAGGATGGCGATGGGGGAGCTGG - Intergenic
1152471779 17:80493546-80493568 CGGGAGAGGGAAGGGGGAGCAGG - Intergenic
1152785296 17:82244860-82244882 CAGCATGGGGCTGGGGGAGCCGG + Intronic
1153333255 18:3896269-3896291 CAGGAAAGCTATTGAGGAGCAGG - Intronic
1155004318 18:21714366-21714388 GAGGATAGGGCATGGGGAACAGG + Intronic
1155330222 18:24708196-24708218 CAGGATTGGGATGGGGGTGGGGG + Intergenic
1155645048 18:28067375-28067397 GGGGATTGGGATTGGGGAGAGGG - Intronic
1156266822 18:35496719-35496741 TTGGATGGGGGTTGGGGAGCAGG + Intronic
1157116572 18:44867723-44867745 CAGGATGGGGAATGGGGGGGTGG + Intronic
1157488424 18:48106110-48106132 CAGGGTGGAGTTTGGGGAGCAGG - Intronic
1157776302 18:50399332-50399354 CAGGATCTGGATGGGGCAGCTGG - Intergenic
1159268409 18:66115028-66115050 CATGATAGGCATTGGGGTGCTGG + Intergenic
1159958536 18:74537599-74537621 CTGGATGAGGTTTGGGGAGCTGG + Intronic
1161573842 19:5044750-5044772 CAGGAGAGGGATGGGGGAGAGGG - Intronic
1161620179 19:5293351-5293373 GAGGAGGGGGATTGGGGGGCAGG + Intronic
1162129910 19:8520093-8520115 CAGAAATGGGATTGGGGTGCAGG + Intergenic
1162133554 19:8542154-8542176 CAGAATAGGGGATGGGGGGCGGG + Intronic
1162925674 19:13929701-13929723 CAGGATAGGCATGGGGGGGGAGG + Intronic
1162983413 19:14253974-14253996 CAGGAAAGGGATGAGGGAGTAGG - Intergenic
1163545047 19:17936378-17936400 GAGGATGGGGATGGGGGAGCAGG - Intronic
1163664207 19:18595362-18595384 CAGGATAGGGGCTGGGGAGCTGG + Intronic
1164467314 19:28498695-28498717 CAGGGTCAGGATAGGGGAGCAGG + Intergenic
1165050029 19:33135195-33135217 CAGGATGGGTATTGGGGAACTGG - Intronic
1165862010 19:38914230-38914252 AAGGGGAGGGATCGGGGAGCAGG + Intergenic
1166124310 19:40704606-40704628 CAGAACAGGGATGGGAGAGCAGG + Intronic
1166217131 19:41343104-41343126 AAAAATAGGGATTAGGGAGCAGG - Intronic
1166559620 19:43723494-43723516 CAGCACAGGGATTGGTGAGAAGG + Intergenic
1166667423 19:44689469-44689491 CAGGTTTGGGGTTGGAGAGCTGG - Intergenic
1166755299 19:45187132-45187154 CAGGATAGGGACTGGGGCAGGGG + Intronic
1167469511 19:49667535-49667557 CAGAGTAGGAATTGGGGAGGAGG + Intronic
1167695888 19:51015507-51015529 CAGGATAGTGATGCTGGAGCAGG + Exonic
1168405940 19:56110758-56110780 CAGGCTATGGATGGGGGAGGCGG + Intronic
1168573838 19:57491792-57491814 CAGGAAAGGGTTTGGGGGTCAGG + Intronic
1168575448 19:57504981-57505003 CAGGAAAGGGTTTGGGGGTCAGG + Intronic
1168645401 19:58056155-58056177 CAGGATGGGGATGGGGCAGAGGG - Intergenic
924977639 2:192675-192697 TGGGATGGGGATTGGGGAGGAGG - Intergenic
925070751 2:965202-965224 CAGGAGGAGGATTGGGGACCAGG - Intronic
