ID: 1062288887

View in Genome Browser
Species Human (GRCh38)
Location 9:135785839-135785861
Sequence GGGCAAGGCCAGGATGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 0, 2: 5, 3: 30, 4: 331}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062288887 Original CRISPR GGGCAAGGCCAGGATGTGCT GGG Intronic
900164280 1:1238509-1238531 GGGCTTGGCCAGTCTGTGCTTGG - Intergenic
900290819 1:1922899-1922921 GGGCAAGGCCAGGAGGGTCAGGG + Intronic
900299325 1:1969196-1969218 GGGCAGGGCTAGGCTGGGCTGGG - Intronic
900336949 1:2169155-2169177 GGGCTGGGACAGGATCTGCTGGG - Intronic
900486858 1:2926765-2926787 GGGCTGGGCCGGGCTGTGCTGGG + Intergenic
900506065 1:3030273-3030295 GGCCAAGGCCAGGAGGGGCCTGG + Intergenic
900626355 1:3610432-3610454 CAGCAAGGCCAGGGAGTGCTGGG + Intronic
900772914 1:4560111-4560133 GGGCAAGGCCACCATGTTGTCGG - Intergenic
900992522 1:6104486-6104508 GGGCAGGGCCAGGGTCTCCTGGG + Exonic
901850298 1:12010892-12010914 GGGCGAGGGCAGGAAGTGCAGGG - Intronic
902409066 1:16202298-16202320 GAACAAGGCCAGGATGTCCCAGG + Intronic
902788117 1:18746003-18746025 GGGCATGGTAAGGATGGGCTCGG - Intronic
902805126 1:18856229-18856251 TGCCAAGGCCAGGAGGTGCCTGG - Intronic
903261392 1:22133544-22133566 GGGCCGGGCCAGGCTGTGCAGGG + Intronic
905178916 1:36155153-36155175 GGGCAGGGCCAGGGTGGGCAGGG + Intronic
905298309 1:36968706-36968728 GGGCAAGGCCAGGACTTGCTGGG + Intronic
905327949 1:37171249-37171271 GGACAAGGCGAGGATGTGTGGGG - Intergenic
905917889 1:41698639-41698661 GGGAAACACCAGGATGTGTTGGG - Intronic
905938097 1:41840720-41840742 TGGCACGGCCAGGATCTGATGGG - Intronic
906165711 1:43684618-43684640 GGGCAAGGCCAGGGAGTGATAGG + Intronic
906213961 1:44028463-44028485 GGGCCAGGCCAGGCTGGGCGCGG + Intronic
906610288 1:47196907-47196929 GGGTAGGGAAAGGATGTGCTTGG - Intergenic
906727554 1:48054996-48055018 GGGCAAGGCCTGGATCTGCAGGG + Intergenic
912505440 1:110152584-110152606 GAGCAGGGCCAGGCTGGGCTGGG + Intronic
913003425 1:114604796-114604818 TGGCAAGTCAAGGATGTGGTAGG - Intronic
914819770 1:151091998-151092020 GTGCAAGGCCAGCCTGGGCTGGG - Intronic
915895291 1:159807271-159807293 AGGCAAGAGCAGGATGTGCTGGG + Intronic
916018744 1:160775066-160775088 GAGCAATGGCAGGATGTGGTGGG + Intergenic
916890634 1:169109006-169109028 GGGCGAGGGCAGGATGCCCTTGG + Intronic
917853952 1:179086975-179086997 GGGCAGGGGCAGGCTGAGCTGGG + Intronic
918430016 1:184449882-184449904 GGGAGAAGGCAGGATGTGCTTGG + Intronic
919074504 1:192797409-192797431 TGGCAAGGCCAGGCTGGGCTGGG - Intergenic
919674298 1:200366338-200366360 GGCCCAGGGCAGCATGTGCTGGG + Intergenic
922565685 1:226600335-226600357 GGGCATGGCCAGGATATGGAGGG + Intronic
922920382 1:229296780-229296802 GGGCAAGTGCAGGAAGGGCTGGG - Intronic
924233088 1:241978574-241978596 GGTCTAGGCCAGGCTGTGCACGG + Intergenic
924274832 1:242375140-242375162 GGGAGAGGCTAGGACGTGCTTGG - Intronic
1065326171 10:24552465-24552487 TGGCAAGGCCAGGAGGAGGTGGG - Intergenic
1067256549 10:44647663-44647685 GGGCAAGGCAGGGATGGGCAGGG - Intergenic
1067994694 10:51258521-51258543 GAGCAAGGCCAGCTTTTGCTGGG - Intronic
1068715204 10:60179881-60179903 GGGCATGGCTTGGATGTGCTGGG + Intronic
1069715079 10:70515430-70515452 GGGCAGAGCCAGGCTGGGCTGGG - Intronic
1069895118 10:71675788-71675810 GGGCAAGGCTGGCATGTGTTAGG - Intronic
