ID: 1062281743

View in Genome Browser
Species Human (GRCh38)
Location 9:135754953-135754975
Sequence CTCCTTATGGTCCCCTCCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 127}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062281736_1062281743 -9 Left 1062281736 9:135754939-135754961 CCTTCCCTTCCCTCCTCCTTATG 0: 1
1: 2
2: 14
3: 195
4: 1636
Right 1062281743 9:135754953-135754975 CTCCTTATGGTCCCCTCCAAAGG 0: 1
1: 0
2: 2
3: 12
4: 127
1062281734_1062281743 8 Left 1062281734 9:135754922-135754944 CCTCCTCTCTTGGGGAACCTTCC 0: 1
1: 0
2: 2
3: 20
4: 209
Right 1062281743 9:135754953-135754975 CTCCTTATGGTCCCCTCCAAAGG 0: 1
1: 0
2: 2
3: 12
4: 127
1062281733_1062281743 12 Left 1062281733 9:135754918-135754940 CCATCCTCCTCTCTTGGGGAACC 0: 1
1: 0
2: 2
3: 9
4: 258
Right 1062281743 9:135754953-135754975 CTCCTTATGGTCCCCTCCAAAGG 0: 1
1: 0
2: 2
3: 12
4: 127
1062281728_1062281743 29 Left 1062281728 9:135754901-135754923 CCTGCTGCAGTCCTGCTCCATCC 0: 1
1: 0
2: 1
3: 47
4: 342
Right 1062281743 9:135754953-135754975 CTCCTTATGGTCCCCTCCAAAGG 0: 1
1: 0
2: 2
3: 12
4: 127
1062281735_1062281743 5 Left 1062281735 9:135754925-135754947 CCTCTCTTGGGGAACCTTCCCTT 0: 1
1: 0
2: 0
3: 21
4: 202
Right 1062281743 9:135754953-135754975 CTCCTTATGGTCCCCTCCAAAGG 0: 1
1: 0
2: 2
3: 12
4: 127
1062281729_1062281743 18 Left 1062281729 9:135754912-135754934 CCTGCTCCATCCTCCTCTCTTGG 0: 1
1: 0
2: 3
3: 59
4: 555
Right 1062281743 9:135754953-135754975 CTCCTTATGGTCCCCTCCAAAGG 0: 1
1: 0
2: 2
3: 12
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062281743 Original CRISPR CTCCTTATGGTCCCCTCCAA AGG Intronic
901961926 1:12833693-12833715 CTCTGTATTGTCCCTTCCAATGG + Intergenic
901963446 1:12846112-12846134 CTCTGTATTGTCCCTTCCAATGG + Intergenic
901990642 1:13110442-13110464 CTCTGTATTGTCCCTTCCAATGG + Intergenic
903340806 1:22653163-22653185 CCCCTGACGGTCCCCTCCCATGG - Intronic
903659932 1:24970728-24970750 CTCCCTAAAGTCCCTTCCAAGGG + Intergenic
906304263 1:44706478-44706500 CTCCTTATGCTCTCCTCCCCGGG - Intronic
910858081 1:91716276-91716298 CTCTTTTTGGTGCCCTCCCAGGG - Exonic
913058996 1:115187599-115187621 CTCCTTCTGGTGGCCTCCAGAGG + Intergenic
918311534 1:183288883-183288905 ACCCTTCTGGTCCCCTTCAAAGG - Intronic
920309681 1:205041772-205041794 TTCCTTCTGAGCCCCTCCAAAGG - Intergenic
921135601 1:212256588-212256610 CCCCTTCTGCTCCCCTCCCATGG + Intergenic
1065474473 10:26119137-26119159 TTCCTGATGGCCTCCTCCAAGGG + Intronic
1068258324 10:54543116-54543138 CTCCGAATGGCCCACTCCAAGGG + Intronic
1069123271 10:64596493-64596515 CTGCTGCTGGTACCCTCCAAAGG - Intergenic
1070640920 10:78169316-78169338 CTCCTTCTCGTCCCATCCCAAGG - Intergenic
1070755475 10:78989433-78989455 CTCCACATGGGCCCCTCCATGGG + Intergenic
1071208818 10:83314389-83314411 CTCCTTATGATCATCACCAAGGG - Intergenic
1075388549 10:122075510-122075532 CCCCTTATGGTCACGTCCATTGG - Intronic
