ID: 1062288428

View in Genome Browser
Species Human (GRCh38)
Location 9:135784065-135784087
Sequence CGCGGCCGGCGGCGAACGGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 183}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062288428_1062288437 25 Left 1062288428 9:135784065-135784087 CCTGCCGTTCGCCGCCGGCCGCG 0: 1
1: 0
2: 0
3: 19
4: 183
Right 1062288437 9:135784113-135784135 ACTGCTCTACCAGGTCAGCGGGG 0: 1
1: 0
2: 0
3: 15
4: 86
1062288428_1062288436 24 Left 1062288428 9:135784065-135784087 CCTGCCGTTCGCCGCCGGCCGCG 0: 1
1: 0
2: 0
3: 19
4: 183
Right 1062288436 9:135784112-135784134 CACTGCTCTACCAGGTCAGCGGG 0: 1
1: 0
2: 0
3: 10
4: 124
1062288428_1062288434 16 Left 1062288428 9:135784065-135784087 CCTGCCGTTCGCCGCCGGCCGCG 0: 1
1: 0
2: 0
3: 19
4: 183
Right 1062288434 9:135784104-135784126 GTTGGACACACTGCTCTACCAGG 0: 1
1: 0
2: 0
3: 7
4: 111
1062288428_1062288435 23 Left 1062288428 9:135784065-135784087 CCTGCCGTTCGCCGCCGGCCGCG 0: 1
1: 0
2: 0
3: 19
4: 183
Right 1062288435 9:135784111-135784133 ACACTGCTCTACCAGGTCAGCGG 0: 1
1: 0
2: 0
3: 14
4: 123
1062288428_1062288433 -2 Left 1062288428 9:135784065-135784087 CCTGCCGTTCGCCGCCGGCCGCG 0: 1
1: 0
2: 0
3: 19
4: 183
Right 1062288433 9:135784086-135784108 CGTCTTCAGCATCAGCATGTTGG 0: 1
1: 1
2: 2
3: 5
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062288428 Original CRISPR CGCGGCCGGCGGCGAACGGC AGG (reversed) Exonic
900180124 1:1307648-1307670 CGCGGCCGCCGGGGAGGGGCTGG - Intronic
901303666 1:8217328-8217350 AGCGGCCGCCCGCGCACGGCTGG + Intergenic
902783202 1:18717305-18717327 CGGGGCAGGCGGCGAAGGGACGG + Intronic
904128630 1:28259892-28259914 CGCCGCCCGGGGCGAACCGCAGG - Exonic
905647259 1:39633203-39633225 TGCGGCCGGGGGCGAAGGGGAGG + Intronic
905670703 1:39788584-39788606 CTCGGCGGGCGGCGGGCGGCGGG + Exonic
906130753 1:43453835-43453857 GGCGGCGGGCGGCGGGCGGCGGG + Exonic
906130756 1:43453842-43453864 GGCGGCGGGCGGCGGGCGGCGGG + Exonic
906168956 1:43707760-43707782 CGCGGCCGGCGGGGGAGGGGCGG - Intronic
906436798 1:45803529-45803551 CGCGGGAGGCGGCGCGCGGCCGG + Intronic
909548028 1:76868639-76868661 CGCCGCCGGCTGCGAGCTGCCGG - Exonic
912305166 1:108560005-108560027 CGCGGCCTGCAGCGCACGGCGGG - Intergenic
922648575 1:227317957-227317979 CGCGGCCGGGGGTGGAAGGCGGG + Exonic
923744339 1:236686574-236686596 GGCGGCGGGCGGCGGGCGGCGGG - Exonic
1063504105 10:6580448-6580470 CGGGACCGGGGGCGCACGGCGGG - Intergenic
1069546738 10:69334524-69334546 CGCTGCCGGGGGAGAAGGGCTGG + Intronic
1072189129 10:93066339-93066361 CGCGGCAGGCGGCAGGCGGCAGG - Intronic