1070284214 10:75071677-75071699 GAGGAGGGCCAGGAAGTGCTGGG + Intergenic
1070762806 10:79035265-79035287 GGGCAGGGCAAGGGTGTGGTTGG - Intergenic
1071565611 10:86669945-86669967 GGGCAAGGCCTGAAGGGGCTTGG + Intronic
1072618159 10:97063301-97063323 GGGCAGGGTCAGGAGGTGATGGG + Intronic
1073002348 10:100295037-100295059 GGCGAAGCCCAGGATGTCCTTGG + Exonic
1074156423 10:110804202-110804224 GGGCTAGGCCATGCTGTGATTGG + Intronic
1074359854 10:112816902-112816924 GGCCAAGGCCTGCATGTGTTCGG + Exonic
1075050038 10:119176840-119176862 GGGTGAGACCAGGATGTGCCGGG - Intronic
1075584855 10:123650294-123650316 GGGCAAGGCCTGGAGCTTCTTGG + Intergenic
1076525764 10:131111657-131111679 GGGGAAGGTCAGGCTGTGCGAGG - Intronic
1076776647 10:132701596-132701618 GAGCAGGGCCGGGAAGTGCTGGG - Intronic
1076879967 10:133235458-133235480 GGGCCAGGCCGGGTTGCGCTGGG - Intergenic
1077126773 11:942988-943010 GGGGGAGGCCAGAACGTGCTGGG + Intronic
1077316131 11:1920183-1920205 TGGCAAGGCCAGGACGGGCCTGG - Intronic
1077442827 11:2576692-2576714 GGGCAAGGCCAGAAGGGGCTGGG + Intronic
1078856057 11:15207060-15207082 GGGCCAGGCCAGGATGGGGTTGG + Intronic
1078876407 11:15403169-15403191 GGGCAAAGCCAGGTGGGGCTGGG + Intergenic
1080691082 11:34558596-34558618 TGCCAAGGCCTGGATGTGCTGGG + Intergenic
1080942638 11:36937065-36937087 GGTCTAGGCCAGGTTGGGCTAGG - Intergenic
1083617266 11:64032485-64032507 GGGCAGGGCCAGGGTGACCTTGG + Intronic
1083626207 11:64073333-64073355 GAGCAAAGCCAGGATGGGCATGG - Intronic
1083840158 11:65299630-65299652 CAGCAAGGCCAGGTTGAGCTGGG - Intronic
1084204677 11:67584587-67584609 GGGCAAGGGGAGGGGGTGCTGGG + Intronic
1084710579 11:70841472-70841494 CAGCCAGGCCAAGATGTGCTTGG + Intronic
1084857642 11:71999158-71999180 GGGAAAGGCCAGGATGTGGACGG + Exonic
1085032282 11:73280049-73280071 GGGCAAGGCCAGGGCAAGCTGGG + Intronic
1085846009 11:80065913-80065935 GTGCAAGGCAATGATGTGCCGGG + Intergenic
1089565037 11:119366653-119366675 GGGCCAGACCAGGCTCTGCTAGG + Intronic
1089853279 11:121518368-121518390 GGGAAAGGAAAGGATGGGCTGGG + Intronic
1090204061 11:124875273-124875295 GCCCAAGGCCAGGAGGGGCTGGG + Exonic
1091694084 12:2616458-2616480 GGGGAAGGCCAGGGAGGGCTGGG - Intronic
1091842842 12:3633141-3633163 GAGCAAGGCCAGGATGTAGCAGG + Intronic
1092155601 12:6279731-6279753 GGGCCAGGCATGGATCTGCTGGG - Intergenic
1092921161 12:13233086-13233108 AGGGAAGGCCAGGGTGGGCTGGG - Intergenic
1095986262 12:48001637-48001659 GGGCGGGGCCAGGCTGCGCTGGG + Intronic
1096269237 12:50151120-50151142 GGGGAAGGCCAGAGGGTGCTAGG - Intronic
1096630762 12:52925504-52925526 GGGCAAGGCCAGGATGACGGAGG - Intronic
1100406075 12:94273948-94273970 TGGCAGGGCCAGGAGGTACTGGG - Intronic
1100870805 12:98908104-98908126 TCCCTAGGCCAGGATGTGCTTGG - Intronic
1101373907 12:104154372-104154394 GGGCAAGAGCAGGAAATGCTGGG + Intergenic
1102204195 12:111078971-111078993 GGACCAGGCCAGGATAGGCTTGG - Intronic
1103584651 12:121943021-121943043 GTGCAAGGCCAGGCTGGGCGTGG + Intronic
1103960780 12:124607835-124607857 CGGACAGGCCAGGATGTGCCTGG + Intergenic
1104875744 12:132033401-132033423 AGGTGAGCCCAGGATGTGCTCGG - Intronic
1107015629 13:35706188-35706210 GGGGAAGGGCAGGGTGAGCTAGG + Intergenic
1107670997 13:42746152-42746174 GGGAAAGGCCAGGTTGTGAAGGG + Intergenic
