ID: 1062284864

View in Genome Browser
Species Human (GRCh38)
Location 9:135768373-135768395
Sequence GAGTCACAGTGCCCCCTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 161}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062284864_1062284865 -4 Left 1062284864 9:135768373-135768395 CCACTGAGGGGGCACTGTGACTC 0: 1
1: 0
2: 0
3: 11
4: 161
Right 1062284865 9:135768392-135768414 ACTCCTGACCAGCAGAGAGTAGG 0: 1
1: 0
2: 1
3: 10
4: 218
1062284864_1062284866 -3 Left 1062284864 9:135768373-135768395 CCACTGAGGGGGCACTGTGACTC 0: 1
1: 0
2: 0
3: 11
4: 161
Right 1062284866 9:135768393-135768415 CTCCTGACCAGCAGAGAGTAGGG 0: 1
1: 0
2: 2
3: 22
4: 427
1062284864_1062284867 -2 Left 1062284864 9:135768373-135768395 CCACTGAGGGGGCACTGTGACTC 0: 1
1: 0
2: 0
3: 11
4: 161
Right 1062284867 9:135768394-135768416 TCCTGACCAGCAGAGAGTAGGGG 0: 1
1: 0
2: 1
3: 36
4: 842

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062284864 Original CRISPR GAGTCACAGTGCCCCCTCAG TGG (reversed) Intronic
900145915 1:1158605-1158627 GAGCCACTGGGCCCCCTCCGTGG + Intergenic
901026570 1:6281595-6281617 GAGCCACTGTGCCCCCACGGGGG + Intronic
901678051 1:10898321-10898343 GGGTCAGAGGGCCCCCTCAAGGG + Intergenic
902377920 1:16038762-16038784 GAGCCACAGTGCCCGGCCAGGGG - Intergenic
902606755 1:17573393-17573415 GAGCCACGGTGCCCCATCACAGG + Intronic
902867262 1:19287865-19287887 GAGTCTCACTGCCCTCTCTGTGG - Intronic
904674305 1:32189311-32189333 AAGGCACACTGCCCCCTCACTGG - Intronic
905239425 1:36572248-36572270 GAGTCACAGTGTCCTCCCATAGG + Intergenic
911055200 1:93702608-93702630 CAGTCACAGAGCTCTCTCAGAGG + Intronic
911219778 1:95234334-95234356 GAGGGACAGGGCGCCCTCAGGGG + Intronic
918279592 1:182990867-182990889 CAGTCACTGTGCCTCCTCCGTGG + Intergenic
920491145 1:206416315-206416337 CAGTCTCAGTGCTGCCTCAGAGG - Intronic
921559122 1:216635649-216635671 GAATTACAGAGACCCCTCAGTGG - Intronic
921702318 1:218282568-218282590 GAGTTGCACTGCCCACTCAGAGG - Intergenic
1063384287 10:5606450-5606472 GGCACACAGTGGCCCCTCAGGGG - Intergenic
1064641589 10:17420817-17420839 GACTCACAGTTCCACCTGAGTGG + Intronic
1065784611 10:29201872-29201894 GAGTCACAGGGCTCCTTCTGTGG - Intergenic
1066703735 10:38156620-38156642 GGGTCCCAGTGCCCTCTCACTGG + Intergenic
1070559506 10:77555216-77555238 GAGTCAGACGGCCCCCTCACAGG + Intronic
1072486312 10:95859270-95859292 GAGTCACAGTGAGCCCCCAATGG + Intronic
1073043985 10:100625503-100625525 GACTCACAGTGCGGCCTCAGCGG - Intergenic
1073816927 10:107217777-107217799 GAGCCACAGTGCCCGGCCAGTGG - Intergenic
1075023564 10:118967993-118968015 AAGCCACAGTCCCACCTCAGTGG - Intergenic
