ID: 1062288788

View in Genome Browser
Species Human (GRCh38)
Location 9:135785513-135785535
Sequence ACTCCCTCCTGCACTGGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 254}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062288780_1062288788 26 Left 1062288780 9:135785464-135785486 CCACGGATGTGTCGGCCCCAGCA 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1062288788 9:135785513-135785535 ACTCCCTCCTGCACTGGTGGTGG 0: 1
1: 0
2: 3
3: 26
4: 254
1062288779_1062288788 27 Left 1062288779 9:135785463-135785485 CCCACGGATGTGTCGGCCCCAGC 0: 1
1: 0
2: 1
3: 1
4: 45
Right 1062288788 9:135785513-135785535 ACTCCCTCCTGCACTGGTGGTGG 0: 1
1: 0
2: 3
3: 26
4: 254
1062288784_1062288788 10 Left 1062288784 9:135785480-135785502 CCCAGCACGGCTCAGAGAAGGCT 0: 1
1: 0
2: 1
3: 12
4: 163
Right 1062288788 9:135785513-135785535 ACTCCCTCCTGCACTGGTGGTGG 0: 1
1: 0
2: 3
3: 26
4: 254
1062288783_1062288788 11 Left 1062288783 9:135785479-135785501 CCCCAGCACGGCTCAGAGAAGGC 0: 1
1: 0
2: 0
3: 27
4: 177
Right 1062288788 9:135785513-135785535 ACTCCCTCCTGCACTGGTGGTGG 0: 1
1: 0
2: 3
3: 26
4: 254
1062288785_1062288788 9 Left 1062288785 9:135785481-135785503 CCAGCACGGCTCAGAGAAGGCTG 0: 1
1: 0
2: 0
3: 22
4: 199
Right 1062288788 9:135785513-135785535 ACTCCCTCCTGCACTGGTGGTGG 0: 1
1: 0
2: 3
3: 26
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062288788 Original CRISPR ACTCCCTCCTGCACTGGTGG TGG Intronic
900115573 1:1026504-1026526 CCACCCTCCTGCAGTGATGGGGG - Intronic
900736457 1:4302390-4302412 ACCTCCTCCTGCAGTGGTGATGG + Intergenic
901449352 1:9326529-9326551 TCTCCCTGGTGGACTGGTGGGGG + Intronic
902738135 1:18414725-18414747 AGTCCTGCCTTCACTGGTGGAGG - Intergenic
903744502 1:25577496-25577518 TCTGCCTCCTGCACTGGGCGTGG - Intergenic
904500404 1:30909475-30909497 TCGCCATCCTGCACTGGAGGGGG - Intergenic
905259362 1:36706607-36706629 ACTTCCTCCTGCGTGGGTGGTGG - Intergenic
905311997 1:37055770-37055792 ACTGCCTCCTGCACAGCAGGAGG + Intergenic
906368336 1:45230656-45230678 CCTCCCTCCTCCTCTGGTAGAGG - Intronic
908809839 1:67969304-67969326 ACTCTCTCATACACTGTTGGTGG - Intergenic
911002980 1:93186159-93186181 ACTCTCTCTTCCACTGCTGGTGG - Intronic
915967379 1:160322719-160322741 GAACCCTCCTGCACTGTTGGTGG + Intronic
919838696 1:201593964-201593986 CTTCCCACCTGCACTGATGGTGG - Intergenic
919922444 1:202174543-202174565 CATCCCTCCCCCACTGGTGGGGG - Intergenic
922479460 1:225928989-225929011 ACTCCCAGCTACTCTGGTGGCGG + Intergenic
922548145 1:226473876-226473898 ATTGACTCCTGCAATGGTGGAGG + Intergenic
923095928 1:230775118-230775140 TCTCCCTCCTGTCTTGGTGGGGG + Intronic
1062914240 10:1235244-1235266 ACTCCCACCTGTGCTGGTGACGG - Intronic