1113747249 13:112754001-112754023 GGTCAAGGTCAGGCTGTGATCGG - Intronic
1113892767 13:113744846-113744868 GGGGAAGTCCAGGATGTGGCCGG - Intergenic
1113936319 13:113996897-113996919 GGCCAAGGCCAGGGGGTGCATGG + Intronic
1115203187 14:30874873-30874895 GGGCAAGGCCAGGGTGCGGGAGG - Intronic
1117580087 14:57143224-57143246 GGGCAAGGGAAGAATGTGGTTGG - Intergenic
1118295646 14:64566505-64566527 TGGCAGCCCCAGGATGTGCTAGG + Intronic
1118980468 14:70712147-70712169 TGGCAAGACCTGGATGTTCTTGG + Intergenic
1119877444 14:78072929-78072951 GTGCCAGGACAGGGTGTGCTAGG - Intergenic
1120173888 14:81273619-81273641 GGGCTGGGCCAGGCTGGGCTGGG + Intronic
1120475290 14:84979069-84979091 GTGCAATTCCAGGAGGTGCTGGG - Intergenic
1121644613 14:95509291-95509313 GAGAAAGGCCACGATGAGCTAGG + Intergenic
1121939420 14:98055617-98055639 AGGCAGGGCCATGAGGTGCTAGG - Intergenic
1121996664 14:98608194-98608216 GGGCAAGGCCAGGCTGTCCCCGG + Intergenic
1122229495 14:100298624-100298646 GGCCAAGCCCAGGATGGACTTGG + Intronic
1122234934 14:100326091-100326113 GGGCAAGGCCAGCAGGCCCTGGG - Intronic
1122343493 14:101044041-101044063 GGGCCAGGCCACAATGTGCAAGG + Intergenic
1122355262 14:101119426-101119448 GGGCGTGGCCAGGATGTGACGGG + Intergenic
1122594322 14:102878865-102878887 GGGCAAGGCCTGGTGTTGCTGGG + Intronic
1123084525 14:105711349-105711371 GAGCTAGGCCAGGCTGGGCTGGG - Intergenic
1123109676 14:105860090-105860112 GAGCAAGGCTAGGCTGAGCTGGG - Intergenic
1125743615 15:41984390-41984412 GGCCAAGGGCAGCAGGTGCTGGG + Intronic
1128154691 15:65385145-65385167 GGGCACGACCAGGATTGGCTGGG + Intronic
1128261661 15:66236990-66237012 GGACAAGGGAAGGAGGTGCTGGG - Intronic
1128381469 15:67116260-67116282 GTGGATGGCCAGGATGTGCTTGG - Intronic
1130808604 15:87353236-87353258 GGGCAAGGCTAGGCTTTGATTGG + Intergenic
1132404863 15:101536119-101536141 GGGGAAGGTCAGGAGTTGCTGGG + Intergenic
1132941083 16:2508679-2508701 GGACAAGGGAAGGAGGTGCTGGG - Intronic
1133117755 16:3587890-3587912 GGGCAAGGACAGGCCGGGCTGGG - Intronic
1133407750 16:5539157-5539179 GGGAAAGTGCAGGAAGTGCTGGG + Intergenic
1135421428 16:22308031-22308053 GGGTAAGGCCAGTCTCTGCTTGG + Intronic
1136008051 16:27344706-27344728 GGGAGCGGCCAGGGTGTGCTGGG - Intronic
1136236132 16:28914645-28914667 GGGCACGGCCAGGGGGCGCTGGG - Intronic
1136257897 16:29054613-29054635 GGGCAAGGTCAGGAAGTGGCAGG - Intergenic
1136625920 16:31462227-31462249 TGCCAAGGCCAGGCGGTGCTGGG - Exonic
1137001778 16:35235377-35235399 GTGCATGGCCAGGAGCTGCTGGG - Intergenic
1137018059 16:35395246-35395268 GTGCATGGCCAGGAGCTGCTGGG - Intergenic
1137737606 16:50736643-50736665 GGGCAATGCCTGGAAGTGCCCGG + Intergenic
1137760492 16:50936187-50936209 GGGCAAGGCCAGGAAGAGGCGGG + Intergenic
1138378551 16:56584074-56584096 GGTCCGGGCCAGGATCTGCTTGG + Intergenic
1140225209 16:73071386-73071408 GCTCAAGGCCAGGAGCTGCTGGG - Intergenic
1140491442 16:75339589-75339611 GGGGAAGGGCAGGATATGCAGGG + Intronic
1141091863 16:81135934-81135956 GGGCAAGGCTGGGATGTGGAAGG - Intergenic
1141664724 16:85460081-85460103 GAGCAAGGACACGATGTCCTGGG + Intergenic
1141667465 16:85473318-85473340 GGGCAGGGCCAGGAGCTGGTGGG + Intergenic
1142229818 16:88894990-88895012 GGGCCAGGTCAGGATGGGCAGGG - Intronic
1143034465 17:3986452-3986474 GAGCGTGGCCAGGCTGTGCTTGG - Intergenic