925070807 2:965357-965379 CAGGAGGAGGATTGGGGACCAGG - Intronic
925292389 2:2756384-2756406 CAGGGAAGGGGTTGGGGAGACGG - Intergenic
926136579 2:10340821-10340843 CAGGACAGGGATTCAGGAACAGG - Intronic
927469595 2:23363031-23363053 CAGGTTTGGGAAGGGGGAGCAGG + Intergenic
927714638 2:25343476-25343498 CAGGGTGGGGGTTGGGGAGACGG - Intergenic
927848361 2:26483686-26483708 CAGGATGGGGGTTGGGGACCTGG - Intronic
928320930 2:30282380-30282402 CAGGGTGGGGCTCGGGGAGCGGG - Intronic
929673937 2:43905040-43905062 GAGGATTGGGATTGGGGTGGGGG - Intronic
929829968 2:45339292-45339314 GAGGACAGGGATGGGGGAGTTGG - Intergenic
930185800 2:48411034-48411056 GAGGATAGGGATGGGGGGGATGG - Intergenic
930722708 2:54653535-54653557 CAGAATAGGGCTTGGGGTGATGG + Intronic
931748611 2:65311928-65311950 GGGGAAAGGGAGTGGGGAGCAGG + Exonic
933528525 2:83475651-83475673 GAGGATGGGGACTGGGGAGTGGG - Intergenic
933862515 2:86484049-86484071 CAGGAAAGAGTTTGGTGAGCAGG + Exonic
934704656 2:96468523-96468545 AAGGAAGGGGAATGGGGAGCTGG - Intergenic
934926194 2:98383284-98383306 TGGGATAGGGATTGGGGGGTGGG + Intronic
935034307 2:99353681-99353703 CAGGTGAGGGGTTGGGGAGGTGG - Intronic
935383254 2:102475336-102475358 CAGGTTGTGGAATGGGGAGCAGG - Intronic
936038269 2:109129445-109129467 CAGCATCAGGACTGGGGAGCCGG - Intronic
937050162 2:118882070-118882092 ATGGATAGGGATTGGGGAGGTGG + Intergenic
937463626 2:122110478-122110500 CAGGAAAAGGATAGGGGAGCTGG + Intergenic
937496780 2:122428883-122428905 CAGGAAGGGGATTGTGGTGCTGG + Intergenic
938092392 2:128442060-128442082 CGAGATAAGGACTGGGGAGCAGG - Intergenic
938117847 2:128613862-128613884 CAGCATAGGGATTTGGGAGATGG + Intergenic
938548835 2:132361149-132361171 CAGGGCAGGCATTGGGGGGCGGG + Intergenic
938922356 2:136007015-136007037 TAGGAAAGGGATTGGGAAGGAGG - Intergenic
939236796 2:139504456-139504478 CAGGATAGGGGTTGGGCACCAGG - Intergenic
939460078 2:142488112-142488134 CAGGATAGGGATAGGGGGTGGGG - Intergenic
940655790 2:156486573-156486595 AAGGATGGGGAATGGGGAGAGGG - Intronic
940883145 2:158967750-158967772 CAGGATAGGGACTAGGGATTCGG - Intergenic
941290560 2:163668468-163668490 CAGGACAGTGAGTGGTGAGCTGG + Intronic
941600401 2:167536572-167536594 AAGGATAGAGAATGGAGAGCAGG - Intergenic
941900352 2:170672210-170672232 CAAGAAAGGGATGGGGGAGATGG + Intergenic
942477711 2:176345564-176345586 AAGGATAGAGATAGGGGAGAAGG + Intergenic
943065810 2:183084919-183084941 CAGGATAGGGAGTGGGGCTAAGG + Intronic
943778336 2:191792844-191792866 GAGGAGATAGATTGGGGAGCAGG + Intergenic
945314773 2:208359997-208360019 GTGGATAGGGACTGGAGAGCAGG - Intronic
