ID: 1062281490

View in Genome Browser
Species Human (GRCh38)
Location 9:135753887-135753909
Sequence CAGTGGTGCTAGAGGGGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 195}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062281481_1062281490 8 Left 1062281481 9:135753856-135753878 CCTGTGGAAGCCCTCGGGCAGCA 0: 1
1: 0
2: 3
3: 29
4: 137
Right 1062281490 9:135753887-135753909 CAGTGGTGCTAGAGGGGCCAGGG 0: 1
1: 0
2: 0
3: 21
4: 195
1062281474_1062281490 23 Left 1062281474 9:135753841-135753863 CCCCATGAACCCGAGCCTGTGGA 0: 1
1: 0
2: 0
3: 6
4: 69
Right 1062281490 9:135753887-135753909 CAGTGGTGCTAGAGGGGCCAGGG 0: 1
1: 0
2: 0
3: 21
4: 195
1062281483_1062281490 -3 Left 1062281483 9:135753867-135753889 CCTCGGGCAGCAAGTCCTTGCAG 0: 1
1: 0
2: 0
3: 14
4: 106
Right 1062281490 9:135753887-135753909 CAGTGGTGCTAGAGGGGCCAGGG 0: 1
1: 0
2: 0
3: 21
4: 195
1062281472_1062281490 24 Left 1062281472 9:135753840-135753862 CCCCCATGAACCCGAGCCTGTGG 0: 1
1: 0
2: 1
3: 4
4: 108
Right 1062281490 9:135753887-135753909 CAGTGGTGCTAGAGGGGCCAGGG 0: 1
1: 0
2: 0
3: 21
4: 195
1062281477_1062281490 14 Left 1062281477 9:135753850-135753872 CCCGAGCCTGTGGAAGCCCTCGG 0: 1
1: 0
2: 0
3: 14
4: 185
Right 1062281490 9:135753887-135753909 CAGTGGTGCTAGAGGGGCCAGGG 0: 1
1: 0
2: 0
3: 21
4: 195
1062281482_1062281490 -2 Left 1062281482 9:135753866-135753888 CCCTCGGGCAGCAAGTCCTTGCA 0: 1
1: 0
2: 0
3: 8
4: 87
Right 1062281490 9:135753887-135753909 CAGTGGTGCTAGAGGGGCCAGGG 0: 1
1: 0
2: 0
3: 21
4: 195
1062281475_1062281490 22 Left 1062281475 9:135753842-135753864 CCCATGAACCCGAGCCTGTGGAA 0: 1
1: 0
2: 0
3: 8
4: 290
Right 1062281490 9:135753887-135753909 CAGTGGTGCTAGAGGGGCCAGGG 0: 1
1: 0
2: 0
3: 21
4: 195
1062281476_1062281490 21 Left 1062281476 9:135753843-135753865 CCATGAACCCGAGCCTGTGGAAG 0: 1
1: 0
2: 2
3: 10
4: 105
Right 1062281490 9:135753887-135753909 CAGTGGTGCTAGAGGGGCCAGGG 0: 1
1: 0
2: 0
3: 21
4: 195
1062281479_1062281490 13 Left 1062281479 9:135753851-135753873 CCGAGCCTGTGGAAGCCCTCGGG 0: 1
1: 0
2: 0
3: 13
4: 159
Right 1062281490 9:135753887-135753909 CAGTGGTGCTAGAGGGGCCAGGG 0: 1
1: 0
2: 0
3: 21
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062281490 Original CRISPR CAGTGGTGCTAGAGGGGCCA GGG Intronic
900403774 1:2483688-2483710 CCAAGGTGCTACAGGGGCCATGG - Intronic
901132253 1:6969325-6969347 GAGTGGAGCTAGAAGGGGCAAGG + Intronic
901647235 1:10723255-10723277 CAGTGGTGATGGACAGGCCAGGG - Intronic