1143462865 17:7114973-7114995 GTGCCAGGCCAGGAGGGGCTGGG + Intronic
1143471724 17:7179569-7179591 GTGCCAGGCCAGGAGGGGCTGGG + Intergenic
1147909914 17:43849324-43849346 GGGCGAGGCCAGCATGTCCAGGG - Intronic
1147911885 17:43861012-43861034 GGGCAAGGCAGGGAGGTGCCGGG - Intronic
1148025076 17:44581585-44581607 TGGAAAGGACAGGATGAGCTGGG - Intergenic
1149363088 17:55914224-55914246 AGGCATGGCCAGGCTGGGCTGGG + Intergenic
1150250957 17:63704266-63704288 GGGTAAGGCCAGGGTGTGAAGGG - Intronic
1150456997 17:65314179-65314201 GGGGAAGTCCAGGAGGTCCTGGG - Intergenic
1150473929 17:65460143-65460165 GTGCAAGACCAGGGTGTACTGGG + Intergenic
1151678649 17:75612937-75612959 GGGTAAGGACAGGACGTGCGGGG - Intergenic
1151704530 17:75759638-75759660 GGGCAAGGACAGGCTGGGGTGGG + Intronic
1151765945 17:76133118-76133140 GGGGAGGGCCAGGATGTGGGAGG - Intergenic
1152029993 17:77836285-77836307 GGGCAAGGCCAGAGTTGGCTTGG - Intergenic
1152282991 17:79396373-79396395 GGGCAAGGCCAGGATGAGCAGGG - Intronic
1152822444 17:82444246-82444268 GGAGCAGGCCAGGAAGTGCTGGG - Intronic
1154501957 18:15001615-15001637 GGGCAAGGCAAGGCAGGGCTGGG - Intergenic
1154958493 18:21283824-21283846 GGGCAAGCCCAGGATCAACTTGG + Intronic
1157476924 18:48029506-48029528 GGGCGCTGCCAGGAAGTGCTTGG + Exonic
1157557661 18:48623140-48623162 GGGCAAGGCAAGGCTGTGGAGGG + Intronic
1157567285 18:48688158-48688180 AGGCAAGGCCAGTCTGTGCACGG + Intronic
1157598185 18:48876431-48876453 GGTCACGGCCAGGCTGGGCTTGG - Intergenic
1157617838 18:48997938-48997960 GGGCCAGGGCAGGATGGGCGCGG - Intergenic
1158984225 18:62797494-62797516 GGGCAGGGTAAGGAGGTGCTAGG + Intronic
1159993713 18:74941070-74941092 GGGCAAGGCAAGGACGGGCCCGG - Intronic
1160100121 18:75912677-75912699 GGGCAAGTCCAGGATCAGCAGGG - Intergenic
1160169329 18:76539938-76539960 GGGCAAGGCCATGATTGACTGGG - Intergenic
1160492782 18:79351894-79351916 GGGCAAGGGCAGAGTGGGCTTGG - Intronic
1161056417 19:2192897-2192919 GGGCCCGGCCAGCAAGTGCTAGG - Intronic
1161315607 19:3615912-3615934 GGGCACGGCCGCGCTGTGCTTGG - Intronic
1161642043 19:5430337-5430359 GAGTAAGTCCAGGAGGTGCTGGG + Intergenic
1162798557 19:13098972-13098994 GGGGGAGGCCAGGAGGGGCTGGG - Intergenic
1163126406 19:15246551-15246573 GTGCAAGGGAAGGATATGCTGGG + Intronic
1163595018 19:18216200-18216222 GGGTACAGCCAGGATCTGCTGGG + Intronic
1165309841 19:35023316-35023338 GGCCAGGGCCAGGCTGTGCCAGG - Exonic
1165358284 19:35317649-35317671 GTGCAAGGTCAGGCTGTGCTGGG + Intergenic
1165422297 19:35728212-35728234 GGGCAAGGCCAGGGCATGCAGGG + Intronic
1168414688 19:56160592-56160614 GGGGCAGGCCAGGAGGAGCTCGG + Exonic
1168486214 19:56764663-56764685 TGGCCAGGCCATGATGTGCTGGG - Intergenic
1168642752 19:58040781-58040803 GGGAAAGGACAGGAGGGGCTGGG - Intronic
926088005 2:10032266-10032288 GGCCAAGGGCAGGAGGTTCTGGG - Intergenic
926341249 2:11906483-11906505 AGGCCAGGGCAGGAAGTGCTAGG + Intergenic
927032844 2:19140629-19140651 GGGCAAGGCCAGGAACTTTTGGG + Intergenic
927739157 2:25551721-25551743 GGACAAGGTCAGGATGTGCTTGG + Intronic
927910030 2:26890912-26890934 GGGCAGGGCCGTGATCTGCTAGG - Intronic
928632249 2:33205815-33205837 GGGCAGGGCCCTGATGTGATAGG + Intronic
930111769 2:47684908-47684930 GGGCAAGGCCAGGAGGAAGTTGG - Intergenic