1084044950 11:66563098-66563120 CGCCGTATGGTGCCCTACAAGGG + Exonic
1084703928 11:70804903-70804925 CTACTCAGGGTCCCCTCTAAGGG + Intronic
1087746188 11:101949990-101950012 CTCCTTCTGGTACCTTCCACTGG + Intronic
1088548116 11:110982075-110982097 CTCCTGAAGGTCTCATCCAAAGG - Intergenic
1089054802 11:115576932-115576954 TTCATTATGCTCCCCTCCAGGGG - Intergenic
1089124655 11:116168249-116168271 CCCCTTAGGGTCCCCTCCCTTGG + Intergenic
1089665454 11:120015071-120015093 TTCCTTTTGGTCCCCTCTCAAGG - Intergenic
1090394308 11:126408637-126408659 CGCCTTAGGCTGCCCTCCAAGGG + Intronic
1096534931 12:52265726-52265748 CTTGATATGGCCCCCTCCAATGG - Intronic
1099833382 12:87874905-87874927 CTACTTATGAGCCCCTCCAAAGG - Intergenic
1103512376 12:121484192-121484214 CTCCTTATGGACTGCTGCAAGGG - Intronic
1106405659 13:29470750-29470772 CTCCTTCTGCTCTCCTCCATGGG + Intronic
1116796044 14:49391285-49391307 CTCCCTTTGGTCACCTACAAAGG + Intergenic
1118632556 14:67719124-67719146 CTCTGTATTGTACCCTCCAATGG - Intronic
1119778059 14:77260411-77260433 CCTCTCATGGTCCCCTCCCAGGG + Intergenic
1120296612 14:82649447-82649469 ATCCTCATGGTCCCCTACAATGG - Intergenic
1121304648 14:92898505-92898527 CTCATTTTGCTCCCCTCCAGTGG - Intergenic
1121931367 14:97975599-97975621 ATCTTTATTGTCCCCTCCATGGG - Intronic
1122009609 14:98735287-98735309 CTCAATATGGTGGCCTCCAAAGG + Intergenic
1123982488 15:25616546-25616568 CTCCTCGTGGGCCCCTCCACAGG + Intergenic
1124394369 15:29288480-29288502 CTCCTTCAGGTCCCCAGCAATGG + Intronic
1126799892 15:52289149-52289171 CTCCTCATGGGCCCCTCCCCTGG + Intronic
1129377499 15:75143327-75143349 CTCCTTCTGGTCCCATGCGATGG + Intergenic
1130056703 15:80532526-80532548 CTCCGAATAGTCCTCTCCAAAGG + Intronic
1130166790 15:81469513-81469535 TTCCTTATGTTCTCCTTCAATGG - Intergenic
1132877748 16:2147969-2147991 CCCCTGAGGGTCCCCTCCCACGG - Intronic
1134396276 16:13866870-13866892 CTCCTTATGCTCCTCTCCCTTGG + Intergenic
1137379030 16:47980856-47980878 CTCCTCATGATCCCCTCGGATGG + Intergenic
1142011013 16:87714180-87714202 CTCCTGATGGGCCCCTCCAAGGG - Intronic
1142615936 17:1135141-1135163 CTATTTATAGTCCCCTCCAGGGG - Intronic
1144714703 17:17425836-17425858 CTCCTTCTGGTCCCACACAATGG - Intergenic
1145784035 17:27582640-27582662 CTCCTTGTGCTCCCCTCCTGTGG - Exonic
1151336069 17:73440500-73440522 CTCCCTCTGGGCTCCTCCAAGGG + Intronic
1151387027 17:73761221-73761243 CTCCTTCAGGCCCCATCCAATGG - Intergenic
1152688879 17:81708465-81708487 CCCTTTCTGGTCCCATCCAAGGG - Intergenic
1154079975 18:11246681-11246703 TTTCTTATTTTCCCCTCCAACGG - Intergenic
1154491177 18:14923384-14923406 CTCCTCATGGTCACCACCACAGG - Intergenic
1159709964 18:71745703-71745725 CTCCATGTGGTCCCTTCCCATGG - Intronic
1162905062 19:13818313-13818335 CTCCTCATTGGCCCCGCCAATGG + Intronic
1163390479 19:17027183-17027205 CCCCTTATGGCCCCCTCCCCGGG + Intergenic
1164830782 19:31318930-31318952 CTCCTCATGGGCTCCTCCCATGG + Intronic