902099364 1:13973278-13973300 CAGTGGATCTAGAGGGGAAAGGG - Intergenic
902552984 1:17230285-17230307 CAGTGTCGCTAGAGAAGCCACGG + Intronic
904499715 1:30907135-30907157 CAGTGTTGCTTGAGAGGCCTGGG + Intronic
904955604 1:34280820-34280842 CAGTGTTGCAAAAGGGCCCAGGG - Intergenic
906210705 1:44010965-44010987 GAGGGGTGTTGGAGGGGCCACGG - Intronic
909172624 1:72315570-72315592 CAATGGTGCTTGAGGTGTCAGGG - Intergenic
909588571 1:77319366-77319388 GAGTAGAGCTAGAGGGGCAAAGG + Intronic
910900840 1:92119367-92119389 CACTGGAGCTAGAGAGGTCAAGG - Intronic
912528729 1:110304693-110304715 CAGTGTGGCCACAGGGGCCATGG - Intergenic
912700519 1:111875054-111875076 CTTTGGTTCCAGAGGGGCCATGG + Intronic
912750996 1:112287526-112287548 CAGTGGTGCCCGAGTGTCCATGG + Intergenic
913255639 1:116950695-116950717 CAGTGGAGACAGAGGGGGCAGGG + Intronic
914455581 1:147833494-147833516 CAGTGCTGTTAGTGGGGGCATGG - Intergenic
921962083 1:221046722-221046744 CAGTGATGCTTGAGTAGCCAAGG + Intergenic
922350836 1:224733634-224733656 CAATGGTGGTAAAGGGCCCAGGG - Intronic
922672191 1:227518968-227518990 CAGTGGGGCTAGAGGGAGCCTGG + Intergenic
924321446 1:242854998-242855020 CAGTGCTGTTAGAGGGGGCACGG - Intergenic
924427676 1:243968041-243968063 CAGTAATGCCAGAGGGACCAGGG + Intergenic
1066053574 10:31659971-31659993 CAGTGGTGCAAGTGGGCCCCTGG - Intergenic
1066697442 10:38091588-38091610 GAATGGTGTTAGAGGGGACAGGG + Intergenic
1067572485 10:47381597-47381619 CATTGCTGCTAGAGGGGTCCAGG - Intronic
1068314212 10:55320365-55320387 CAGTGGTGGTGGTGGGGGCATGG - Intronic
1068386151 10:56330369-56330391 CTTGGGTGCTAGAGGGACCACGG - Intergenic
1069052095 10:63805962-63805984 CTGTGGTGATAGAGGGGAGAAGG - Intergenic
1070271016 10:74955024-74955046 CAGTGGTGGTAGAGGGGTGAGGG - Intronic
1072742361 10:97917191-97917213 CAGTGGGGCAAGAGGTTCCAGGG + Intronic
1076795334 10:132795403-132795425 CAGCCGTCCTAGAGGGGTCACGG + Intergenic
1077153907 11:1083170-1083192 CAGTGGAGCTCGAAGGGCCCGGG - Intergenic
1077497853 11:2895205-2895227 CAGTGGGGGCTGAGGGGCCAGGG + Intronic
1082835187 11:57646231-57646253 CACTGGTGCTTGAAGGGCCATGG + Intronic
1083864001 11:65443786-65443808 CAGTGGTGTTGGCAGGGCCAAGG - Intergenic
1084108496 11:66997233-66997255 CAGTGGTGCCAGAGGTGGCCTGG + Intergenic
1084548870 11:69828897-69828919 CAGTGGGGCTGGGGGAGCCATGG - Intergenic
1085506680 11:77064855-77064877 CAGAGTTGCTGGTGGGGCCAAGG - Intergenic
1085904890 11:80748480-80748502 CAGTGGTGGTAGGAGGGACAAGG - Intergenic
1087951093 11:104220938-104220960 CAGTGTTGGAAGAGGGGCCTGGG - Intergenic