1072253613 10:93600831-93600853 GGCGTCCGGGGGCGCACGGCGGG + Intronic
1072670481 10:97425909-97425931 GGCGGCGGGCGGCGGGCGGCGGG - Intronic
1074399082 10:113126887-113126909 CGCGGCCGGCGGCGGGCGGGCGG + Intronic
1076371483 10:129958908-129958930 AGCGGCGGGCGGCGGGCGGCGGG - Intronic
1077021814 11:420318-420340 CGAGGCCGTCGGAGAAGGGCTGG + Intronic
1077334286 11:1996608-1996630 CGCAGCGGGCGGCGAGCGGGAGG - Intergenic
1077914709 11:6603750-6603772 CGGGGCCGGCGGCGGGCTGCGGG + Intronic
1078934849 11:15941465-15941487 TGCGGCCGGGGGCGGACGGTGGG + Intergenic
1080389076 11:31827223-31827245 AGCGGGCGGCCGCGAACGCCGGG - Intronic
1083445597 11:62706316-62706338 AGCGGCCGGCGGAGAGGGGCGGG - Intronic
1083822544 11:65181429-65181451 CGGGGCTGGCTGGGAACGGCGGG + Exonic
1084010869 11:66347683-66347705 GGCGGCGGGCGGCGGGCGGCGGG - Exonic
1084010872 11:66347690-66347712 GGCGGCGGGCGGCGGGCGGCGGG - Exonic
1089046138 11:115503638-115503660 GGCGGAGGGCTGCGAACGGCCGG + Intronic
1090636692 11:128694297-128694319 CGCGGGCGGCGGGGACCGGCCGG + Intronic
1202817269 11_KI270721v1_random:51790-51812 CGCAGCGGGCGGCGAGCGGGAGG - Intergenic
1095206158 12:39442888-39442910 GGCGGCGGGCGGCGGGCGGCGGG - Intronic
1096784410 12:54009042-54009064 GGCGGCGGGCGGCGAGCGGGCGG - Intronic
1100540061 12:95548936-95548958 CGCGGAAGGCGGCCACCGGCAGG - Intronic
1102854090 12:116277922-116277944 CCCGGCGGGCGGCGGACTGCCGG + Intergenic
1103698546 12:122835651-122835673 GGCGGCGGGCGGCGGGCGGCGGG + Intronic
1105801078 13:23903710-23903732 CGCGGGAGGCGGGGAAGGGCCGG - Intergenic
1110630065 13:77697739-77697761 CGCGGCCGGAGGCGAGGGCCCGG + Intergenic
1115028324 14:28767202-28767224 GGCGGGCGGCGGCGACCGGTGGG - Exonic
1116658198 14:47675890-47675912 CCCGGCCGGCGTCGAACCCCAGG - Intergenic
1118932382 14:70254948-70254970 GGCGGCGGGCGGCGGGCGGCGGG - Intergenic
1118932385 14:70254955-70254977 GGCGGCGGGCGGCGGGCGGCGGG - Intergenic
1118932388 14:70254962-70254984 GGCGGCGGGCGGCGGGCGGCGGG - Intergenic
1118932391 14:70254969-70254991 GGCGGCGGGCGGCGGGCGGCGGG - Intergenic
1118932394 14:70254976-70254998 GGCGGCGGGCGGCGGGCGGCGGG - Intergenic
1118932397 14:70254983-70255005 GGCGGCGGGCGGCGGGCGGCGGG - Intergenic
1118932400 14:70254990-70255012 GGCGGCGGGCGGCGGGCGGCGGG - Intergenic
1118932403 14:70254997-70255019 GGCGGCGGGCGGCGGGCGGCGGG - Intergenic
1122543371 14:102509713-102509735 CGTCGCCGGCGGCGGGCGGCGGG + Exonic
1122543375 14:102509720-102509742 GGCGGCGGGCGGCGGGCGGCGGG + Exonic
1122543378 14:102509727-102509749 GGCGGCGGGCGGCGGGCGGCGGG + Exonic