1076127537 10:127987207-127987229 CAGTCACAGTTTCCCCTAAGAGG + Intronic
1077199504 11:1298433-1298455 GACCCACAGTGCTCCCTCAGAGG - Intronic
1077229201 11:1451063-1451085 GACTGGCAGTGCCCCCTCGGTGG - Intronic
1078894662 11:15587318-15587340 GGCTCTCAGTGCCCCCTCAAAGG + Intergenic
1081935778 11:46903035-46903057 GAGTCACAGTGACACTTCAAGGG + Intronic
1082009099 11:47438332-47438354 GAGTCAGAGAGGCCCCTCAAAGG - Intronic
1084104977 11:66975286-66975308 GAGGCACTGGGCCACCTCAGAGG + Exonic
1084429211 11:69101979-69102001 GAGTCTGAGTGTCCCCACAGTGG - Intergenic
1088785478 11:113177806-113177828 GAGAGACAGTCCCACCTCAGCGG - Intronic
1089682240 11:120125095-120125117 GAGTCATGCTGTCCCCTCAGAGG - Intronic
1090923528 11:131229919-131229941 GAGTCCCACAGCCCCTTCAGAGG + Intergenic
1091196317 11:133733826-133733848 GTGTCACAGGGACCCCTCAGAGG - Intergenic
1091364519 11:135006635-135006657 GAGGCCGAGTGTCCCCTCAGAGG - Intergenic
1093530829 12:20161081-20161103 GAGACAGAGTGCCTCGTCAGTGG - Intergenic
1093542603 12:20305056-20305078 TAGTCAAAGTTCCACCTCAGTGG + Intergenic
1094488504 12:30943774-30943796 CAGTCACAGTGTCCACTCATCGG + Intronic
1096840179 12:54375223-54375245 GAGTCCCAGTGGAGCCTCAGAGG + Intronic
1098224206 12:68304801-68304823 AAGTCACTGTGGCTCCTCAGTGG - Intronic
1102074350 12:110048206-110048228 GAGTCTCGGGGCCCCCTGAGGGG + Intronic
1102811693 12:115829731-115829753 GAGTCACAGTTCCACATCACTGG - Intergenic
1103014299 12:117481943-117481965 GATCCACAGGGTCCCCTCAGGGG - Intronic
1103700205 12:122845310-122845332 GAGGCACAGTGCTCGCACAGTGG - Intronic
1104023603 12:125010368-125010390 CAGCCACAGTGCCACCTCTGAGG + Intronic
1105543958 13:21338562-21338584 GAGCCACAGTGCAGCCTCTGTGG + Intergenic
1106388077 13:29307570-29307592 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1108542086 13:51453706-51453728 GAGTCCCAGCGCTCCCTCTGGGG + Intronic
1110493762 13:76140250-76140272 GAGCCACAGTGCCCAGCCAGTGG + Intergenic
1114055551 14:18964828-18964850 GTGTCCCAGGGCACCCTCAGTGG - Intergenic
1114106995 14:19436935-19436957 GTGTCCCAGGGCACCCTCAGTGG + Intergenic
1116682050 14:47984353-47984375 GAGTCACAGGGCCATCTCTGAGG - Intergenic
1117915155 14:60670314-60670336 GAATTGCAGTGGCCCCTCAGAGG + Intergenic
1118385135 14:65249943-65249965 CAGTTACAGTGCCAGCTCAGCGG - Intergenic
1118739400 14:68728123-68728145 GACTCACGGTGACACCTCAGTGG - Intronic
1121100085 14:91244540-91244562 GTTTCAGAGTCCCCCCTCAGAGG - Intronic
1121510862 14:94512238-94512260 ATGTCACAATGCCCCCTGAGAGG - Intronic
1202918906 14_KI270723v1_random:12824-12846 GTGTCACAATACCCCCTGAGGGG + Intergenic
1202925723 14_KI270724v1_random:22168-22190 GTGTCACAATACCCCCTGAGGGG - Intergenic