1088540971 11:110913309-110913331 CAGTGGAGCTTCAGGGGCCATGG + Intergenic
1089380942 11:118030955-118030977 CATTAGTGCTAGAGAGGACATGG + Intergenic
1089870887 11:121671832-121671854 TAGTGGTGCTCGATGGACCAAGG - Intergenic
1090767759 11:129891612-129891634 CAGTGGTGCTAATGGTGCTAAGG - Intronic
1097970356 12:65626804-65626826 CAGTGGTACTGGAGTGGCCATGG - Intergenic
1099693789 12:85993530-85993552 CAGTGGGGCTGGAGGGGCCTTGG + Intronic
1108035922 13:46290696-46290718 GAGTGGTGCTCCAGGGGCAAAGG - Intergenic
1109897219 13:68708935-68708957 CAGAGGTTCTAGAAGGGACATGG - Intergenic
1109997782 13:70152538-70152560 CAATGGTGCTATAGGAGCAAAGG - Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112261144 13:97879637-97879659 GAGTGAAGCTAGAGGAGCCAGGG - Intergenic
1112562558 13:100527022-100527044 CAGTGGTCCTCGTGGCGCCAGGG + Intronic
1113701242 13:112390172-112390194 CAGTGGTGCAAGAGGGCTAACGG + Intronic
1114052350 14:18931051-18931073 CAGTTGTGCCAGAGAGGTCAAGG + Intergenic
1114110208 14:19470874-19470896 CAGTTGTGCCAGAGAGGTCAAGG - Intergenic
1115868819 14:37777980-37778002 CTGCTGTGCTGGAGGGGCCAAGG + Intronic
1121495409 14:94388632-94388654 CAGTGGATCCAGAGGGGCAACGG + Exonic
1122112478 14:99511950-99511972 CTGCGGTGCTTGAGGGGCCTTGG + Exonic
1122150829 14:99725325-99725347 CAGTGGCTCAAGAGGTGCCAGGG + Intronic
1123945621 15:25237496-25237518 CAGTGGTGCCAGGGCGGCCCTGG + Intergenic
1124999232 15:34754181-34754203 CAGTGGTGCTTGATGGGGAAGGG + Intronic
1127333450 15:57961083-57961105 CACTGGTGGTATAGGGACCAGGG - Intronic
1128300639 15:66564511-66564533 CAGTGCAGCCAGAGGGGGCAGGG - Intronic
1129169586 15:73799470-73799492 CAGTTGGGCTAGAAGGGCCTTGG + Intergenic
1130157488 15:81364183-81364205 CAGTAGTGCTTGAGGAGCCAGGG + Intronic
1132570990 16:643911-643933 CAGTGGGGCTAGAGGAGCCCTGG + Intronic
1137441756 16:48504127-48504149 CAGAGGTGTTGGAGGGGCCCAGG + Intergenic
1137635210 16:49980061-49980083 CAGTGGTGATTGAGGGGCCCTGG - Intergenic
1139593402 16:67945281-67945303 AAGTAGTGTTAGATGGGCCAGGG - Intronic
1140774746 16:78239479-78239501 CAGAGGGGATAGAGGGGCCTGGG - Intronic
1142154257 16:88526050-88526072 CAGTGAGGCCAGGGGGGCCAGGG + Intronic
1142422713 16:89982339-89982361 CAGGGGTGCAGGAGGGGACACGG - Intergenic
1143180542 17:4981610-4981632 CAGGGCTCCCAGAGGGGCCATGG - Intronic
1143400077 17:6638037-6638059 CTGTGGTGCCTGAGGGGCCTGGG - Intronic
1148133222 17:45274703-45274725 CAGTGGTGATGCAGGGGCCTGGG + Intronic