1122779689 14:104138485-104138507 CGGGGCGGGCGGCGAGGGGCGGG - Intergenic
1123964128 15:25438674-25438696 GGCGGCTGGCGACGAACGCCGGG - Exonic
1129644815 15:77420153-77420175 CTGGGCGGGCGGCGAGCGGCCGG - Intergenic
1132252012 15:100341463-100341485 CGCGGCTGGCGGCCAGCGGGAGG - Intronic
1132828902 16:1918159-1918181 GGCGGCCGGCGGGCAGCGGCCGG + Exonic
1132893232 16:2214783-2214805 GGCGGGCGGCGGCGGCCGGCGGG - Exonic
1140462208 16:75148808-75148830 CGGGGCCGGCGGGGCACGCCTGG + Intronic
1140478787 16:75251623-75251645 GGCGGCAGGCGGAGAGCGGCTGG - Intronic
1141054593 16:80803950-80803972 CGCGGGAGGCGGCGGGCGGCGGG + Intronic
1141054596 16:80803957-80803979 GGCGGCGGGCGGCGGGCGGCGGG + Intronic
1141682642 16:85553445-85553467 CGCGGGCGGCCCCGAGCGGCCGG + Intergenic
1141830121 16:86505732-86505754 CGGGGGCGGCGGCGGCCGGCGGG + Intergenic
1142136352 16:88453572-88453594 GGCGGGCGGCGGCGGGCGGCGGG - Exonic
1143845782 17:9771837-9771859 CGCGGACCGCGGCGACCAGCGGG + Intronic
1145979964 17:29005600-29005622 CTCGGCCGGGCGCGAATGGCGGG + Intronic
1146057791 17:29589699-29589721 CGCGGCCGGCAGCGCGCGGCGGG - Intronic
1146079147 17:29761444-29761466 CGCGGGTGGGGGCGAACTGCTGG - Intronic
1147440268 17:40443463-40443485 GGCGGCGGGCGGCGAGGGGCAGG - Exonic
1152475514 17:80515493-80515515 CTCGGCAGGCGGCAAACGCCGGG - Intergenic
1152596364 17:81239563-81239585 CGCAGGCCGCGGCGTACGGCAGG + Exonic
1152697425 17:81804092-81804114 CGAGGGCGGCGGCGGAGGGCGGG - Intergenic
1152744184 17:82031594-82031616 CGCGGCCGGCGGGGGGCGGGGGG - Intergenic
1153794475 18:8609682-8609704 GGCGGGCGGCGGCGGGCGGCGGG + Exonic
1154304047 18:13217977-13217999 CGCGGCAGGGGGCGCGCGGCGGG - Intronic
1157095096 18:44680195-44680217 CGGAGGCGGCGGCGAGCGGCGGG - Intronic
1160452963 18:78978530-78978552 CGCGGCTCGCGGCGCTCGGCGGG - Intergenic
1160685927 19:436576-436598 CGCGGCCGGAGGGGGGCGGCAGG + Intronic
1160763352 19:796704-796726 CGCGGCCGGCTGCCTACAGCTGG - Intergenic
1160763755 19:798103-798125 CGCGGCCCGGGGCGCACGGGGGG - Intronic
1161266385 19:3366608-3366630 CGCGGCGGGAGGCGCAGGGCCGG - Exonic
1161672784 19:5623468-5623490 CGCGGCCGGGGGCGGACGCCAGG - Intronic
1161851396 19:6739696-6739718 GGCGGCGGGCGGCGGGCGGCGGG + Exonic
1162954258 19:14089809-14089831 GGCGGCCGGCGGCGCCCGTCCGG + Exonic
1163666627 19:18606665-18606687 CGCTGCCGGGGGCGCGCGGCGGG + Exonic
1165040237 19:33063809-33063831 GGCGGCGGGCGGCGGGCGGCGGG - Intronic
1165040240 19:33063816-33063838 GGCGGCGGGCGGCGGGCGGCGGG - Intronic
1165928699 19:39342688-39342710 CGCGGGCGGCGGCGGCGGGCGGG + Intronic
1168705350 19:58467422-58467444 CGCTGCTGGCGGGGAAAGGCTGG + Exonic