1124093516 15:26628363-26628385 GAGGCACTGTGAGCCCTCAGGGG + Intronic
1124632909 15:31347454-31347476 GCGTCAAAGGGCACCCTCAGGGG + Intronic
1125345230 15:38712529-38712551 AAGTGCCAGTGCCCCTTCAGTGG - Intergenic
1128541796 15:68540943-68540965 GAGTCACTGTGCCCTTGCAGAGG - Intergenic
1129174769 15:73832062-73832084 AAGTCACAGTGACTGCTCAGTGG + Intergenic
1129423353 15:75447887-75447909 GAGTCACCGTGCCCGGTCATGGG - Intronic
1132518098 16:375265-375287 GAGCCAGAGGGCCCCATCAGAGG + Intronic
1137744888 16:50813196-50813218 CAGGGACAGTGCCCACTCAGGGG + Intergenic
1139919773 16:70452157-70452179 GAGCCACCGTGCCCAGTCAGTGG - Intergenic
1143762002 17:9111500-9111522 GAGGCACAGTTCCCCCAGAGAGG + Intronic
1144999228 17:19291821-19291843 CAGGCACAGTGGGCCCTCAGAGG + Intronic
1148819680 17:50353424-50353446 GAGGCCCAGTGCGCCCTCAGTGG + Intronic
1150880033 17:69014096-69014118 GAAACACAGTGACACCTCAGTGG + Intronic
1152260145 17:79262378-79262400 GAGGGACCGTGTCCCCTCAGTGG - Intronic
1158545412 18:58392097-58392119 GCGTCACTGTGCCTCCTGAGAGG - Intronic
1160502155 18:79407014-79407036 GCGTCACGGTGGCCCCTCCGTGG - Intronic
1160895914 19:1401685-1401707 GAGCCTCGGTGCCCCCTCTGCGG + Intergenic
1162395653 19:10416951-10416973 GAGTCGCAGTGCCCTGTCCGTGG + Intronic
1162824914 19:13245345-13245367 GAGGCACAGTTGCCCATCAGCGG + Intronic
1165069920 19:33249207-33249229 GAGGCTCAGTTCCCCGTCAGTGG - Intergenic
1166997423 19:46726358-46726380 GAGCCACTGTGCCCCGTCTGTGG - Intronic
1168514794 19:57002340-57002362 CGGTCACAGTGCCCTCTGAGTGG - Intergenic
925041572 2:735281-735303 GAGTCCCAGTTCCCTCTCAAAGG - Intergenic
925064660 2:920853-920875 GACTCCCAGTGCCACCCCAGAGG - Intergenic
925856920 2:8138022-8138044 GAGGCACATTGCACACTCAGCGG - Intergenic
927081081 2:19631161-19631183 GAGTCACAGTGCCCATGCAGAGG + Intergenic
927946042 2:27135792-27135814 GAGCCAAACTGCCCCCTCTGAGG - Intergenic
928391570 2:30914740-30914762 GAGACACAGTCCACCCTCGGAGG + Intronic
928692208 2:33811765-33811787 GAGCCACTGTGCCCAGTCAGAGG - Intergenic
932417717 2:71583880-71583902 GAGCCACAGGGCTCCCCCAGGGG - Intronic
933560106 2:83877442-83877464 GAGACACAGTGGCCGCTCCGAGG + Intergenic
936578187 2:113672576-113672598 CAGTCTCAGTGCCCCGTCACTGG - Intergenic
937275752 2:120682903-120682925 CAGTCACAGAACACCCTCAGGGG - Intergenic
948231608 2:236352953-236352975 CTGTCACACTGCCCCCCCAGGGG + Intronic
1170169317 20:13393465-13393487 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1173003582 20:39123103-39123125 GAGGCAAAGGGACCCCTCAGGGG + Intergenic
1178906892 21:36643962-36643984 GAGGCACAGCCGCCCCTCAGGGG + Intergenic