1062914409 10:1236003-1236025 ACTCCCACCTGTGCTGGTGACGG - Intronic
1064037993 10:11930866-11930888 ACACTCTCCTGCACAGATGGCGG + Intronic
1066535992 10:36392730-36392752 ACTCCCACCTGCTCAGGAGGTGG + Intergenic
1067000952 10:42613065-42613087 ACTTCCTCCTGCATTGAAGGGGG - Intronic
1067415344 10:46098000-46098022 TCTCCCTCCTGCACTGGTCAGGG + Intergenic
1068173111 10:53421929-53421951 ACTAGCACCTGCTCTGGTGGAGG + Intergenic
1069982172 10:72260471-72260493 ACTCCTTCCTGCACTAGCTGGGG + Intergenic
1070643795 10:78187444-78187466 TCTCCTTCCAGGACTGGTGGAGG + Intergenic
1070758478 10:79008422-79008444 ATTTCCTCCTGCACAGGAGGAGG - Intergenic
1071399986 10:85259534-85259556 ACTCCAATCTGCACTGGTGTTGG - Intergenic
1071517940 10:86311463-86311485 ACTCCCTCAGGCTTTGGTGGAGG - Intronic
1071717798 10:88114619-88114641 TTTCCTTCCTGCACTGGAGGAGG - Intergenic
1073373520 10:103012289-103012311 AATCTCTCCTACATTGGTGGTGG - Intronic
1074503294 10:114044710-114044732 CCATCCTCATGCACTGGTGGCGG + Exonic
1074713989 10:116201629-116201651 GCTTCCTCCTGCACTGGAAGAGG + Intronic
1076098452 10:127753633-127753655 ACCACCTCCAGCAATGGTGGAGG + Intergenic
1076533133 10:131158923-131158945 ACTGCCAGCTGAACTGGTGGCGG - Intronic
1076622052 10:131795882-131795904 CCTCCCTCATTCACTGCTGGTGG - Intergenic
1077497085 11:2891612-2891634 ACTCCCTCCTCCACTGCAGGAGG + Intronic
1077590945 11:3490605-3490627 GCTCCCTCCTGCACTTGTCGGGG - Intergenic
1079190531 11:18273262-18273284 GCTCCCTCCAGTGCTGGTGGGGG - Intergenic
1080773490 11:35364142-35364164 ACTCCCTGCTGTTCTGGAGGTGG + Intronic
1084246663 11:67862355-67862377 GCTCCCTCCTGCACTTGTCGGGG - Intergenic
1084660007 11:70541222-70541244 CCTTCCTCCTGCACCGGTGATGG + Intronic
1084727296 11:70949994-70950016 GCTCCCTGCTGCACAGGTGGTGG + Intronic
1084826016 11:71732136-71732158 GCTCCCTCCTGCACTTGTCGGGG + Intergenic
1084942138 11:72618507-72618529 ACTCTCTCCCTCACTGGAGGAGG - Intronic
1084954898 11:72685906-72685928 CCTCCCTCCAGCCTTGGTGGGGG - Intronic
1090617955 11:128533276-128533298 ACACTCTCCTGCAATGGCGGCGG - Intronic
1092154497 12:6273698-6273720 ACTCCCTGCTGGGCTGCTGGTGG - Intergenic
1092417231 12:8299602-8299624 ACTCCCTCCTGCACTTGTCGGGG - Intergenic
1092897784 12:13030035-13030057 ACTCCCTCCTTCACTAATAGAGG - Intergenic
1093541465 12:20291549-20291571 AAACCCTTGTGCACTGGTGGTGG - Intergenic
1094534023 12:31305211-31305233 ACTCCCTCCAGCCTTGGTGGAGG - Intronic
1097125788 12:56773887-56773909 ACTACCTTCTGCACTGGTACCGG + Exonic
1097134599 12:56841219-56841241 ACTACCTTCTGCGCTGGTAGTGG - Intergenic
1097148351 12:56957406-56957428 ACTACCTTCTGCACTGGTACCGG - Exonic
1097151978 12:56985904-56985926 ACTACCTTCTGCACTGGTACTGG - Intergenic