1148332525 17:46820877-46820899 CAGTGGTGTCTGAGTGGCCAGGG - Intronic
1148731426 17:49839159-49839181 CAGGGGTGCTAGGGAGGCGAGGG + Intronic
1149134189 17:53345033-53345055 CAGTGTTACAAGAGGGGCCCTGG + Intergenic
1150618335 17:66789444-66789466 CAGTGGTGGAAGAGGGGGCGGGG - Intronic
1151952333 17:77362024-77362046 CAGTGTTGGGGGAGGGGCCAAGG + Intronic
1152273168 17:79337309-79337331 CAGTGGTGCCAGAGATGCCAAGG - Intronic
1152432975 17:80260109-80260131 CACTGATGATGGAGGGGCCACGG - Intergenic
1152672209 17:81615597-81615619 CAGAGCTGCTTGTGGGGCCAAGG + Intronic
1152812885 17:82390665-82390687 CCGTGGTGCAGGAGGGGCCCTGG + Intronic
1153880607 18:9418615-9418637 CAGTTGTACTAGGAGGGCCAGGG + Intergenic
1156492697 18:37505731-37505753 CAGTGGGGCTAGAGAGGTTAAGG - Intronic
1157566258 18:48680944-48680966 CAGTGGTGGTGGAGGGGGCGGGG + Intronic
1160303302 18:77705958-77705980 CAGTAGTGCTACACGGCCCAGGG + Intergenic
1160545257 18:79648857-79648879 CAAGGGTGCTAGAGGGGGGAGGG - Intergenic
1164149053 19:22532851-22532873 CAGTGGCGCAGGAGGGTCCAGGG - Intergenic
1164155702 19:22595829-22595851 CAGTGGCGCAGGAGGGTCCAGGG + Intergenic
1165392511 19:35546579-35546601 CATTGGGGTGAGAGGGGCCAGGG + Exonic
1165665513 19:37624042-37624064 CACTGGTGTTAGAGGGGTCCAGG - Intronic
1166537677 19:43585185-43585207 CAGTGGTGGTAGGGGTCCCAAGG + Exonic
1167016803 19:46846327-46846349 CAGGGGTGCTGGAGGGACCCGGG - Intronic
1168637694 19:58009395-58009417 CAGTGGTGGAAAAGGTGCCACGG + Exonic
925906067 2:8540260-8540282 CAGTGGTCCTGGAGGCCCCAGGG - Intergenic
926323033 2:11762254-11762276 CTGGGGTGCTAGAGAGGGCATGG - Intronic
926406168 2:12555122-12555144 CAGTGGTGTGGGAGGAGCCATGG + Intergenic
926693471 2:15753958-15753980 AAGTTGTGCAAGAGAGGCCATGG + Intergenic
927062955 2:19441379-19441401 CAGTGTTGGAAGAGGGGCCTGGG - Intergenic
927095129 2:19742580-19742602 CTGCAGTGCTAGAGAGGCCACGG + Intergenic
931158823 2:59665544-59665566 CAGGGGTGGGAGGGGGGCCAAGG + Intergenic
941540297 2:166773749-166773771 CAGAGGTGCTGTAGGGGCCAAGG - Intergenic
941653995 2:168123981-168124003 CAGTGGATCCAGTGGGGCCAAGG + Intronic
947639163 2:231696642-231696664 CTGTGGTGCGTGAGGGGACAGGG + Intergenic
948429625 2:237911428-237911450 CAGGGCTGCATGAGGGGCCACGG + Intronic
948894497 2:240921923-240921945 CAGTGGTGGCAGAGTGGCCCTGG + Intronic
1169541871 20:6608205-6608227 CATTAGTGCTAGATGGGCCATGG + Intergenic
1172098675 20:32473155-32473177 CAGTGGGGCTGAAGGGACCATGG - Intronic
1172997738 20:39083500-39083522 GAGTGGACCTGGAGGGGCCAGGG + Intergenic