1167524862 19:49977349-49977371 CTCGTTATGTTCCCAACCAAGGG + Intronic
1167717624 19:51154151-51154173 CTCTTGCTGGTCCCCTCCAGAGG + Intergenic
925738948 2:6988397-6988419 CTCCTTAGAGTCCTCTCCACTGG + Intronic
927473706 2:23396211-23396233 CTCCTTATGGCCACCAACAATGG - Intronic
929185729 2:39091876-39091898 CTCCTAATGGTTTACTCCAATGG + Intronic
930854424 2:55997443-55997465 CTCCTAATCGGCCCCTCCTAAGG - Intergenic
932224100 2:70025511-70025533 CTCCTTATGGTTCTATCCATGGG + Intergenic
937016690 2:118612203-118612225 GTTCTTATGGTGCCCTCCTAGGG + Intergenic
944090952 2:195911014-195911036 CTCCTTATGGACACCTCCACGGG + Intronic
945159965 2:206879643-206879665 CTCCTTCTGGGCACATCCAAAGG - Intergenic
945244021 2:207701737-207701759 CTCCTTTTATTCCCCTCCAAGGG + Intergenic
946951088 2:224876072-224876094 GTCCTGAGGGGCCCCTCCAAGGG - Exonic
948499481 2:238381379-238381401 ATGCCTATGGCCCCCTCCAAGGG - Intronic
948962687 2:241353318-241353340 CTCCTTATGGTACACTCCAGCGG + Intronic
1169019746 20:2320746-2320768 CTCCTTCGGGTCCACTGCAAAGG + Intronic
1169872824 20:10265611-10265633 CTCCTAATGGTGCCCTGCACTGG - Intronic
1171783467 20:29442362-29442384 CTCCTTATGCTCCTCTCTATTGG - Intergenic
1176421866 21:6522637-6522659 CTTCTGATGAGCCCCTCCAAAGG + Intergenic
1177748619 21:25252436-25252458 CTCCTTCTGGTCCACTCTTAGGG + Intergenic
1177939045 21:27386103-27386125 CTTCCTATGCTCCCCTCCCAAGG - Intergenic
1179034395 21:37747239-37747261 CCCCTTCTGGCCCTCTCCAAAGG - Intronic
1179311730 21:40202115-40202137 CTTCTCATGGTCCTCTCCATAGG - Intronic
1179697356 21:43130953-43130975 CTTCTGATGAGCCCCTCCAAAGG + Intergenic
1181009728 22:20033168-20033190 TTCCTGATGGTCCCCTCCCCAGG + Intronic
1181473634 22:23155782-23155804 CTCCTTATGATCTCTTCCTAGGG - Intronic
1181518297 22:23430489-23430511 CTCCATATGGACCTCTCCATAGG + Intergenic
1183067853 22:35375858-35375880 CACATTATGGACCCCTCCAGGGG - Intergenic
950557782 3:13705748-13705770 CTCCACATGCCCCCCTCCAATGG - Intergenic
950557851 3:13706054-13706076 CTCCACACAGTCCCCTCCAATGG - Intergenic
952514541 3:34090756-34090778 GTTTTTATAGTCCCCTCCAAGGG - Intergenic
954030196 3:47813757-47813779 CTCCTTCTGGCCCCATTCAATGG - Intronic
957082004 3:75644200-75644222 CTCCTTATGCTCCTTTCCATCGG + Intergenic
960384329 3:117002915-117002937 CTCCTTATGGGTTCCTCCAATGG - Intronic
961078591 3:124004751-124004773 CTCTTTATGGTGACCTCAAAGGG - Intergenic
964272459 3:154972296-154972318 CTCCTTTTGGGCTTCTCCAAAGG + Intergenic
964954686 3:162338192-162338214 CTCCTTACTGTCCCCTGCAAAGG + Intergenic
966994409 3:185265865-185265887 CTCCTTCTTGTCCCCTTAAAAGG + Intronic
967861936 3:194159090-194159112 CTCCACCTGGTCCCCTCCAGGGG - Intergenic
978426718 4:108590984-108591006 CTCCTTTGGGTCAGCTCCAAGGG + Intergenic
980163255 4:129193146-129193168 CTCCTAATGTTCCTCTCCAATGG - Intergenic
980990619 4:139735555-139735577 CTCCTTATCGCCCCCTCCCCGGG - Intronic
981126176 4:141109551-141109573 TTCCTTATGATCCCATCTAAGGG - Intronic