947918166 2:233848156-233848178 CAGGAAAGGGACTGGGCAGAGGG + Intronic
948206317 2:236164472-236164494 CAGGAGTGGGCTTGGGGACCAGG + Intergenic
948350459 2:237335954-237335976 CAGGATGGGGAGTGGGAGGCTGG + Intronic
948671523 2:239571614-239571636 CAGGTTAGAGTTTGGGGGGCAGG - Intergenic
1168859454 20:1035485-1035507 CAGGATGGGGGTTGGGGACGTGG + Intergenic
1171172855 20:23031414-23031436 CAGGATAGTGAATGAGGATCAGG - Intergenic
1172644084 20:36459087-36459109 CAGGCTGGGGATTAGGGAGGGGG + Intronic
1172793314 20:37520931-37520953 CAGGCCAGGGACTGGGGAGAAGG + Intronic
1173866143 20:46313729-46313751 CAGGAGCGGGGTTAGGGAGCTGG - Intergenic
1174085645 20:48005668-48005690 TAGGAGAGGCTTTGGGGAGCAGG + Intergenic
1174107376 20:48172152-48172174 CTGGACAGGGAGTGGGGAGCAGG + Intergenic
1174130619 20:48341371-48341393 CAGGAAAGGCTCTGGGGAGCAGG - Intergenic
1174679296 20:52389730-52389752 CAGGAGAGGGAGTGGTGAGATGG + Intergenic
1175601343 20:60276267-60276289 CAGGGTAGGGAGGAGGGAGCTGG - Intergenic
1175689466 20:61055098-61055120 GAGTACAGGGATTGGGGGGCAGG + Intergenic
1176089780 20:63313652-63313674 CAGGGTAGGGGCTGGGCAGCTGG + Intronic
1178724418 21:35038259-35038281 CAGGGGTGGGATCGGGGAGCAGG - Intronic
1179410098 21:41155966-41155988 CAGGATGGGGATCTGGGAGCTGG - Intergenic
1179788900 21:43744213-43744235 CAGGCTAGGGAGTGGGGGGAGGG + Intronic
1179875086 21:44263046-44263068 CAGGTGGGGGGTTGGGGAGCTGG + Intergenic
1180623953 22:17181608-17181630 CAGGGCAGGGGTTGGGGAACGGG + Intronic
1181331521 22:22096134-22096156 CAGGAGAGGGATTGTGGGGTTGG - Intergenic
1181762783 22:25069487-25069509 CAGCATGGGGAGTGGGGTGCTGG - Intronic
1182773307 22:32811679-32811701 CAGGATGGTGATTGGGGGGTCGG + Intronic
1183553321 22:38506009-38506031 AAGGATAGAGATCTGGGAGCGGG + Exonic
1183582652 22:38735151-38735173 CTGGATAGGGAAGGGGGAGGAGG - Exonic
1184409209 22:44317056-44317078 CAGGTCAGGGGTTGGGGAGCTGG - Intergenic
1184421146 22:44383656-44383678 AAGGAAAGGGATAGGGGAGAAGG - Intergenic
1184644423 22:45888524-45888546 GAGGAGAGAGAGTGGGGAGCTGG - Intergenic
1185323308 22:50212600-50212622 CAGGGAGGGGAATGGGGAGCTGG - Intronic
1185401425 22:50620106-50620128 CAGTTTAGGGTTTGGGGGGCGGG - Intergenic
949895664 3:8766231-8766253 CTGGAAAGGGGTTGGGGGGCAGG + Intronic
950526272 3:13526085-13526107 CTGGATGGGGCTTGAGGAGCCGG + Intergenic
951159756 3:19404136-19404158 CAGGATAGAGAGTGAAGAGCAGG - Intronic
953141720 3:40235210-40235232 GAGCATAGGAATTGGGGAGCGGG - Intronic
953776567 3:45822523-45822545 TAGGATAAGGATTTGGGTGCAGG - Intergenic