1097167754 12:57094652-57094674 ACCCCATCCCGCGCTGGTGGAGG + Exonic
1097804663 12:63952221-63952243 ACTGCATCCAGCCCTGGTGGGGG - Intronic
1097823728 12:64153686-64153708 ACACCCTTGTGCACTGTTGGTGG + Exonic
1098895164 12:76051616-76051638 AGTCCCAGCTGCTCTGGTGGCGG - Intronic
1101414605 12:104498314-104498336 TCTCCCTCCTGGGCTGGGGGTGG + Intronic
1102172296 12:110851612-110851634 ACACCTTCCTGCACTCCTGGGGG - Intronic
1102562026 12:113769195-113769217 TCTCCCCCCTGCACTGTTGATGG - Intergenic
1102662860 12:114544935-114544957 GCTCCCTGCTGCACTGGCCGGGG - Intergenic
1103450740 12:121026934-121026956 ACTCCCACCAGATCTGGTGGAGG + Intronic
1104420708 12:128632243-128632265 AATCCTTGCTGCACTGGTGAGGG - Intronic
1104937702 12:132375343-132375365 GCTCCCTCCCTCCCTGGTGGAGG + Intergenic
1104994030 12:132643021-132643043 ACTTCCTCCTGCGCAGGGGGAGG - Intronic
1105705447 13:22965205-22965227 CCGCCTTCCTGCACTGGTGAAGG + Intergenic
1106186246 13:27412503-27412525 ACTCCCTCCAGCACCTCTGGAGG + Intergenic
1107253229 13:38391652-38391674 ACTAGCACCTGCTCTGGTGGAGG + Intergenic
1107390453 13:39957654-39957676 ACTCCATCCCACACTGGAGGGGG - Intergenic
1113295063 13:108950572-108950594 ACTGCCCCCTGCATTGCTGGTGG + Intronic
1113546423 13:111154187-111154209 ACTCCACCCTGCCCTGGGGGTGG - Intronic
1113902656 13:113805305-113805327 GCTCCCCGCTGCAGTGGTGGAGG + Intronic
1117653282 14:57928330-57928352 TCTCCCTACTGCAGTGGTGTTGG + Intronic
1117776164 14:59187327-59187349 ACTCCCTACTGAAGTGTTGGTGG - Intergenic
1118805444 14:69232506-69232528 ACACCCTCATACACTGCTGGTGG - Intronic
1118822548 14:69354648-69354670 ACTCCTGACTGCTCTGGTGGGGG + Exonic
1118956443 14:70487226-70487248 ACTCTCTCCTTCATTGCTGGTGG + Intergenic
1120422243 14:84302891-84302913 TAGCCCTCCTGCACTGGTGCTGG + Intergenic
1121175665 14:91889133-91889155 CCTCCCACGGGCACTGGTGGGGG - Intronic
1121227109 14:92329038-92329060 CCTCCCTTCTGCACAGTTGGTGG + Intronic
1121378986 14:93444057-93444079 ACTCTCTCCTACATTGCTGGTGG - Intronic
1121766331 14:96489779-96489801 AATCCCTCATACACTGCTGGTGG - Intergenic
1122199675 14:100114779-100114801 ACTCCCACCTGCTCCGGGGGTGG + Intronic
1122939213 14:104973749-104973771 ACTCCTTCCTGCAGGGGTGGCGG - Intronic
1123020146 14:105394213-105394235 ACTTCCACCTGCACAGGTGTGGG - Intronic
1123397846 15:19955150-19955172 ACCCCCACCTGCTCTGGGGGTGG + Intergenic
1123476444 15:20594987-20595009 ACTTCCTCCTGCTCAGTTGGTGG + Intergenic
1123641567 15:22405377-22405399 ACTTCCTCCTGCTCAGTTGGTGG - Intergenic
1125254319 15:37745303-37745325 GCTCCCTCCAGCAGTGGTCGTGG - Intergenic
1126597604 15:50397848-50397870 ACTTCCTCCTGCCCCTGTGGTGG + Intergenic