930742155 2:54842613-54842635 AAACAAGGCCAGGATGTGATGGG - Intronic
931697526 2:64882599-64882621 AGGCCAGGCCAGGTTGTGCAGGG + Intergenic
932280698 2:70489390-70489412 GCACAAGACCAGGATGTTCTGGG + Intronic
932731422 2:74224707-74224729 GGCCCAGTCCAGGATGGGCTGGG - Intronic
933921214 2:87048718-87048740 AGGCATGGCCATGCTGTGCTGGG - Intergenic
933930420 2:87145079-87145101 AGGCATGGCCATGCTGTGCTGGG + Intergenic
934001752 2:87720867-87720889 AGGCATGGCCATGCTGTGCTGGG + Intergenic
934717563 2:96552406-96552428 GGGCATGGCCCGGGTGTCCTGGG - Exonic
934948126 2:98556637-98556659 AGGTAAGGCCCAGATGTGCTGGG + Intronic
935796542 2:106647114-106647136 GGAAAAGGCCAGGAGGTGGTGGG - Intergenic
936362710 2:111820369-111820391 AGGCATGGCCATGCTGTGCTGGG - Intronic
937002280 2:118478764-118478786 GGGCAGGGCCAGGCAGAGCTGGG - Intergenic
937984232 2:127631416-127631438 CTGTAGGGCCAGGATGTGCTGGG - Intronic
937988926 2:127651547-127651569 TGCCAGGGCCAGGATGCGCTGGG - Exonic
941178621 2:162232071-162232093 GGGCAAGGACAGGAAGTATTAGG + Intronic
943517006 2:188901050-188901072 GGGCATTTCCAGTATGTGCTAGG + Intergenic
946045196 2:216815165-216815187 GGGCAAGTCCAGGACGAGCCTGG + Intergenic
946159232 2:217826031-217826053 GGGCAGGGCCAGGTGGGGCTGGG - Intronic
947719860 2:232363741-232363763 GGGCCAGGCCAGGTGGGGCTGGG - Intergenic
947999424 2:234555590-234555612 GGGCAACCCCACCATGTGCTGGG + Intergenic
948460492 2:238127818-238127840 AGGAAAGGCCTGGCTGTGCTGGG - Intronic
948802887 2:240440810-240440832 CGGCACGGCCAGGAGGAGCTGGG - Intronic
949025286 2:241764958-241764980 GGCCAGGGCCAGGGTGTGCTTGG + Intronic
1168770056 20:408827-408849 GGGCAAGGCCAGGTCCTGCGGGG - Intronic
1169758430 20:9067573-9067595 GGAAATGGCCAGGATGTGCCAGG + Intergenic
1170431458 20:16280421-16280443 GGCCAAGGCCAGCCTGTGCAAGG + Intronic
1170562293 20:17568865-17568887 GGTCGAGGCCATGATGTTCTCGG + Intronic
1170574698 20:17653535-17653557 GGCCAGGGCCAGGCTGTTCTTGG - Intronic
1171188938 20:23144708-23144730 AGGCAAGGCCAGGCTCTCCTTGG - Intergenic
1171305533 20:24102640-24102662 GGCCATGGGCAGGATGGGCTGGG - Intergenic
1171459954 20:25292703-25292725 GGGCCAGGCCACTGTGTGCTAGG + Intronic
1172005556 20:31816992-31817014 GGGCAAGTCCACTCTGTGCTGGG + Intergenic
1172281488 20:33710969-33710991 GGGTCAGGACAGGATGTGATGGG - Intronic
1172639737 20:36433508-36433530 GGGCAAAGCCAGGCTGTGGGTGG + Intronic
1173002625 20:39115489-39115511 GGGTGAGGCCAGCAAGTGCTTGG + Intergenic
1174192585 20:48750778-48750800 GGGAAAGGCCAGGATAAGCAGGG + Intronic
1174305881 20:49614036-49614058 GAGCAAGGCCAGGAAGAGCCAGG + Intergenic
1175063315 20:56263619-56263641 GGGCCTGGCCATGATGTACTGGG - Intergenic
1175353196 20:58340986-58341008 TGGCCAAGGCAGGATGTGCTGGG + Intronic
1175375152 20:58518991-58519013 GGGACAGGCCAGGGTGGGCTGGG + Intergenic
1175448565 20:59043122-59043144 ATGCCAGGCGAGGATGTGCTGGG - Intergenic
1179238385 21:39567151-39567173 CGGCAAGGCCAGGAGGTGGTGGG - Intronic
1179475561 21:41641300-41641322 TTGCATGGCCAGAATGTGCTGGG + Intergenic
1179928669 21:44552262-44552284 GGGCAAAGCCAGCCTGTGCTTGG + Intronic
1180151231 21:45949088-45949110 AGGCACGGCCTGGACGTGCTGGG + Intergenic
1181048291 22:20226931-20226953 GGGCCAGGCCATGATGTTCCTGG + Intergenic
1181269906 22:21652817-21652839 GGGAAAGGCCTGGGTGTCCTGGG + Intronic