953974402 3:47371404-47371426 CAGCCTAGGGGTTGGGGGGCCGG - Intergenic
954075620 3:48177256-48177278 CATGATAGGATTTGGGGATCTGG - Intronic
955779951 3:62473723-62473745 CTGGCTGGGGATTGGGTAGCAGG + Intronic
956695883 3:71919118-71919140 CAGAACAGGGAGTGGAGAGCTGG - Intergenic
956747432 3:72320789-72320811 AGGGATAGGGGTTGGGGAGGGGG + Intergenic
958453182 3:94298870-94298892 CAGCACAGGGATTGGTGAGAAGG - Intergenic
959095523 3:101951359-101951381 CAGGGCAGGGGTAGGGGAGCGGG + Intergenic
959258270 3:104042489-104042511 CCAGATAGGAATTGGAGAGCTGG - Intergenic
959531721 3:107441022-107441044 CAAGATAGGGTTTAGGGAGATGG + Intergenic
961328735 3:126126740-126126762 CAGCATACGAATTGGGGAGTGGG - Intronic
961478851 3:127166625-127166647 CATGATGGCCATTGGGGAGCTGG + Intergenic
964170924 3:153768590-153768612 TAGGATGGGGATGTGGGAGCCGG + Intergenic
965208970 3:165759922-165759944 GAGGATAGGAAGTGGGGAGGGGG - Intergenic
966565568 3:181377076-181377098 GAGGATAGGGTTTGGGTAGAGGG - Intergenic
966622410 3:181980268-181980290 CAGCATATGAATTTGGGAGCAGG - Intergenic
966807645 3:183819312-183819334 CAGCATATGGTTTGGGCAGCTGG - Intronic
967070364 3:185957640-185957662 CTGGATGGGGAATGGTGAGCAGG - Intergenic
968942534 4:3646290-3646312 CAGGACAGAGGGTGGGGAGCAGG + Intergenic
969636165 4:8370512-8370534 CAGGACAGGGATGGGGGAAGAGG + Intronic
969838703 4:9864630-9864652 CAGGCTTGGGTTTGGAGAGCTGG - Intronic
969996893 4:11322620-11322642 GTGGAAAGGGATTGGGGAGTGGG + Intergenic
970252282 4:14128672-14128694 CAGGATAGGGGTGGGAGGGCAGG - Intergenic
972699793 4:41483033-41483055 CAGGATAGTGATTAGAGGGCTGG + Intronic
974901896 4:68009736-68009758 CAGGACATGGAGTGGGGAGAAGG - Intergenic
974977299 4:68906624-68906646 CAGGATAGGGAACTGGGAGCGGG - Intergenic
977776357 4:100924563-100924585 CAGGACAGGGATTGGGGAAGAGG + Intergenic
978818795 4:112939732-112939754 CAGGAAGGGCATTGGGTAGCTGG - Intronic
979160775 4:117458350-117458372 CAGGAGTGGGATTGTGGATCTGG - Intergenic
980113708 4:128659020-128659042 CTGGATGGGGGGTGGGGAGCGGG + Intergenic
981633962 4:146854024-146854046 CAGGGGAGGGATGAGGGAGCTGG - Intronic
981892540 4:149755380-149755402 CAGGAGAGGGATTGAGGGGCTGG - Intergenic
981951837 4:150419022-150419044 GAGGATGGGGAATGGTGAGCGGG + Intronic
982921578 4:161280509-161280531 AAGGATAGAGAGTGGGAAGCAGG - Intergenic
984665800 4:182427916-182427938 CTGGATAGGGTTTTGGGAGGTGG - Intronic
985236416 4:187880290-187880312 GAGGAGAAGGGTTGGGGAGCTGG + Intergenic
986785592 5:11111390-11111412 CTGGCTGGGGATTGGGGATCGGG + Intronic