1129562282 15:76583796-76583818 AAACCCTCATGCACTGTTGGTGG + Intronic
1132860012 16:2065786-2065808 CCTTCCTCCTGCTCTTGTGGAGG + Intronic
1132864946 16:2088620-2088642 CCTCCCTCCTGCACTGGCCTTGG + Exonic
1132909258 16:2299873-2299895 GCTCCCTCCTGCCCTGAAGGAGG - Intronic
1133356321 16:5139638-5139660 ACTACCTCCTGCACTTCTCGGGG - Intergenic
1135975356 16:27105571-27105593 TCTCTCTCTTGCCCTGGTGGTGG - Intergenic
1138094296 16:54199993-54200015 TGTCCCTCCTGCCCTGGTGTCGG - Intergenic
1138501228 16:57446384-57446406 GCTCCCCCCTGCACGGGTGCGGG - Intronic
1140107304 16:71972438-71972460 CCTCCCTCCTGCACTTTGGGAGG - Intronic
1142172616 16:88630776-88630798 ACACGCTCCTGCCCTGGTTGAGG + Intronic
1144016929 17:11205066-11205088 TCTTCCTCCTGAACTGATGGAGG - Intergenic
1144636943 17:16916135-16916157 GCTTCCTCCAGCATTGGTGGAGG + Intergenic
1145903155 17:28500985-28501007 AATCCCTCCTGCTGTGGAGGTGG - Intronic
1147519095 17:41151529-41151551 ACTCCCTCGTACACTGTTGGTGG - Intergenic
1147631594 17:41935839-41935861 ACTCCCTGCGGGCCTGGTGGTGG - Intronic
1149682250 17:58514614-58514636 CCTCCCTTCTGCACTCGTGCGGG - Intronic
1151495729 17:74457131-74457153 ACTCCCCCAGGCAGTGGTGGAGG - Intergenic
1152110869 17:78357263-78357285 CCTCCCTCCTGCCTGGGTGGGGG - Exonic
1152119071 17:78407042-78407064 CCTCTCTCCTGCCCTGGTGTGGG + Intronic
1152551387 17:81032142-81032164 CCTTCTTCCTGCACTGGGGGTGG - Intergenic
1152581667 17:81168058-81168080 ACTCCCTCCTGAGCTGGGGAGGG - Intergenic
1156212220 18:34957278-34957300 ACTCCCTTCCACATTGGTGGAGG - Intergenic
1157174360 18:45437577-45437599 ACACCAGCCTGCACTGGAGGTGG + Intronic
1157583214 18:48785406-48785428 ACTGCGGCCTGCACTGCTGGAGG + Intronic
1158566904 18:58561726-58561748 ACTCCCACCCCCATTGGTGGAGG + Intronic
1159453991 18:68638286-68638308 ACTGGCACCTGCTCTGGTGGAGG + Intergenic
1159838501 18:73369736-73369758 ACTAGCACCTGCTCTGGTGGAGG - Intergenic
1160526046 18:79538212-79538234 AGTCACTCCTGCATTGCTGGTGG - Intergenic
1161030588 19:2056212-2056234 ACCCCCACCTGCCTTGGTGGGGG + Intergenic
1161153051 19:2719651-2719673 TCTACCTGCTGCACTGGGGGTGG + Intronic
1162246620 19:9406861-9406883 ACTCCCACCTGCGCCGCTGGGGG - Intergenic
1163400898 19:17091822-17091844 ACTTCCTCCTGGCCTGGGGGCGG + Intronic
1164558311 19:29270045-29270067 CCTCCCTCCAGCACCTGTGGGGG - Intergenic
1165101583 19:33441558-33441580 GCTGCCTCCTACCCTGGTGGTGG - Intronic
1166051050 19:40260268-40260290 ACACCCTCATGCACTGCTGGTGG + Intronic
1167226258 19:48242856-48242878 GCCCCCTCCTACACTGCTGGTGG - Intronic
1167228006 19:48262465-48262487 GCCCCCTCCTACACTGCTGGTGG + Intronic
1167474381 19:49691503-49691525 ATTCCCTCCAGCACGGGCGGGGG + Intronic