1181354251 22:22289221-22289243 GGGCAAGGCCAGGGTAGGGTGGG + Intergenic
1181539237 22:23564553-23564575 GGGCCAGGCCATGGTGGGCTTGG - Intergenic
1181960906 22:26621262-26621284 GGGCTAGGCCAGGGCCTGCTGGG - Intergenic
1181975559 22:26726880-26726902 GGGGAAGGAAAGGGTGTGCTGGG + Intergenic
1182429430 22:30291226-30291248 GGGCAAGGACAGGGTGTCCCTGG - Intronic
1182904338 22:33922180-33922202 GGGCAGGGGAAGGATGGGCTGGG + Intronic
1182991484 22:34771901-34771923 GGTCTAGGACAGGATGTGCCTGG - Intergenic
1183395439 22:37568571-37568593 GGGCAGGGCCAGCAGGTCCTCGG - Exonic
1183625638 22:38999765-38999787 GGCCAAGGCCGAGAGGTGCTGGG + Intergenic
1184149805 22:42631382-42631404 AGGGAGGCCCAGGATGTGCTGGG + Exonic
1184426070 22:44410044-44410066 GGGCAAGGCCAGAAGGCACTGGG - Intergenic
1184444385 22:44538974-44538996 TGGAAAGGCCAGGATCTGCCTGG - Intergenic
1184803126 22:46774578-46774600 GGGCAGGGCCAGGCATTGCTGGG + Intronic
1185012091 22:48319883-48319905 TGGCCAGGCCAGGATGCTCTGGG + Intergenic
1185107858 22:48884571-48884593 GGGCAACGCCGGGATGGGATTGG + Intergenic
1185211548 22:49573377-49573399 GAGCAGGGGCAGGATGTGCTGGG + Intronic
1185258241 22:49848471-49848493 GGGAAAGACCAGGAAGCGCTGGG - Intergenic
1185273445 22:49939039-49939061 GGGCAGGGCCAGGAGGTGCCAGG + Intergenic
1185287410 22:50008712-50008734 GGGCAGGAGCAGGATGGGCTGGG - Intronic
1185291024 22:50027841-50027863 GGGCACGGCCGGGAGGAGCTGGG - Intronic
1185332979 22:50259996-50260018 GGGCAAGGCCTTGGTGTGATGGG + Intronic
1185364808 22:50432587-50432609 GGGCAAAGCCAGGCTGGGCGGGG - Intronic
950857190 3:16116580-16116602 GGGCAAAGTCAGGAAGGGCTGGG - Intergenic
950869380 3:16215591-16215613 GGGGAAGGCAAGGATGTATTTGG + Intronic
952171918 3:30816434-30816456 GGGCTAGGGAACGATGTGCTGGG - Intronic
952953270 3:38541553-38541575 GTGCCAGGCCAGGACATGCTTGG + Intronic
953624119 3:44556695-44556717 GGGTAAGGCCAGGTTGTGAAGGG + Intronic
954287088 3:49626740-49626762 GGGCAAGGCCAGCATGAGGAGGG - Intronic
955202242 3:56861671-56861693 CGGAAAGGCCTGGATCTGCTGGG + Intronic
960940287 3:122928871-122928893 AGGCCTGGCCAGGATGAGCTGGG - Intronic
962154380 3:132930031-132930053 GGGCATGTCCAGGATGTCCAGGG + Intergenic
964751668 3:160059361-160059383 GGGCCAGGCCAGGAAGAGCAGGG + Intergenic
969329937 4:6468680-6468702 TGCCCAGGGCAGGATGTGCTTGG + Intronic
973013034 4:45101256-45101278 GTGCAAAGCCAAGATGTGCCAGG + Intergenic
974902568 4:68019393-68019415 GGGATAAGCCAGGATTTGCTAGG - Intergenic
975779081 4:77820007-77820029 GGCCAAGGCCAGGCTCTGCGTGG - Intergenic
976349965 4:84050216-84050238 AAGCAAGGCCAGGAAGTGCTGGG + Intergenic
976881345 4:89929093-89929115 GGGTAGGGCAAGGATGTTCTAGG + Intronic
977427166 4:96881963-96881985 AGGAAAGGCCAAGCTGTGCTAGG + Intergenic
979400086 4:120238544-120238566 GGACAAGGTCAGGAACTGCTGGG + Intergenic
985577758 5:681631-681653 GGGCCTGGCCAGGACCTGCTTGG + Intronic
985589256 5:756274-756296 GGGCCAGGCCTGGGTGAGCTGGG - Intronic
985592685 5:773730-773752 GGGCCTGGCCAGGAACTGCTTGG + Intergenic
985603936 5:848790-848812 GGGCCAGGCCTGGGTGAGCTGGG - Intronic
985725826 5:1515354-1515376 GGTTTGGGCCAGGATGTGCTGGG - Intronic
985725969 5:1515837-1515859 GGACAGGGCCAGGATGTGCTTGG - Intronic
985999181 5:3616708-3616730 TGGCCAGGCCAGGAGATGCTGGG - Intergenic