1168721788 19:58558435-58558457 CGCGGGCGGCGGCGGGGGGCCGG - Exonic
925406253 2:3607013-3607035 CGTGTCCGGGGCCGAACGGCGGG - Intronic
928511997 2:32010736-32010758 CGGGGCCGGCGGCGGGCGGCCGG - Intronic
929078224 2:38096067-38096089 CGGGGGCGGCGGGGAAGGGCGGG - Intronic
931253503 2:60552413-60552435 CGCCGCCGCCGCCGAAGGGCAGG - Intronic
931517809 2:63059867-63059889 CGGGGGCGGCGGGGGACGGCGGG + Intergenic
932496701 2:72149087-72149109 GGCGGCGGGCGGCGGGCGGCCGG - Intergenic
933278220 2:80304614-80304636 GGCGGCGGGCGGCGGGCGGCGGG + Exonic
935820168 2:106886469-106886491 CGCGGGCGGCGGGGCACAGCGGG + Exonic
936512160 2:113157335-113157357 GGCGGGCGGCGGCGCAGGGCGGG - Intronic
936537721 2:113324925-113324947 CGCGGGAGGCTGCGAGCGGCGGG - Intergenic
937997019 2:127701752-127701774 AGCGGCTGGCGGCGGGCGGCGGG + Exonic
938018552 2:127886727-127886749 CCCGGCCAGGGGCGAGCGGCTGG - Intergenic
942565960 2:177264797-177264819 CGCGGCCGGCGGGGGAAGGAAGG - Exonic
945225846 2:207530390-207530412 GGCGGCGGGCGGCGGGCGGCGGG + Intronic
946340192 2:219061276-219061298 CGCGGCCGGACGCGAGGGGCGGG + Intergenic
947860625 2:233354859-233354881 CGCGGCCCCCGACGGACGGCGGG + Intronic
948115877 2:235494141-235494163 GTCGGCGGGCGGCGCACGGCGGG + Exonic
948207144 2:236168303-236168325 CGCGGGAGGCGACGGACGGCGGG - Exonic
1170578595 20:17681887-17681909 GGCGGCAGGCGGCGGGCGGCGGG + Intronic
1171217396 20:23362265-23362287 GGCGGCGGGCGGCGAGGGGCCGG - Intronic
1172409329 20:34710072-34710094 CGCGGCCCGCGGCTCGCGGCGGG - Exonic
1176178686 20:63739924-63739946 CCCGGCCGGCGGCGCGGGGCGGG - Exonic
1178981466 21:37268096-37268118 CGCGGCCCGCGGAGCCCGGCTGG - Intergenic
1181457960 22:23070354-23070376 GGCGGCGGGCGGCGGGCGGCGGG + Exonic
1183744728 22:39685914-39685936 CTCAGGCGGCGGCGAGCGGCGGG - Exonic
1184164787 22:42720810-42720832 GGCGGCGGGCGGCGGACAGCGGG + Intronic
1184796954 22:46738233-46738255 GGCGGCGGGCGGCGGGCGGCGGG + Exonic
949105811 3:198178-198200 GGAGGCCGGCGGCGGAGGGCAGG + Intronic
950618107 3:14178532-14178554 CGCGGCCGGCGGGGAGCCGCGGG - Exonic
951881286 3:27483823-27483845 GGCGGCCGGCGGCGCGCCGCGGG - Intronic
952287242 3:31981036-31981058 CCCGGCCGCCGCCGACCGGCTGG + Exonic
952816667 3:37452698-37452720 CTCGGCCGCCGGGGGACGGCGGG + Intronic
953618223 3:44510727-44510749 GGCGGCGGGCGGCGGGCGGCGGG + Intergenic
953618226 3:44510734-44510756 GGCGGCGGGCGGCGGGCGGCGGG + Intergenic
953618229 3:44510741-44510763 GGCGGCGGGCGGCGGGCGGCGGG + Intergenic
953618232 3:44510748-44510770 GGCGGCGGGCGGCGGGCGGCGGG + Intergenic