1167889678 19:52529261-52529283 ACTCCCAGCTGCTCTGGAGGTGG + Intronic
927207072 2:20617456-20617478 TCTCACTCTAGCACTGGTGGAGG + Intronic
927434117 2:23052592-23052614 TCTCGCTCCTCCAGTGGTGGTGG + Intergenic
927988888 2:27433239-27433261 ACTCAGGCCTGCACTGGTTGGGG - Exonic
928375382 2:30769320-30769342 ACTCCCTCCCGTGCTGTTGGAGG + Intronic
930947082 2:57087654-57087676 AAACCCTCATGCACTGTTGGTGG - Intergenic
931341281 2:61403659-61403681 ACTCACTCCTGCTCTGGGTGGGG - Intronic
931867343 2:66426585-66426607 ACTCCCTCCGGCACAGGCTGAGG + Intergenic
932602044 2:73134254-73134276 CCCCCCTTCTGCACTGGTGAGGG + Intronic
934631245 2:95925636-95925658 CCTCCCACCTGCACTAGTGTAGG + Intronic
934833406 2:97557221-97557243 CCTCCCGCCTGCACTAGTGTAGG + Intronic
940784925 2:157971366-157971388 ACTGGCACCTGCTCTGGTGGAGG + Intronic
941946644 2:171105739-171105761 AAACCCTCCTACACTGTTGGTGG + Intronic
942449137 2:176098420-176098442 TCTTCCTCCTGCTCTGGTGGGGG - Intergenic
943449306 2:188028379-188028401 ACTAGCACCTGCTCTGGTGGAGG + Intergenic
944295826 2:198061427-198061449 CCACCCTCCTTCACTGCTGGGGG - Intronic
944870524 2:203907102-203907124 ACACCCATCTGCACTGGTGAGGG - Intergenic
945657573 2:212644129-212644151 ACTAGCACCTGCTCTGGTGGAGG + Intergenic
945703519 2:213200661-213200683 ACTCCCTCCTCCCCTACTGGTGG - Intergenic
947444984 2:230156596-230156618 AGTCCCTCCTGGACTGGAGCTGG - Intergenic
947612050 2:231530532-231530554 GCCCCCTCCCGCACTGGCGGAGG + Intergenic
948851835 2:240712053-240712075 TGTCACTCCTGCACTGGGGGCGG - Intergenic
1173526353 20:43735854-43735876 ACGCCCTCCTGCGCTGATGTTGG - Intergenic
1173570330 20:44071683-44071705 ATTCCATCCTGCAATGATGGTGG + Intergenic
1173663873 20:44752008-44752030 ACTGCTTCCTGGACGGGTGGTGG - Exonic
1174006728 20:47416788-47416810 CCTCCCACCAGCACTGGTGGGGG + Intergenic
1174034497 20:47660066-47660088 ACTCCCTCCTGCACTTGGTCAGG - Intronic
1174042367 20:47709063-47709085 TCTCCCACCTCCACTGGTGCCGG - Intronic
1174282109 20:49447002-49447024 CCTCCCTCCTCCACTGGAGTGGG + Intronic
1174769765 20:53288145-53288167 AATCCCTCCTGCACTTTGGGAGG + Intronic
1175121085 20:56716875-56716897 AATCCCTCCTCCAGGGGTGGGGG + Intergenic
1175178333 20:57127302-57127324 GCTACCTTCTGCACTGGTGGAGG + Intergenic
1176131185 20:63497493-63497515 GGTCCCTCCTGCCCTGGAGGAGG + Intronic
1176344969 21:5734950-5734972 ATTTCCTCCGGCACTGGTGCAGG + Intergenic
1176351783 21:5855534-5855556 ATTTCCTCCGGCACTGGTGCAGG + Intergenic
1176499858 21:7589505-7589527 ATTTCCTCCGGCACTGGTGCAGG - Intergenic
1176539290 21:8133020-8133042 ATTTCCTCCGGCACTGGTGCAGG + Intergenic
1176558241 21:8316065-8316087 ATTTCCTCCGGCACTGGTGCAGG + Intergenic