988776177 5:34479838-34479860 CATCAGAGGGATTGGGAAGCGGG + Intergenic
989978529 5:50613672-50613694 CAACATAGGGTTAGGGGAGCTGG - Intergenic
990312221 5:54550949-54550971 CAGGAATGGGAATGGGGGGCAGG + Intergenic
991319077 5:65348491-65348513 CAGGCTAGGGATGGGAGAGAAGG + Intronic
991453697 5:66780031-66780053 CAAGCAAGGGATTGGGGGGCAGG + Intronic
992177673 5:74166441-74166463 TAGGATAGGGCTGGGTGAGCAGG + Intergenic
994114768 5:96049774-96049796 CAGGATGGATATTGGGGAGTTGG + Intergenic
995481317 5:112595908-112595930 CAGGGCAGGGGTTGGGGAGTTGG - Intergenic
996185994 5:120476031-120476053 CAGCATAGGGATTAGAGAGGTGG - Intronic
997152378 5:131512060-131512082 TAGGAAAGGGAATGGGGAGGAGG + Intronic
997431520 5:133844304-133844326 CAGGCCTGGGAGTGGGGAGCCGG - Intergenic
998429439 5:142058127-142058149 CAGGATAGGGGTTGAGCAGAAGG - Intergenic
999610572 5:153364789-153364811 CAGGATGAGGGTTGGGGAACAGG + Intergenic
1000448332 5:161352551-161352573 CAGGAGTGGGACTGGGGAGATGG + Intronic
1001266258 5:170276595-170276617 CAGGATGGAGCTGGGGGAGCTGG + Intronic
1001334535 5:170786237-170786259 AAGGACAGGGATTGGGGAGATGG + Intronic
1002104906 5:176875229-176875251 CAGGCTAAGGATGGGGGAGTGGG - Intronic
1002176393 5:177403682-177403704 CGGGATTGGGGTTCGGGAGCAGG - Intronic
1004637228 6:17480553-17480575 CTGCATAGGGATTGGGGAGTTGG + Intronic
1005348051 6:24909709-24909731 GAGGGTAGGAAGTGGGGAGCAGG + Intronic
1005641241 6:27798512-27798534 CAGGAAAGGGGATAGGGAGCTGG - Intergenic
1006173229 6:32107431-32107453 CAGGAGCTGGAATGGGGAGCTGG - Intronic
1006804114 6:36777430-36777452 GAGGAGAGGGATTTGGGAGCAGG - Intronic
1006852562 6:37109527-37109549 GAGAATAGGCTTTGGGGAGCGGG + Intergenic
1006980560 6:38144511-38144533 CAGGCTAGGGGGTGGTGAGCAGG + Intronic
1007176729 6:39902322-39902344 CATGGTAGGGGATGGGGAGCAGG - Exonic
1008510834 6:52274188-52274210 CAGAATAAGGTTTGGGAAGCAGG - Intronic
1008517886 6:52335372-52335394 TAGGATAGGGAATGGGGTGGTGG - Intergenic
1008556903 6:52681227-52681249 TGGGATAGGGACTGGGTAGCTGG + Intronic
1010161669 6:72863618-72863640 CATGATAGGTAATGGGGAGTAGG + Intronic
1011041587 6:83035253-83035275 CAGGGTAAGGAGTGGGCAGCAGG - Intronic
1014696832 6:124632412-124632434 GAGGGTAGGGATGGGGGTGCTGG - Intronic
1015106479 6:129542587-129542609 CAGGGAAAGGATTGGGGAGATGG - Intergenic
1015552997 6:134431551-134431573 CAGGAAAGGGAATGGGGGGTGGG + Intergenic
1016016408 6:139190976-139190998 CAGTACAGGGATTGGGAAACAGG - Intergenic
1017472262 6:154750462-154750484 CATGATAGGGATGGGGGAAAGGG - Intronic