1175444512 20:59010752-59010774 CAGTGGTGCTTGAGGGCAGAGGG + Intergenic
1175929298 20:62486063-62486085 CCATGGTGCTGGAGGTGCCAGGG - Intergenic
1176020157 20:62958653-62958675 CAGAGGTTCTAGGGGAGCCATGG - Intronic
1176380936 21:6111704-6111726 CAGAGGTGCTAAAGGGGTCGAGG + Intronic
1176628386 21:9114985-9115007 CGGTGTTGCTAGAGGGTCAATGG - Intergenic
1177847383 21:26306274-26306296 CAGTGCTGTTAGTGGGGGCACGG + Intergenic
1178552306 21:33551111-33551133 CAGGGGTGCTGGAGTTGCCAGGG + Exonic
1179246415 21:39637729-39637751 CAGAGGTGCTAGAGAGACAATGG + Intronic
1179637708 21:42724097-42724119 CAGAGGTGCTAGAGGGGGTAAGG + Intronic
1179742536 21:43426536-43426558 CAGAGGTGCTAAAGGGGTCGAGG - Intronic
1180944157 22:19680523-19680545 CTGTGGTGTCAGAGAGGCCAAGG + Intergenic
1181781193 22:25194748-25194770 CTGTGGTGCTGGAGGAGACAAGG - Exonic
1183197814 22:36365395-36365417 CAGGGCTGCCAGAGGCGCCAGGG + Intronic
1184029211 22:41881625-41881647 CAGTGGTCCTAGAGGGAGCCAGG + Intronic
1185344033 22:50303721-50303743 CAGCTGTGCCAGAGGGGCCGGGG + Intronic
953680847 3:45036835-45036857 CAGTGGTGGTGGAAAGGCCAAGG - Intergenic
953929413 3:46998573-46998595 CAGTGGGGCCAGATGGGCCATGG + Intronic
954135012 3:48578461-48578483 CAGGGGGACCAGAGGGGCCAGGG + Exonic
955575969 3:60363749-60363771 CAGGGGGGCCAGGGGGGCCAGGG - Intronic
960688160 3:120314357-120314379 CTATTGTGCTGGAGGGGCCAAGG - Intergenic
961026519 3:123563144-123563166 CAGTGGTACTGGTGGGGACATGG + Intronic
961126806 3:124426069-124426091 CAGTGGCCCTCGAGGTGCCAAGG + Intronic
961204299 3:125068618-125068640 CAGTGGGGCAAGAGGGGTGAAGG + Intergenic
961607175 3:128104929-128104951 AAGAGGTGGCAGAGGGGCCATGG + Intronic
966215577 3:177498863-177498885 CAGTGGTAATAGAGAGGCCTTGG - Intergenic
968460943 4:724405-724427 CAGCGGTGCTGTGGGGGCCATGG + Intronic
968703702 4:2068775-2068797 CTGAGGGGCAAGAGGGGCCAGGG - Exonic
968956707 4:3723175-3723197 CAGTGGTGCTGTGGGGGCCGGGG + Intergenic
968958980 4:3733309-3733331 CAGTGGAGCTTGAGGGAGCAGGG + Intergenic
969418042 4:7073909-7073931 AAGTGGGGGTAGAAGGGCCACGG - Intergenic
969476312 4:7424403-7424425 CAGTGATGCCAGAGGGACAACGG - Intronic
969548280 4:7846447-7846469 GAGGGGTTCTGGAGGGGCCATGG + Intronic
969719465 4:8885298-8885320 CTGTGCTGCCAGAGGGGACAGGG + Intergenic
970203898 4:13636540-13636562 CAGTTGCTCTAGAGAGGCCATGG + Intergenic
970272021 4:14358304-14358326 CAGCTCTGCTAGAGGGGCCTGGG - Intergenic
971831741 4:31704193-31704215 CTGTGAAGATAGAGGGGCCAGGG - Intergenic