1176589637 21:8633602-8633624 GATCTCTCCTGCATTGGTGGTGG - Intergenic
1180272467 22:10610596-10610618 GATCTCTCCTGCATTGGTGGTGG - Intergenic
1180977952 22:19860859-19860881 TCTCCTTCCTGCCCTGCTGGTGG + Intergenic
1181413742 22:22745041-22745063 ACTCTCTCCTGAGCAGGTGGGGG - Intronic
1182146237 22:27998532-27998554 ACTCCCACCTGCCCAGTTGGAGG + Exonic
1183520849 22:38295313-38295335 ACTTCCTCCTGCACCAGGGGCGG - Intronic
1184339565 22:43878904-43878926 TCTCCCCTCTGCACTGGGGGAGG + Intergenic
1184514869 22:44955763-44955785 ACCAGCTCCTGCAATGGTGGAGG - Intronic
1184773911 22:46613766-46613788 ACCCCCTCCTGCCCTGGAGGCGG + Intronic
1184885999 22:47344872-47344894 GCTCCCCCCAGCACTGGTGATGG - Intergenic
1185048225 22:48539871-48539893 GCCCCCTTCAGCACTGGTGGCGG - Intronic
1203244239 22_KI270733v1_random:49375-49397 ATTTCCTCCGGCACTGGTGCAGG + Intergenic
949137661 3:588120-588142 GATCTCTCCTGCATTGGTGGTGG + Intergenic
949189661 3:1236348-1236370 ACCACCACCTGCTCTGGTGGAGG - Intronic
949928394 3:9059540-9059562 CCTCCTTCCTGCACCGATGGGGG - Intronic
952461559 3:33531902-33531924 AAACCCTTCTGCACTGGTGGTGG + Intronic
953268807 3:41419554-41419576 ACACCGCCCTGCAGTGGTGGCGG + Intronic
953849581 3:46455540-46455562 AGTCTCTCCTGCAGGGGTGGAGG - Intronic
954872851 3:53780841-53780863 ACTCTCTGAGGCACTGGTGGAGG + Intronic
955836429 3:63060571-63060593 ATACCCTCCAGCACTGGTGGGGG + Intergenic
956026807 3:64991792-64991814 ACTCCCTCCTGTTCTTCTGGAGG - Intergenic
957060973 3:75481106-75481128 ACTACCTCCTGCACTTGTCGGGG - Intergenic
961292408 3:125858314-125858336 ACTCTCTCCTGCACTTGTCAGGG + Intergenic
961358865 3:126355463-126355485 GCTCCCACCTGCAGTGCTGGGGG - Intronic
961894779 3:130158093-130158115 GCTCCCTCCTGCACTTGTCGGGG - Intergenic
962034500 3:131636801-131636823 ACTAGCACCTGCTCTGGTGGAGG - Intronic
966225654 3:177594809-177594831 ACTTTCTCCTGCACCAGTGGTGG - Intergenic
966912435 3:184566933-184566955 CCTACCACCTGCCCTGGTGGAGG - Intronic
967918359 3:194596288-194596310 ACTTCCTCCTGGACTGGGGCAGG - Intronic
968174247 3:196535492-196535514 AGTCACTCCTACATTGGTGGTGG - Intergenic
968687452 4:1970825-1970847 ACTCCGTCCTGTCCTGTTGGCGG - Intronic
969004881 4:4011146-4011168 ACTCCCTCCTGCACTTGTCGGGG - Intergenic
969604153 4:8194004-8194026 TCTACCTCCCGCACGGGTGGTGG - Intronic
969747993 4:9089002-9089024 GTTCCCTCCTGCACTTGTCGGGG + Intergenic
969809022 4:9633540-9633562 ACTCCCTCCTGCACTTGTTGGGG + Intergenic
970875501 4:20864594-20864616 CCTCTCTCCTGCTCTGGGGGAGG - Intronic
974855689 4:67458033-67458055 AGGCCCTCCCACACTGGTGGGGG - Intergenic
976918206 4:90404626-90404648 ACTAGCACCTGCTCTGGTGGAGG - Intronic
978390537 4:108220575-108220597 CCTCCCTCCCCCACAGGTGGGGG - Intergenic