981490207 4:145331430-145331452 CTGCTTTTGGTCTCCTCTAAAGG - Intergenic
987031182 5:13978077-13978099 CTCCATATTCTCCCCTCCATAGG - Intergenic
988700861 5:33673334-33673356 CTCCTGATGGTCACCTCCACAGG + Intronic
990807746 5:59684958-59684980 CTCCTTATATTCCTCTACAAGGG + Intronic
993078005 5:83259456-83259478 GACCTTATGGACCCCTACAAAGG - Intronic
1003606061 6:7562085-7562107 CTCCCTATGGGCCACTTCAAAGG - Intronic
1004829569 6:19462724-19462746 CTCATCATGGTCCCCTGCCAAGG + Intergenic
1008577042 6:52870749-52870771 CTCCTTATAGTCCCATGAAATGG + Intronic
1008779762 6:55089405-55089427 CTCCTTTTGTTACACTCCAAAGG + Intergenic
1009243137 6:61203421-61203443 CTCCTTCTGATCCCATGCAATGG + Intergenic
1009956409 6:70460123-70460145 GTCCTTATGGTTACCTCCATAGG + Intronic
1011771401 6:90677583-90677605 TTCCATATGGTCTCCTCCCATGG + Intergenic
1012552526 6:100477102-100477124 ATCCTTATGATGACCTCCAAGGG - Intergenic
1013159058 6:107523706-107523728 CTGCTTGTGCTCCCCTCCAGTGG + Intronic
1020127451 7:5541019-5541041 CTCCTTCTCCACCCCTCCAAGGG - Intronic
1022978582 7:35580860-35580882 CTCCATATGGGCCACTCCACAGG + Intergenic
1024458122 7:49631862-49631884 ATCATTATGGTCCCGTCCTACGG - Intergenic
1026684274 7:72494903-72494925 CTCCATATGGTCCTCCCCAAGGG + Intergenic
1026766959 7:73166175-73166197 CTCCATATGGGCCTCTCCATGGG - Intergenic
1027043444 7:74975911-74975933 CTCCATATGGGCCTCTCCATGGG - Intronic
1027080202 7:75226448-75226470 CTCCATATGGGCCTCTCCATGGG + Intergenic
1029389408 7:100265055-100265077 CTCCATATGGGCCTCTCCATGGG + Intronic
1029439849 7:100581551-100581573 CTCCTTGTGGTACTCTCCGATGG - Intronic
1031436824 7:121742553-121742575 CTCCTTATGTGCCACTCCAGTGG - Intergenic
1031473272 7:122192160-122192182 CACCCAATGGTCCCCACCAATGG - Intergenic
1039141302 8:34391734-34391756 TTCCATATGGTTCCCTCCACAGG + Intergenic
1041042092 8:53857374-53857396 TTCCTTATGGTCTCCATCAAAGG - Intronic
1041504565 8:58581295-58581317 CTCCTTTTTACCCCCTCCAAGGG - Intronic
1043478761 8:80631541-80631563 GTCCTCATTGTCCCCTCCTAAGG + Exonic
1044235642 8:89826949-89826971 CTCCTGATTGTCCCATCAAAGGG - Intergenic
1049817234 8:144611277-144611299 CTTTTTATGGTCCCCTAAAATGG + Intergenic
1050005315 9:1123380-1123402 CTCTTGCTGGTGCCCTCCAAAGG + Intergenic
1058643278 9:107107594-107107616 CTCCTTAAGGCCCTCTCCCATGG + Intergenic
1061288605 9:129638363-129638385 CTCCTCTTTGTCCCCTCCCACGG + Exonic
1061906602 9:133702456-133702478 CCCCGTATGGGCCCCTCCAAGGG - Intronic
1062281743 9:135754953-135754975 CTCCTTATGGTCCCCTCCAAAGG + Intronic
1062432441 9:136532119-136532141 CTCCTTATGGGCCCCTCCCAGGG - Intronic
1203443491 Un_GL000219v1:33218-33240 CTCCTTATGCTCCTCTCTATCGG - Intergenic
1203514299 Un_KI270741v1:152127-152149 CTCCTTATGCTCCTCTCTATCGG - Intergenic
1189727719 X:43985282-43985304 CTTTTTATGCTCCCCTCCAAAGG - Intergenic
1189956679 X:46282839-46282861 CTCCATATGGTCCTCTCTACAGG + Intergenic