972662865 4:41133737-41133759 CAGTGGGGAGAGAGGGACCAAGG - Intronic
977406554 4:96606983-96607005 GAATAGTGCTAGATGGGCCATGG - Intergenic
978565141 4:110073429-110073451 CATTGGTGCTTAAGGGCCCAAGG - Intronic
978576635 4:110196493-110196515 CGGTGGGGCTCGAGGGGCCTCGG + Intronic
980442557 4:132867615-132867637 CAGTGGTGGTAGTGGGCACAGGG + Intergenic
981107966 4:140902968-140902990 CAGTGGTGCTAGAAGGAGAAAGG + Intronic
981817004 4:148842415-148842437 CAGTGGTTCTAAAAGGTCCATGG + Intergenic
988267652 5:28972569-28972591 CAGTGGTGCCAGTGGGTCCCCGG - Intergenic
990820145 5:59829817-59829839 CAGTAGGGCGAGAGAGGCCATGG + Intronic
990919427 5:60945761-60945783 CAAAGGGGCTAGAAGGGCCAGGG + Intronic
991923844 5:71684220-71684242 CAGTGCTGTTAGAGAGGGCATGG + Intergenic
992425002 5:76648008-76648030 GAGTGGTGTGAGAGGAGCCAAGG + Intronic
993002822 5:82399403-82399425 CAGTGTTGCTAGAGGAGTGATGG + Intergenic
997032139 5:130142802-130142824 CAGTGGGACTGGAAGGGCCAAGG + Intronic
997972879 5:138418420-138418442 CAGTGTTGCCAGAAAGGCCATGG - Intronic
998045708 5:138984994-138985016 CAGAGCAGCTAGAGGGGCCGAGG + Intronic
998160380 5:139809656-139809678 CATTGGTGAGAGAGAGGCCAAGG - Exonic
1001704665 5:173733297-173733319 CAGTGAGGCAAGAGTGGCCATGG + Intergenic
1001886364 5:175293935-175293957 CTGCTGTGCTGGAGGGGCCAAGG - Intergenic
1001923200 5:175616917-175616939 CAGTGGTGATGGAGGGACAAGGG + Intergenic
1002856522 6:1042965-1042987 GAGTGGTGCTCGAGGGGCTGGGG + Intergenic
1010165139 6:72906243-72906265 CAGTGCTGCTAGCAGGGGCATGG - Intronic
1012157256 6:95834895-95834917 CATTTGTGTTATAGGGGCCAAGG - Intergenic
1013409988 6:109875618-109875640 CATTGGAGCTAGAGGGACCATGG + Intergenic
1016869058 6:148798658-148798680 CAGTGATGTTATGGGGGCCAGGG + Intronic
1017931462 6:158959112-158959134 CAGGGCTGCTAGTGGAGCCATGG - Intergenic
1018031307 6:159844216-159844238 GAGTGGTGCTAGAAGGGCCCTGG + Intergenic
1018050684 6:160005781-160005803 CAGGGAGGCTCGAGGGGCCAAGG - Intronic
1019047118 6:169157776-169157798 CAGAGGTGCTGGCAGGGCCATGG - Intergenic
1022877885 7:34553383-34553405 CTGTAGTGTTGGAGGGGCCAAGG - Intergenic
1026974741 7:74490455-74490477 CAGTGGGGGTAGAGTGGCCTGGG - Intronic
1027833102 7:83206010-83206032 CAAAGGTGCTAAAAGGGCCAGGG - Intergenic
1029905864 7:104093021-104093043 CAGTGGGGCTGGAGGAGACAAGG + Intergenic
1029930939 7:104370385-104370407 CGGTGGTGCTAGAGGGAGCCTGG - Intronic
1030689486 7:112517753-112517775 CAGTGGTGGTAAAGGGGTGATGG + Intergenic
1034960635 7:155362235-155362257 CATTGGTCCCAGAGAGGCCAAGG - Intronic