981857102 4:149307788-149307810 AATCCCACCTGCAATGGTGAGGG - Intergenic
984051732 4:174872841-174872863 ACGCCCACCTGCACTGGTGAAGG - Intronic
984610309 4:181829760-181829782 ACTCCCATCAGCACTGCTGGAGG - Intergenic
985843065 5:2324211-2324233 ATTCCCACCTGAAATGGTGGAGG + Intergenic
986331406 5:6718616-6718638 ACTTGCTCCTGCACTGTTGGAGG + Intronic
986348114 5:6853168-6853190 GCTCCATCCTGCAATGGTGAGGG - Intergenic
990962337 5:61407881-61407903 GCATCCTCCTGCACTGCTGGTGG + Intronic
992207968 5:74449329-74449351 ACTCCGTCTTGCTCAGGTGGGGG + Intergenic
993612088 5:90066918-90066940 TCTCTCTCCTACCCTGGTGGTGG + Intergenic
995311234 5:110714179-110714201 ACTCCCTGCTGCAGGGCTGGAGG + Intronic
1000265380 5:159631363-159631385 GCACCCTCATGCACTGTTGGTGG - Intergenic
1002621612 5:180492429-180492451 ACTCCCTGCTGTACAGGAGGAGG + Intergenic
1003024542 6:2542534-2542556 CCTCTCTCCTGGGCTGGTGGAGG - Intergenic
1003335674 6:5169839-5169861 ATTCCCTCCTACACTGGTCATGG - Intronic
1005335094 6:24788224-24788246 AAACCCTCCTGCAGTGGTGGTGG + Intergenic
1005774760 6:29118865-29118887 TCTTGCTCCTGCACTGGGGGTGG + Intergenic
1008236499 6:49057728-49057750 CCTCCATACTGCCCTGGTGGAGG + Intergenic
1008627047 6:53326960-53326982 ACTGTCTGCTGCACTAGTGGTGG - Intronic
1012186536 6:96223860-96223882 AAACCCTCATGCACTGTTGGTGG - Intergenic
1012273505 6:97243944-97243966 ACCACCACCTGCTCTGGTGGAGG + Intronic
1014313136 6:119830408-119830430 ACTAGCACCTGCTCTGGTGGAGG + Intergenic
1015135316 6:129862673-129862695 ACACCCTCATACACTGCTGGTGG - Intergenic
1015889966 6:137960681-137960703 ACTCCCTCCTGCTTTGGGGAGGG - Intergenic
1016216258 6:141607641-141607663 ACCAACACCTGCACTGGTGGAGG + Intergenic
1018384342 6:163289677-163289699 ACTCCCTCCTGGACTAGTACAGG - Intronic
1020047139 7:5048836-5048858 TCTTCCTCCTGCTCTGGTGATGG - Intronic
1020292500 7:6732694-6732716 TCTTCCTCCTGCTCTGGTGATGG - Intergenic
1022326964 7:29341205-29341227 GCTCCCTCCTTCACGTGTGGAGG + Intronic
1024358518 7:48443774-48443796 ACTCCCTCCTCCAATGGGAGTGG - Intronic
1024776571 7:52794066-52794088 ACAACCTCATGCACTGCTGGAGG - Intergenic
1024917666 7:54521641-54521663 AAACACTCCTGCACTGCTGGTGG - Intergenic
1027116164 7:75483435-75483457 TCTTCCTCCTGCTCTGGTGATGG + Intronic
1027275663 7:76552263-76552285 TCTTCCTCCTGCTCTGGTGATGG - Intergenic
1027349898 7:77300797-77300819 AATCCCACCTACACTGCTGGTGG - Intronic
1028417406 7:90595727-90595749 ACTGCCTCCTGGACTGGGTGCGG - Intronic
1029714977 7:102320744-102320766 ACACCCACCTGCACTGCTGTTGG - Intronic
1029721370 7:102366817-102366839 TCTTCCTCCTGCTCTGGTGATGG - Intronic
1030068891 7:105681431-105681453 GATCCCTCGTGCACTGTTGGTGG + Intronic