953618235 3:44510755-44510777 GGCGGCGGGCGGCGGGCGGCGGG + Intergenic
954717475 3:52533780-52533802 GGCGGCGGGCGGCGGGCGGCGGG - Intronic
956675095 3:71725487-71725509 GGCGGCGGGCGGCGGGCGGCGGG - Intronic
956675098 3:71725494-71725516 GGCGGCGGGCGGCGGGCGGCGGG - Intronic
966696434 3:182793991-182794013 CGAGGCTGGCGCCGAGCGGCCGG + Intronic
966808797 3:183825718-183825740 CGGGGCCGGCTGCGCACGGCTGG + Intergenic
968225220 3:196968839-196968861 CGCCGCCGCCGGCGCAGGGCGGG + Intronic
968515137 4:1012542-1012564 CTCGGGCGGCGGCGGCCGGCGGG - Exonic
968631694 4:1655283-1655305 CGCCGCTGGCGGAGGACGGCCGG + Exonic
968775393 4:2536855-2536877 CGCGGGCGGCGGCGGAGGGCGGG - Intronic
972321653 4:37977637-37977659 CGCGGCGGGGGGCGAGCGGCGGG + Intronic
975701911 4:77075410-77075432 CGCGGCCGGCGTCGACGCGCTGG - Intronic
977694330 4:99949894-99949916 CGCGGCGGGGGGCGAACGGGCGG - Intronic
984801818 4:183723023-183723045 CGCGGCCGGCGGGGGCCGCCAGG + Intergenic
985064064 4:186104745-186104767 GGCGGCGGGCGGCGGGCGGCGGG + Intronic
985781855 5:1875743-1875765 CGCGGCCGGGAGCGTAAGGCCGG + Intergenic
985783533 5:1882654-1882676 CGCGGCCCGGGGCGGACGGGCGG + Exonic
985895484 5:2748312-2748334 CGCGGCCGGCGGCGCCCGGGAGG - Intronic
990210890 5:53480646-53480668 GGCGGCCGGCGGCGAGCGCGGGG + Exonic
997635108 5:135399001-135399023 CGCGGCCGGACCCGAGCGGCGGG + Intronic
999696294 5:154190830-154190852 CGGGGCCGGCGGGGCGCGGCGGG + Exonic
1001064991 5:168529366-168529388 GGCGGCGGGCGGCGGGCGGCGGG - Exonic
1002455898 5:179345215-179345237 CGCCGCCGCCCGCGAACGCCAGG - Exonic
1002541198 5:179907629-179907651 CGGGGCTGGCGGCGGGCGGCGGG - Intronic
1007390218 6:41546448-41546470 TGCGGCCGGCGGCCGGCGGCCGG + Exonic
1007800441 6:44387883-44387905 AGCGGCGGGCAGCGGACGGCGGG - Intronic
1010001888 6:70956705-70956727 CGGGACCGGCGGCGCGCGGCTGG - Exonic
1013175015 6:107669339-107669361 TGCGGCCAGCAGCGCACGGCAGG - Intergenic
1013366301 6:109440758-109440780 CGCGGGCGGCCGCGACCGCCGGG + Exonic
1013369169 6:109455283-109455305 CGCGGCGGGCTGGGAACGGAGGG - Intronic
1015910123 6:138161683-138161705 CGCGGCGGGCGGCGGGAGGCAGG - Intergenic
1017671978 6:156777737-156777759 GGCAGGCAGCGGCGAACGGCGGG + Intergenic
1019330445 7:458242-458264 CATGGCCGGCGGTGAACGGCAGG + Intergenic
1019412392 7:911976-911998 CGCTGCCTGCGAGGAACGGCTGG + Intronic
1019434932 7:1017709-1017731 CGCGGGCAGCCGCGGACGGCGGG + Intronic
1019765129 7:2844257-2844279 CGCGGCCTGAGGCGAGCGGCGGG - Exonic
1020083058 7:5296736-5296758 CGGGGCCGGCGGTGATGGGCGGG + Intronic
1020261078 7:6531122-6531144 CGCGGCAGGTGCCGAAGGGCAGG + Intronic