1035646118 8:1222446-1222468 CTGCTGTGCTGGAGGGGCCAAGG + Intergenic
1037388189 8:18365225-18365247 CACTGGTGCCAGAGTGCCCAGGG - Intergenic
1037440280 8:18909289-18909311 CAGTGGTGTTAATGGGGCCACGG - Intronic
1039144980 8:34437621-34437643 CAGTGCTGTTGGAGGGGACATGG + Intergenic
1039471483 8:37815990-37816012 AAATGGCGCTAGAGGGGCCAAGG - Intronic
1049116814 8:140695830-140695852 CAGTGGATCTGGAGAGGCCAAGG - Intronic
1049653018 8:143784215-143784237 CAGTGTTGCAGGAGGGGCCTGGG + Intergenic
1052664578 9:31478333-31478355 CAATGTTGCAAGAGGGGCCTGGG - Intergenic
1054769510 9:69070419-69070441 CAGAAGTGCTAGGGGGACCATGG + Intronic
1055792875 9:79942466-79942488 CTTTGGTGCTAGAGGGGCAAAGG + Intergenic
1057820579 9:98327378-98327400 AAGTGCTGCTGGAGGGGCCAAGG - Intronic
1060926169 9:127456917-127456939 CAGGGCTGGCAGAGGGGCCAGGG - Intronic
1061561978 9:131410407-131410429 CAGGGGTGCTGGCAGGGCCAGGG + Intronic
1061681239 9:132243393-132243415 AAGGGGTGCTGGAGGGGACAGGG + Exonic
1062004142 9:134230848-134230870 GAGTGGTCCTAGAGGAGCTAAGG + Intergenic
1062249581 9:135587493-135587515 CAGTGTTGGGGGAGGGGCCAGGG + Intergenic
1062281490 9:135753887-135753909 CAGTGGTGCTAGAGGGGCCAGGG + Intronic
1062319626 9:135984385-135984407 CAGAGGGGCTGGAGGGGACAAGG + Intergenic
1203751231 Un_GL000218v1:82668-82690 CGGTGTTGCTAGAGGGTCAATGG - Intergenic
1189926500 X:45960290-45960312 CTGCTGTGCTGGAGGGGCCAAGG - Intergenic
1189941955 X:46133676-46133698 GAGTGATGCTGGAGTGGCCATGG - Intergenic
1190218250 X:48494161-48494183 CAGTGATGCTAGAGGAGCCCAGG - Intergenic
1190777208 X:53562472-53562494 GGGTGGTGCTTGAGGAGCCATGG + Intronic
1193449414 X:81647215-81647237 CTGCTGTGCTGGAGGGGCCAAGG + Intergenic
1194424440 X:93719127-93719149 CAGTGGTTACAGAGGGGCAAGGG - Intergenic
1194574014 X:95589218-95589240 CAGTAGTGCTAGTAGGGACAAGG - Intergenic
1198116771 X:133551793-133551815 CTGTGGAGCTAGAGGGGCACAGG - Intronic
1200970854 Y:9150850-9150872 CAGTGGTGCTAGAGGAATTAAGG + Intergenic
1201782700 Y:17740995-17741017 CTGTGGTACTAGATTGGCCAGGG + Intergenic
1201818853 Y:18164993-18165015 CTGTGGTACTAGATTGGCCAGGG - Intergenic
1202140177 Y:21713463-21713485 CAGTGGTGCTAGAGGAATTAAGG - Intergenic
1202174045 Y:22081165-22081187 CTGTGGTCCTAGGGTGGCCAGGG + Intronic
1202217315 Y:22505217-22505239 CTGTGGTCCTAGGGTGGCCAGGG - Intronic
1202325871 Y:23690842-23690864 CTGTGGTCCTAGGGTGGCCAGGG + Intergenic
1202544900 Y:25979212-25979234 CTGTGGTCCTAGGGTGGCCAGGG - Intergenic