ID: 1062288788

View in Genome Browser
Species Human (GRCh38)
Location 9:135785513-135785535
Sequence ACTCCCTCCTGCACTGGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 254}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062288780_1062288788 26 Left 1062288780 9:135785464-135785486 CCACGGATGTGTCGGCCCCAGCA 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1062288788 9:135785513-135785535 ACTCCCTCCTGCACTGGTGGTGG 0: 1
1: 0
2: 3
3: 26
4: 254
1062288783_1062288788 11 Left 1062288783 9:135785479-135785501 CCCCAGCACGGCTCAGAGAAGGC 0: 1
1: 0
2: 0
3: 27
4: 177
Right 1062288788 9:135785513-135785535 ACTCCCTCCTGCACTGGTGGTGG 0: 1
1: 0
2: 3
3: 26
4: 254
1062288779_1062288788 27 Left 1062288779 9:135785463-135785485 CCCACGGATGTGTCGGCCCCAGC 0: 1
1: 0
2: 1
3: 1
4: 45
Right 1062288788 9:135785513-135785535 ACTCCCTCCTGCACTGGTGGTGG 0: 1
1: 0
2: 3
3: 26
4: 254
1062288784_1062288788 10 Left 1062288784 9:135785480-135785502 CCCAGCACGGCTCAGAGAAGGCT 0: 1
1: 0
2: 1
3: 12
4: 163
Right 1062288788 9:135785513-135785535 ACTCCCTCCTGCACTGGTGGTGG 0: 1
1: 0
2: 3
3: 26
4: 254
1062288785_1062288788 9 Left 1062288785 9:135785481-135785503 CCAGCACGGCTCAGAGAAGGCTG 0: 1
1: 0
2: 0
3: 22
4: 199
Right 1062288788 9:135785513-135785535 ACTCCCTCCTGCACTGGTGGTGG 0: 1
1: 0
2: 3
3: 26
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062288788 Original CRISPR ACTCCCTCCTGCACTGGTGG TGG Intronic