987304626 5:16625675-16625697 GGCCACAGCCAGGATGTTCTTGG - Intergenic
988597126 5:32605519-32605541 GTGCAAGGCCATGGTGCGCTAGG - Intergenic
989106714 5:37869660-37869682 GGGCAAGGTGTGGATGTGCTTGG + Intergenic
993280480 5:85919685-85919707 GAGCAGGGCAAGGAAGTGCTGGG - Intergenic
995531008 5:113091814-113091836 GGTCAAGGCCATGGTGGGCTAGG + Intronic
996912339 5:128669951-128669973 GGGCAATGGCAGGATTGGCTGGG + Intronic
999127806 5:149259248-149259270 GGGAAGGGTCAGGAGGTGCTGGG - Exonic
999235253 5:150086696-150086718 GGGCAGGGCCAGCCTGAGCTTGG + Intronic
999238820 5:150115692-150115714 AGGCCAGGCCAGGAGATGCTGGG + Exonic
999314508 5:150575263-150575285 TGGCAGGGCCAGGATGGGCCAGG - Intergenic
999450940 5:151677657-151677679 TGTCAAGACCAGAATGTGCTTGG - Intronic
999671198 5:153960434-153960456 GGGCAAGGCCTGGCTGTGCAGGG - Intergenic
1001066515 5:168539037-168539059 GGGATAGGCCAGGTTATGCTGGG + Intergenic
1001509803 5:172312189-172312211 GGGGAAGGCCAGGAAGTACTTGG + Intergenic
1003032595 6:2615417-2615439 TGGCAGAGCCAGGATGTGCCTGG + Intergenic
1005920733 6:30398187-30398209 GAGCAGGGCCTGGAGGTGCTTGG - Intergenic
1007424179 6:41736048-41736070 GGGCAAGGCCAGGGTGAGCCTGG + Intronic
1008641249 6:53465019-53465041 GGCCATGGGCAGGGTGTGCTTGG + Intergenic
1012426678 6:99122676-99122698 GGACAAGGCCAGCATGTGTCTGG - Intergenic
1012977958 6:105800229-105800251 GGGATAGGCCAGGCTGAGCTTGG + Intergenic
1014325325 6:119986447-119986469 GGGGAGGGCAAGGAAGTGCTGGG + Intergenic
1015079041 6:129201237-129201259 TGGCAAGGCCAGGCTGTGTTTGG - Intronic
1016162337 6:140897556-140897578 GGGCATGGCCAGTAACTGCTTGG - Intergenic
1018480484 6:164184558-164184580 GGGCAAGGGCAGGAAGTCCAGGG - Intergenic
1019496019 7:1341051-1341073 GGGGAAGGCCGAGCTGTGCTGGG - Intergenic
1019542133 7:1556225-1556247 CGGCAAGGCCAGGATCTGAAGGG + Exonic
1019548003 7:1587620-1587642 GGGCAAGGCGAGGAGGAGCCCGG + Intergenic
1019770461 7:2881020-2881042 GGGCAAGGCCAGGAGAAGCTGGG - Intergenic
1019856743 7:3616376-3616398 GAGCAGGGCCAGGTTGTGCAGGG - Intronic
1023864893 7:44233938-44233960 GGGCTGGGCCAGGATCTGCAGGG - Intronic
1023874975 7:44281958-44281980 GGACCAGCCCAGGATGAGCTGGG - Intronic
1024783242 7:52876122-52876144 GGGGAAGGAAAGGATGAGCTTGG - Intergenic
1027138589 7:75640896-75640918 GGGCAAGCCCAGCAGGTCCTGGG - Intronic
1029655650 7:101922726-101922748 GGGCAGGGACAGGGTGTGCCTGG + Intronic
1030641239 7:112009126-112009148 GGGCAAGGGCAGCATGTGCTGGG - Intronic
1031076269 7:117215791-117215813 GGGCAGGGGCAGTGTGTGCTGGG + Intronic
1032474485 7:132202850-132202872 GGGCAAGGACAAGGGGTGCTTGG + Intronic
1032809561 7:135397821-135397843 GGGCAAGGGGAGTATGTGGTAGG + Intronic
1033224276 7:139548343-139548365 TGGCAAAGCCAGGATTTGTTGGG + Intergenic
1034567409 7:151926460-151926482 GTGGAAGGTCAGGTTGTGCTGGG - Intergenic
1034644616 7:152633987-152634009 GGGCAAGGCAATGAAGGGCTCGG - Intergenic
1035359128 7:158298754-158298776 AGGCAACCCCAGGAGGTGCTTGG - Intronic
1036777753 8:11625267-11625289 GGGCAAAGCAAGGCTGGGCTGGG + Intergenic
1038347088 8:26742465-26742487 GGGCTAGGCAAGGATGTGGAGGG - Intergenic
1041804646 8:61836765-61836787 GGGCAAGGCTGGGCTGGGCTGGG + Intergenic
1041972002 8:63754116-63754138 GGGCAAGCCCAGGATGGAATTGG + Intergenic