1030299731 7:107963002-107963024 ATTCCCTCCTGGACTGGAGCCGG - Exonic
1030390395 7:108920724-108920746 ACTAGCACCTGCTCTGGTGGAGG + Intergenic
1030642416 7:112021506-112021528 ACTTCCTCCTGCACTGTAAGTGG - Intronic
1034071254 7:148188027-148188049 ATTCCCTGCTGCAATGGTAGTGG - Intronic
1034262230 7:149764407-149764429 ACTCTTTCCTGCCCTGGTTGAGG + Exonic
1035165806 7:156989066-156989088 CCTCCCTCCTGCTCTGGGGAAGG + Intergenic
1036371051 8:8163198-8163220 GCTCCCTCCTGCGCTTGTCGGGG + Intergenic
1036456921 8:8917608-8917630 ATCCCTTCCTTCACTGGTGGTGG + Intergenic
1036879846 8:12502438-12502460 GCTCCCTCCTGCACTTGTCGGGG - Intergenic
1039548032 8:38423726-38423748 ACTCCCTCCAGGACTGGAGCAGG + Intronic
1040750348 8:50698457-50698479 ATCCCCTCCTGTACTGGTGGGGG + Intronic
1042307100 8:67343581-67343603 CGTCCCTCCGGCCCTGGTGGCGG + Exonic
1042645478 8:70982019-70982041 ACCTGCACCTGCACTGGTGGAGG + Intergenic
1046937988 8:119904045-119904067 ACTTCCTCCTCCTCTTGTGGAGG - Intronic
1048202940 8:132391862-132391884 ACTGCTTCCTGCACTGGCGAGGG + Intronic
1049270843 8:141695364-141695386 ACTGCTTCCTGCCCAGGTGGTGG - Intergenic
1049577527 8:143396661-143396683 AATCTCTCCTGGACTGGCGGTGG + Intergenic
1049667203 8:143850926-143850948 ACTCCCTCCAGTGCTGGTGGGGG - Intergenic
1051715773 9:19981949-19981971 TCTCCCTCCTCCACTGATGTTGG - Intergenic
1055935498 9:81600804-81600826 ATACCCACCTGCACTGGTGGGGG - Intronic
1056074454 9:83024211-83024233 ACTCCCTTCTGTGCTGCTGGAGG - Intronic
1056432288 9:86539926-86539948 ATTCCCTTGTGCACTGATGGTGG + Intergenic
1056580833 9:87887254-87887276 ACTCCCTCCTGCTCAGGCGGTGG - Exonic
1056661128 9:88544223-88544245 TCTCCCTCCTGCTGGGGTGGGGG - Intronic
1056761763 9:89420502-89420524 ACACTCTCCTGCACTAGAGGGGG - Intronic
1058667552 9:107334383-107334405 ACACCCACCTGCATTGGTGAGGG + Intergenic
1060672931 9:125486321-125486343 TCTACCCCCTGCACTGGTGATGG - Intronic
1060926730 9:127460537-127460559 TCTCCCTCCTTCCCTGATGGTGG + Intronic
1062288788 9:135785513-135785535 ACTCCCTCCTGCACTGGTGGTGG + Intronic
1186163964 X:6806995-6807017 ACTACCTACTGGACAGGTGGAGG + Intergenic
1186240697 X:7562386-7562408 AAGCTCTCCTGCATTGGTGGTGG + Intergenic
1186242564 X:7585699-7585721 AAACCCTTCTGCACTGTTGGTGG - Intergenic
1187679509 X:21752945-21752967 AATCCATCCTGTACTGGTGTAGG - Intronic
1189425180 X:40893678-40893700 AATCCCTTGTGCACTGTTGGTGG - Intergenic
1190507367 X:51139360-51139382 ACTCTGTTCTGCACTGTTGGAGG + Intergenic
1196249656 X:113445901-113445923 AATCCCTCATGCACTGCTAGTGG + Intergenic
1196255453 X:113512991-113513013 AATCCCTCATACACTGTTGGTGG - Intergenic
1197472119 X:126877067-126877089 ACTAGCACCTGCTCTGGTGGAGG + Intergenic