1179433671 21:41344865-41344887 GAGTCCCAGTGTCTGCTCAGGGG + Intronic
1180474028 22:15687380-15687402 GTGTCCCAGGGCACCCTCAGTGG - Intergenic
1183363900 22:37397197-37397219 GGGACACAGTGACCCTTCAGTGG - Intronic
950746601 3:15095306-15095328 GAGCCACTGTGCCCGCCCAGAGG + Intronic
950788465 3:15454286-15454308 GAGTCACCATGCACCCTCACTGG - Intronic
951566719 3:24019150-24019172 GAATCACAGAGCCCCCAAAGAGG + Intergenic
952978609 3:38717416-38717438 GAGTGACTGTGCCCCCAAAGGGG + Intronic
954452304 3:50578341-50578363 GAGCCTCAGTGCCCCCTCCATGG + Intronic
957082615 3:75649447-75649469 GTGTCACAATACCCCCTGAGGGG - Intergenic
958802787 3:98775978-98776000 GTGTCACTGTGCTCCCTCTGTGG - Intronic
965656371 3:170989393-170989415 GTGCCACAGAGCCCACTCAGGGG - Intergenic
969048117 4:4353097-4353119 TAGTCACTGTGCCCTTTCAGTGG - Intronic
969340257 4:6535861-6535883 GAGCCACAGTGGGACCTCAGTGG - Intronic
969586964 4:8099559-8099581 GAGCCACCGTGCCCAGTCAGAGG - Intronic
970848079 4:20566974-20566996 GTGTCACAGAGTCCCCTCATGGG - Intronic
976728604 4:88240602-88240624 TAGTCTCAGTGCTCCCTCAATGG + Intergenic
978485748 4:109251912-109251934 CAGTTACAGTGCCACTTCAGTGG - Intronic
980550572 4:134328797-134328819 GAGTGCCAGTGGCCCCTCAGAGG + Intergenic
984587538 4:181580627-181580649 GAGTCCCAGACCCCCCTGAGAGG + Intergenic
986250828 5:6057161-6057183 GAGCCACTGTGCCCCATCATAGG - Intergenic
992214662 5:74514363-74514385 GAGCCAAAGTGCCCAATCAGGGG + Intergenic
995605078 5:113845490-113845512 GAGCTACAGTGCTTCCTCAGAGG + Intergenic
996552354 5:124744218-124744240 CACTCCCAGTGCCCCCGCAGTGG + Exonic
997398296 5:133581959-133581981 GAGTAACAGGGCACCCTCATTGG - Intronic
997512160 5:134461173-134461195 GAGGCACTGTGCCCCCTCTGGGG - Intergenic
997632277 5:135377948-135377970 GAGCTATAGTGCCCTCTCAGGGG - Intronic
998588636 5:143454263-143454285 GCCACACAGTGTCCCCTCAGAGG + Intergenic
1003408127 6:5839819-5839841 GAGCCACAGTGCAGCCTCTGTGG - Intergenic
1005887502 6:30107968-30107990 GAGTCACAGTTCCATTTCAGTGG + Intronic
1010251851 6:73715276-73715298 GAGTCACCGTGCCTCATCACTGG - Intronic
1014639239 6:123889231-123889253 AAGTCACAATGCCCCCTAGGAGG - Intronic
1017876608 6:158529990-158530012 AACACACAGTGCCCCTTCAGTGG + Intergenic
1018282675 6:162204782-162204804 GAGTCACCGTGGCCATTCAGAGG + Intronic
1018340459 6:162846160-162846182 GAGCCACAGTGGCCTGTCAGAGG + Intronic
1018986691 6:168643222-168643244 GTGTGACAGTGCTCCCTCTGTGG - Intronic
1019716688 7:2542481-2542503 GAGGGGCAGTGCCCGCTCAGGGG + Intronic
1020105879 7:5422107-5422129 GACTCACAGTGCCCCCCGGGGGG - Intronic
1020421556 7:8012097-8012119 GAGTCACCGTGCCCAGCCAGGGG + Intronic
1021245745 7:18259251-18259273 GAGTCACAGTGCCCAGCCAAGGG + Intronic