1023955754 7:44885456-44885478 GGCGGCCGGCGATGAGCGGCGGG - Intergenic
1024639398 7:51316967-51316989 CCCGGCCCGCGGCGAGCGTCCGG + Intergenic
1025069766 7:55887805-55887827 GGCGGCGGGCGGCGGGCGGCGGG + Intronic
1025069769 7:55887812-55887834 GGCGGCGGGCGGCGGGCGGCGGG + Intronic
1025069772 7:55887819-55887841 GGCGGCGGGCGGCGGGCGGCGGG + Intronic
1026837373 7:73647807-73647829 CGCGGCCAGGGGCGGGCGGCGGG + Intergenic
1026968290 7:74453925-74453947 CGCGGGCTGCGGCGGAGGGCGGG - Intronic
1032068736 7:128791335-128791357 TCCGGGCGGCGGCGAGCGGCGGG + Intronic
1032306200 7:130734062-130734084 CGCGGCCGGCCGCGTTCGGACGG - Intergenic
1032525657 7:132576980-132577002 CGCGGCCGGCCGCGGGCTGCCGG - Exonic
1032525798 7:132577433-132577455 GGCGGCGGGCGGCGGGCGGCAGG - Intronic
1033300084 7:140177312-140177334 CGCAGCCGGAGGAGGACGGCGGG + Intergenic
1034188346 7:149195886-149195908 CGAGGCGGGCGGGGCACGGCCGG + Intronic
1035580655 8:737671-737693 CGCCTGCGGCGGCGAACGGACGG + Intronic
1035725737 8:1824002-1824024 GGGGGACGGCGGGGAACGGCGGG + Exonic
1037273703 8:17156414-17156436 GCCGGGCGGCGGGGAACGGCGGG + Exonic
1038327018 8:26579100-26579122 CGGGGACCGCGGCGAGCGGCCGG + Intronic
1041167262 8:55102326-55102348 GGCGGGCGGCGGCGGACGGCAGG + Intergenic
1042020861 8:64370473-64370495 GGCGGCGGGCGGCGAACTGAGGG + Intergenic
1042617722 8:70668954-70668976 CGGGGCCGGCTGCGAACGTTGGG + Intronic
1048472056 8:134712718-134712740 CGCGGCCGGCGGCCGGCGGCCGG + Intronic
1048472059 8:134712725-134712747 GGCGGCCGGCGGCCGGCGGCCGG + Intronic
1049442136 8:142614402-142614424 CGGGGCCGGCGGAGCACGCCCGG + Exonic
1056331066 9:85521810-85521832 CGAGGCAGGTGGGGAACGGCTGG + Intergenic
1057313011 9:93953315-93953337 CGCCACCGGCGCCGACCGGCAGG - Intronic
1058439209 9:104991743-104991765 CGCGGCGGGCGGCGGGCAGCGGG + Intergenic
1060477939 9:123999662-123999684 CGGGGGCGGCGGCGAGCGCCGGG - Intergenic
1061208374 9:129177152-129177174 TGCAGCCGGCGGCGGACGCCAGG + Exonic
1062105762 9:134753940-134753962 CGCTGCCGCCGGAGAACGGGAGG - Intronic
1062277177 9:135736593-135736615 CGCGGCGGGCGGCGGGCGGCGGG - Intronic
1062288428 9:135784065-135784087 CGCGGCCGGCGGCGAACGGCAGG - Exonic
1062565119 9:137160911-137160933 AGTGGCCGGCGGCGCAGGGCGGG + Intronic
1185466389 X:357230-357252 CGCGGCAGGTGACAAACGGCCGG + Intronic
1188811393 X:34657252-34657274 CGGGGCCGGCGGCGAAGGTCCGG - Exonic
1189002001 X:36957682-36957704 CGGGGCCGGCGGCGAAGGTCAGG + Intergenic
1195625257 X:107000052-107000074 CGCAGCTGGCGGCGACCGTCCGG + Exonic
1197734978 X:129843715-129843737 CTCGGCCGGCAGCTGACGGCAGG + Exonic