1042176075 8:66037938-66037960 GTGCAAGGCCATGATCTGCTTGG + Intronic
1042297855 8:67242161-67242183 AGGCAAGGCCTAGCTGTGCTGGG + Intronic
1043163045 8:76870222-76870244 GGACAAGGTCAGGATGCTCTAGG - Intergenic
1044522097 8:93210583-93210605 GGAAAAGCCCAGGATATGCTGGG + Intergenic
1047521590 8:125599212-125599234 GGGCAGGGCCAGGCTGAGCAAGG + Intergenic
1049061119 8:140277025-140277047 GAGCAGGGCCAGGAGGAGCTGGG - Intronic
1049207932 8:141372026-141372048 GGGCCAGCCCAGGAGGTGCTGGG + Intergenic
1049526213 8:143128034-143128056 GGGCCAGGCCAGGAGGTCCGCGG - Intergenic
1049800201 8:144514139-144514161 GGCCAGGGCCGGGATGGGCTGGG - Intronic
1051909366 9:22135297-22135319 GGGCAAGACCAGGTTGTGGGGGG + Intergenic
1052988420 9:34504235-34504257 GGGACAGGCCAGGATGTGGTGGG - Intronic
1053692469 9:40593215-40593237 GGGCAAGGCCAGGATAGGGCAGG - Intergenic
1054272348 9:63044318-63044340 GGGCAAGGCCAGGATAGGGCAGG + Intergenic
1054303711 9:63394133-63394155 GGGCAAGGCCAGGATAGGGCAGG - Intergenic
1054402489 9:64720643-64720665 GGGCAAGGCCAGGATAGGGCAGG - Intergenic
1054436099 9:65204974-65204996 GGGCAAGGCCAGGATAGGGCAGG - Intergenic
1054494293 9:65816713-65816735 GGGCAAGGCCAGGATAGGGCAGG + Intergenic
1055669020 9:78581822-78581844 CAGCAAGACAAGGATGTGCTGGG + Intergenic
1055730095 9:79271991-79272013 GGGTATGGCCAGAATGTGATAGG - Intergenic
1055931394 9:81563187-81563209 GGGCAAGAGCTGGATTTGCTGGG - Intergenic
1056537978 9:87547663-87547685 TGGCAAGTCCAGAATTTGCTGGG + Intronic
1057172053 9:92968946-92968968 GGGCATGGCCAGGGTGCCCTGGG + Intronic
1058958146 9:109968285-109968307 GTGGAAGGCCTGGATCTGCTGGG + Intronic
1060072466 9:120562319-120562341 GGGCATGGCCAGGACATGCGAGG + Intronic
1060209764 9:121702359-121702381 GGGTCAGGCCAGGCAGTGCTTGG + Intronic
1060218538 9:121752582-121752604 GGGGAAGGACAGCATGTGCCTGG + Intronic
1060404259 9:123365447-123365469 GGGCAGGGCCATGATGCCCTAGG - Intronic
1060666868 9:125436922-125436944 GGGCAAAGGCAGGAGGAGCTCGG - Intergenic
1060722355 9:125987454-125987476 GGGCAAGGGCAGGCTGCTCTAGG + Intergenic
1060827164 9:126693872-126693894 GGCCTAGGCCAGGGTGAGCTGGG + Intronic
1061087345 9:128406867-128406889 AGGAAAGGCCTGGAGGTGCTAGG - Intergenic
1061258170 9:129464894-129464916 GGACCAGGCCAGGAGGGGCTTGG + Intergenic
1061329621 9:129884493-129884515 GAGCAGGGACAGGAAGTGCTCGG + Intergenic
1062102656 9:134736584-134736606 GGGCTGGGACAGAATGTGCTAGG - Intronic
1062288887 9:135785839-135785861 GGGCAAGGCCAGGATGTGCTGGG + Intronic
1062430593 9:136525368-136525390 GCGCAAGGCCAGGAGGTGACTGG - Intronic
1062450584 9:136614154-136614176 GGGCAAGGCGAGGCTGGGCCAGG + Intergenic
1062556478 9:137115245-137115267 GGGCAGGGCCGGGATGTGGCCGG + Intergenic
1186853301 X:13601555-13601577 GGGAAAACCCAGGATGGGCTGGG - Intronic
1187405032 X:18996422-18996444 GGCCAAGGACAGGATGTGGGAGG - Intronic
1189412360 X:40783941-40783963 GGGCCAGGCCAGGATCTGTGTGG - Intergenic
1192210978 X:69127525-69127547 GGGCAATGCCAGGAGGTGCATGG + Intergenic
1193386888 X:80883300-80883322 GGGCAAAGCCAGGTTGGGGTTGG - Intergenic
1199142698 X:144331827-144331849 GGGCAGGGCAGGGAAGTGCTGGG - Intergenic
1199721896 X:150548062-150548084 GAGCAAGGCCAGGTCGTGCCAGG - Intergenic
1201190695 Y:11439945-11439967 GGTCAGGGCCAGGATGTGGTCGG + Intergenic