1017489629 6:154933656-154933678 CAGGATGGGGATGGGGGTGCCGG + Intronic
1019749285 7:2718710-2718732 CAGGACAGGGCTTGTGCAGCCGG + Intronic
1021301553 7:18979707-18979729 GAGGAAGGTGATTGGGGAGCGGG + Intronic
1021570996 7:22065176-22065198 CAGGATAGGGAATGGGGGAGAGG + Intergenic
1021919640 7:25471881-25471903 CAGGAAAGTCACTGGGGAGCAGG + Intergenic
1022473822 7:30697772-30697794 AAGGGAAGGGATAGGGGAGCAGG - Intronic
1023170585 7:37386806-37386828 CAGGGAAGGGCTTGGGGAGGAGG - Intronic
1024262258 7:47581701-47581723 CAGGACAGGGGCTGGGGCGCGGG - Intronic
1024361848 7:48476518-48476540 TAGGTTGGGGGTTGGGGAGCGGG + Intronic
1025847941 7:65217290-65217312 CAGGATGGGGGGTGGGGAGGAGG - Intergenic
1025898183 7:65723154-65723176 CAGGATGGGGAGTGGGGAGGAGG - Intergenic
1026175404 7:67992103-67992125 CTTGATAGGAATTGGGAAGCAGG + Intergenic
1026652541 7:72227961-72227983 GAGAGTAGGGATTGTGGAGCTGG - Intronic
1027954931 7:84865640-84865662 CAGGAAAAGGGTTGGGGACCGGG + Intergenic
1028401039 7:90425710-90425732 CAGGCTAGGGATGGGGGAGAGGG + Intronic
1028684237 7:93574891-93574913 CAGGAGAGGGAGGGGCGAGCTGG + Intergenic
1030985084 7:116231839-116231861 CATGATAGGAAATGGGGAGCTGG - Intronic
1031965263 7:128023294-128023316 CAGGACTGGGAGTGGGGAGTGGG - Intronic
1032225035 7:130024359-130024381 AAGGCCTGGGATTGGGGAGCTGG + Exonic
1032398874 7:131610111-131610133 CAGGACAGGGGTTGGGGTGGAGG - Intergenic
1032745609 7:134783315-134783337 CGGTACAGGGATGGGGGAGCTGG - Intronic
1032879278 7:136071895-136071917 CAGGAAAGGGATTGGCAAGGTGG - Intergenic
1032947416 7:136869751-136869773 CAGTAGAGGGAATGGGGGGCTGG - Intronic
1033654258 7:143362499-143362521 GAGGAGAGGGATGGGGGAGGGGG + Intronic
1034437427 7:151069872-151069894 CAGGAGATGGGATGGGGAGCAGG - Intronic
1036135858 8:6160987-6161009 CAGGCTTGGGAGAGGGGAGCAGG - Intergenic
1036935920 8:13002833-13002855 CAGGATAGGGGTAGAGGTGCGGG + Intronic
1037124861 8:15335587-15335609 CAGGGCAGGGGTTGCGGAGCAGG - Intergenic
1037463111 8:19133202-19133224 CAGGAGAGGGACTGGTGGGCTGG - Intergenic
1037745011 8:21636276-21636298 CAGACTGGGGCTTGGGGAGCAGG + Intergenic
1038398201 8:27262485-27262507 CAGGATGGCGATCAGGGAGCAGG + Intergenic
1038498429 8:28023791-28023813 GAGGATAGGGATTGGGGTGGGGG - Intronic
1038781311 8:30570417-30570439 CAGGGTAGGGGTTTGTGAGCGGG + Intronic
1039442800 8:37607050-37607072 GGTGATAGGGAGTGGGGAGCGGG + Intergenic
1042491206 8:69400252-69400274 CAGACTAGGAATTGGAGAGCTGG - Intergenic
1044601690 8:94011667-94011689 AGGGATAGGGAGTGGGGAGGTGG + Intergenic
1044740200 8:95318549-95318571 CAGCAGAGGGAATAGGGAGCTGG - Intergenic