1022668502 7:32432865-32432887 GACTTACAGTGCCCTCTCATAGG - Intergenic
1023995784 7:45158097-45158119 GAGGCACAGGGCCCCCTCCGGGG + Intronic
1029669320 7:102018243-102018265 GAGCCACTGTGCCCAGTCAGAGG + Intronic
1033304654 7:140215511-140215533 GAGACACACAGCCCCCTCACAGG - Intergenic
1034540911 7:151757444-151757466 GAGACACAGTGCCCGCTCCAGGG + Intronic
1035650284 8:1258850-1258872 GAGTCGCAGTGCACGCTCTGCGG + Intergenic
1038657487 8:29467206-29467228 GAGCCACTGTGCCCTGTCAGAGG + Intergenic
1039224498 8:35373034-35373056 GAATCTCAGTTCCCCCTCCGTGG + Intronic
1039436379 8:37562178-37562200 GGGAGACAGTGCCCACTCAGGGG + Intergenic
1039442884 8:37607762-37607784 AATTCACTGTGGCCCCTCAGGGG + Intergenic
1042594808 8:70435470-70435492 GAGTCACACTGCCCCAACTGAGG + Intergenic
1043789928 8:84452083-84452105 GAGTCACACTGCCCTATCTGTGG - Intronic
1047875435 8:129132171-129132193 GACTCACAGTTCCCCATCACTGG + Intergenic
1048847048 8:138611748-138611770 GAGTCACAGTCTCCCCTGATGGG - Intronic
1050626551 9:7510269-7510291 GAGTCAAAGTGACTTCTCAGAGG + Intergenic
1051141986 9:13987913-13987935 GAGTGCCAGTGGCCCCTCACAGG + Intergenic
1053489870 9:38490398-38490420 GAGTTACAGTGGCCCCTTGGAGG + Intergenic
1055031390 9:71774017-71774039 GAGTGATACTGCCCCCTGAGTGG + Intronic
1055830730 9:80375608-80375630 GAATCACAGTGCTCCTACAGGGG + Intergenic
1056899751 9:90586843-90586865 GAGTCACAGTGTCTCCAAAGGGG - Intergenic
1057670198 9:97079707-97079729 GAGTTACAGTGGCCCCTTGGAGG + Intergenic
1058274939 9:103028107-103028129 GAGTCACAGTGTCACTTCTGGGG - Intergenic
1059747543 9:117217654-117217676 GAGTCATAATGCCACCTCATTGG + Intronic
1060055777 9:120411799-120411821 GAGTGACAGAGCTGCCTCAGTGG - Intronic
1060208228 9:121694956-121694978 GAGGCAGAGTGCCCCATCTGGGG + Intronic
1060858282 9:126933339-126933361 GGGTCACACTGGCCCCTCTGGGG - Intronic
1061147266 9:128807435-128807457 GAATCACAGTGGCCACTCACAGG + Intronic
1062284864 9:135768373-135768395 GAGTCACAGTGCCCCCTCAGTGG - Intronic
1188421023 X:29991278-29991300 GAGACCCAGTGCCCTATCAGTGG - Intergenic
1189577944 X:42375416-42375438 GAGGCAGAGTGCCCCATCTGGGG - Intergenic
1189851930 X:45186366-45186388 GAGGAACAGAGCCCCTTCAGAGG - Intronic
1190240505 X:48654496-48654518 GGGTGACATTGCCCCCTCAGTGG - Intergenic
1190240813 X:48656473-48656495 GGGTGACATTGCTCCCTCAGTGG - Intergenic
1194717378 X:97302585-97302607 CAGTTACACTGCCTCCTCAGAGG - Intronic
1200073676 X:153541000-153541022 GCCTTCCAGTGCCCCCTCAGCGG + Intronic
1202184050 Y:22165864-22165886 GAGCCACAGTGCCCACCCAGTGG - Intergenic
1202207309 Y:22420537-22420559 GAGCCACAGTGCCCACCCAGTGG + Intergenic