ID: 1062290421

View in Genome Browser
Species Human (GRCh38)
Location 9:135791915-135791937
Sequence CAGTGCCCACCTGGTGCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 259}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062290421_1062290429 6 Left 1062290421 9:135791915-135791937 CCCTGAGCACCAGGTGGGCACTG 0: 1
1: 0
2: 1
3: 25
4: 259
Right 1062290429 9:135791944-135791966 TGAGGCCACAGGCACCACAGTGG 0: 1
1: 0
2: 4
3: 30
4: 300
1062290421_1062290430 7 Left 1062290421 9:135791915-135791937 CCCTGAGCACCAGGTGGGCACTG 0: 1
1: 0
2: 1
3: 25
4: 259
Right 1062290430 9:135791945-135791967 GAGGCCACAGGCACCACAGTGGG 0: 1
1: 0
2: 5
3: 24
4: 253
1062290421_1062290428 -5 Left 1062290421 9:135791915-135791937 CCCTGAGCACCAGGTGGGCACTG 0: 1
1: 0
2: 1
3: 25
4: 259
Right 1062290428 9:135791933-135791955 CACTGGGGAGATGAGGCCACAGG 0: 1
1: 0
2: 0
3: 39
4: 388
1062290421_1062290434 22 Left 1062290421 9:135791915-135791937 CCCTGAGCACCAGGTGGGCACTG 0: 1
1: 0
2: 1
3: 25
4: 259
Right 1062290434 9:135791960-135791982 ACAGTGGGGCCGCTCAGCAGAGG 0: 1
1: 0
2: 1
3: 27
4: 199
1062290421_1062290435 23 Left 1062290421 9:135791915-135791937 CCCTGAGCACCAGGTGGGCACTG 0: 1
1: 0
2: 1
3: 25
4: 259
Right 1062290435 9:135791961-135791983 CAGTGGGGCCGCTCAGCAGAGGG 0: 1
1: 0
2: 4
3: 10
4: 241
1062290421_1062290431 8 Left 1062290421 9:135791915-135791937 CCCTGAGCACCAGGTGGGCACTG 0: 1
1: 0
2: 1
3: 25
4: 259
Right 1062290431 9:135791946-135791968 AGGCCACAGGCACCACAGTGGGG 0: 1
1: 1
2: 10
3: 28
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062290421 Original CRISPR CAGTGCCCACCTGGTGCTCA GGG (reversed) Intronic