1047752581 8:127892910-127892932 CACGATAGGGTGTGGGGAGAGGG - Intergenic
1047974611 8:130117344-130117366 CAAGATAGGGATGGTGAAGCAGG + Intronic
1049208963 8:141376584-141376606 CAGGATGGGAACCGGGGAGCTGG - Intergenic
1049214283 8:141400702-141400724 CAGGATAGGGATGAAGGGGCTGG - Intronic
1049948057 9:617344-617366 TAGGAGAAGGATTGGGGAGGAGG + Intronic
1049988882 9:974798-974820 GAGGCTAGGAAATGGGGAGCTGG - Intergenic
1050273804 9:3975237-3975259 CAGGAGAGGGAGTGGGCAGTTGG + Intronic
1050712057 9:8476170-8476192 CAGGGTGGGGATTGGGGGGATGG + Intronic
1053351963 9:37419041-37419063 CAGGTGAGGTATTGGGGAGAAGG + Intergenic
1053453540 9:38213271-38213293 CAGGATAGGCATTGGAGAAAAGG - Intergenic
1053752063 9:41266776-41266798 CAGGGCAGGTATTGGGGGGCGGG - Intergenic
1054257586 9:62831106-62831128 CAGGGCAGGTATTGGGGGGCGGG - Intergenic
1054333728 9:63784616-63784638 CAGGGCAGGCATTGGGGGGCGGG + Intergenic
1055018222 9:71642181-71642203 AAAGAAAGGGATGGGGGAGCAGG + Intergenic
1057860532 9:98637301-98637323 CAAGAAAGGGCTTGGGGAGGGGG - Intronic
1058302895 9:103398538-103398560 CAGGTTAGGGCTGTGGGAGCCGG - Intergenic
1061100371 9:128487406-128487428 CAGTGTGGAGATTGGGGAGCAGG + Intronic
1061139011 9:128753117-128753139 CAGGGTGGGGTTTGGGGGGCAGG - Intronic
1061365541 9:130171074-130171096 CAGGAGAGATATTTGGGAGCTGG + Intergenic
1061408055 9:130403489-130403511 CAGGAGAAGGGTTGGGGAGGGGG - Intronic
1061661165 9:132131287-132131309 CAGGAGAAGGGATGGGGAGCAGG + Intergenic
1062280753 9:135750648-135750670 CAGGATAGGGATTGGGGAGCAGG - Intronic
1187568282 X:20474723-20474745 CAAGATAGAGAGTGGGGAGGTGG - Intergenic
1189497944 X:41526441-41526463 CATGATAAGGACTGGGTAGCTGG - Intronic
1189971112 X:46419245-46419267 CAGGAAATTGCTTGGGGAGCTGG - Intergenic
1190760538 X:53434365-53434387 CGGGATGGGGATGGGGGCGCGGG + Exonic
1192035515 X:67558646-67558668 CATGATAGGGATTGGAAAACAGG + Intronic
1192743440 X:73915298-73915320 CAGGATGGGAAGTGGGGAGAGGG + Intergenic
1193972729 X:88076468-88076490 CAGGATTGTGTTTGGGGAGGGGG + Intergenic
1196794270 X:119489686-119489708 CAGGATTGGGTGTGGGGAGGTGG + Intergenic
1197455185 X:126670438-126670460 CAGGAGAGAGCTGGGGGAGCAGG + Intergenic
1197902779 X:131392147-131392169 CAGGAAAGAGAGTGGGGAGGGGG - Intronic
1199717776 X:150518516-150518538 CAGGAGAGGGGATGGGGAGGTGG + Intergenic
1199894605 X:152118086-152118108 CAGGATAGGGGTGGGGGATGTGG + Intergenic
1200155845 X:153974552-153974574 CAGGACATGGAATGGGAAGCTGG + Intronic
1201368536 Y:13235188-13235210 CAGAATAGGCACTTGGGAGCTGG + Intergenic