ID: 1062290421

View in Genome Browser
Species Human (GRCh38)
Location 9:135791915-135791937
Sequence CAGTGCCCACCTGGTGCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 259}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062290421_1062290429 6 Left 1062290421 9:135791915-135791937 CCCTGAGCACCAGGTGGGCACTG 0: 1
1: 0
2: 1
3: 25
4: 259
Right 1062290429 9:135791944-135791966 TGAGGCCACAGGCACCACAGTGG 0: 1
1: 0
2: 4
3: 30
4: 300
1062290421_1062290431 8 Left 1062290421 9:135791915-135791937 CCCTGAGCACCAGGTGGGCACTG 0: 1
1: 0
2: 1
3: 25
4: 259
Right 1062290431 9:135791946-135791968 AGGCCACAGGCACCACAGTGGGG 0: 1
1: 1
2: 10
3: 28
4: 267
1062290421_1062290434 22 Left 1062290421 9:135791915-135791937 CCCTGAGCACCAGGTGGGCACTG 0: 1
1: 0
2: 1
3: 25
4: 259
Right 1062290434 9:135791960-135791982 ACAGTGGGGCCGCTCAGCAGAGG 0: 1
1: 0
2: 1
3: 27
4: 199
1062290421_1062290428 -5 Left 1062290421 9:135791915-135791937 CCCTGAGCACCAGGTGGGCACTG 0: 1
1: 0
2: 1
3: 25
4: 259
Right 1062290428 9:135791933-135791955 CACTGGGGAGATGAGGCCACAGG 0: 1
1: 0
2: 0
3: 39
4: 388
1062290421_1062290430 7 Left 1062290421 9:135791915-135791937 CCCTGAGCACCAGGTGGGCACTG 0: 1
1: 0
2: 1
3: 25
4: 259
Right 1062290430 9:135791945-135791967 GAGGCCACAGGCACCACAGTGGG 0: 1
1: 0
2: 5
3: 24
4: 253
1062290421_1062290435 23 Left 1062290421 9:135791915-135791937 CCCTGAGCACCAGGTGGGCACTG 0: 1
1: 0
2: 1
3: 25
4: 259
Right 1062290435 9:135791961-135791983 CAGTGGGGCCGCTCAGCAGAGGG 0: 1
1: 0
2: 4
3: 10
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062290421 Original CRISPR CAGTGCCCACCTGGTGCTCA GGG (reversed) Intronic
900095631 1:939002-939024 GAGTGCCCACCTGCATCTCAAGG - Intronic
900122360 1:1054277-1054299 CAGTGCCCTCCTTGGGGTCAAGG + Intronic
900440215 1:2651145-2651167 AAGTGCTCACCTGGTGCTGGAGG - Intronic
900641803 1:3691152-3691174 CTGTGCCCACCTGCTGGGCAGGG + Intronic
901266493 1:7914349-7914371 AGCTGCCCTCCTGGTGCTCACGG - Intergenic
901274751 1:7982436-7982458 CAGTGCCTTCCTGGTGCTGATGG + Intronic
902375767 1:16029307-16029329 CTGTGCACACCTGGGGGTCAGGG - Intronic
903104241 1:21061287-21061309 GAGTGCCAACATGATGCTCAAGG - Intronic
904300317 1:29549804-29549826 CCCTGCCCGCCTGGAGCTCATGG - Intergenic
904349184 1:29893879-29893901 CCATGGCCACATGGTGCTCATGG + Intergenic
904457918 1:30658311-30658333 CCCTGCCCGCCTGGAGCTCATGG + Intergenic
909082480 1:71129723-71129745 CAGTGCCAGGCTGGTCCTCACGG + Intergenic
911211320 1:95141400-95141422 CCGTGCCCACCTTCTGCTCTAGG + Intronic
911462315 1:98206280-98206302 CCGTGCCCACCTGGTATGCATGG - Intergenic
911858941 1:102921552-102921574 CAGGGGCCACCTGGTCCTCCAGG - Exonic
912433157 1:109640387-109640409 CAGTACCCAACTGGTCCACAGGG + Intergenic
915341054 1:155177054-155177076 CAGTGCCTACCAGGCCCTCAAGG + Exonic
915590429 1:156867305-156867327 AAGTGCCCACCAGGTACACATGG - Intronic
916695487 1:167231747-167231769 CAGTCCCCACCTTATGCTCCTGG - Intronic
918070733 1:181131814-181131836 CAGTGACCAGCTGGTGCTGAGGG + Intergenic
920747493 1:208642941-208642963 CAGAGCCCACCTGTGGCTCAGGG - Intergenic
920747504 1:208643000-208643022 CAGAGCCCACCTGTGGCTCAGGG - Intergenic
922540877 1:226418449-226418471 CAAAGCCCTCCTGGGGCTCAGGG + Intergenic
922773017 1:228198986-228199008 CTGTACCCACATGGTGCTCAAGG + Intergenic
922901172 1:229137873-229137895 CAGAGCCCACCTGCTAATCAGGG + Intergenic
923667515 1:236011947-236011969 CAGTGCAAACCTGGTTATCAGGG - Exonic
1062763527 10:45256-45278 CAGTTCCCACCTGGGTCTGAGGG - Intergenic
1063544431 10:6966615-6966637 CTGTGCCCACCTGGTTCTGCTGG - Intergenic
1063726760 10:8645565-8645587 CAGTGCATACATGGTGCCCAAGG + Intergenic
1064084798 10:12337293-12337315 CAGTGCTCAGCTGGGTCTCATGG + Intergenic
1064971631 10:21072629-21072651 CAGTCCCCACCAGCAGCTCAGGG + Intronic
1066635150 10:37492561-37492583 CAGTGCCCATCTGGGTCTCATGG + Intergenic
1067265017 10:44734277-44734299 GAGTGTCCACCTGGTGGTCAGGG - Intergenic
1067434411 10:46266776-46266798 CAGAGCCCAGCTGCTGCTCTGGG + Intergenic
1067507825 10:46871637-46871659 CCCTGCACAGCTGGTGCTCATGG + Intergenic
1067654426 10:48180208-48180230 CCCTGCACAGCTGGTGCTCATGG - Intronic
1067743025 10:48910870-48910892 CAGAGCCCACCTGGTGCCCAGGG - Intronic
1070219280 10:74423497-74423519 CAGAGTGCACCTGGTGCTCCAGG - Intronic
1074751935 10:116595199-116595221 CAGAGCCCACCTGGTGTTGTGGG - Intronic
1074821719 10:117184518-117184540 CAGTGCAGACCTGGTTCTCCAGG - Intergenic
1075385719 10:122053926-122053948 CAGTGGCCACCTGCTGGGCATGG + Intronic
1075444691 10:122505251-122505273 CAGTGCTCTCCTGGTCCTCTTGG + Intronic
1075701112 10:124470010-124470032 CAGGGCCCACTTGCTGCTCTAGG + Intronic
1075711992 10:124535872-124535894 CAGAGCAGAACTGGTGCTCAGGG - Intronic
1075717498 10:124565640-124565662 CAGTGGCCGCCTGGGGCGCACGG - Intronic
1076538457 10:131198359-131198381 CATTGCCCACCTGCTCCTGAGGG + Intronic
1076544065 10:131232088-131232110 CAGTCCCAGCCTTGTGCTCAGGG + Intronic
1076726880 10:132418095-132418117 CACAGCCCTCCTGGGGCTCAGGG - Intergenic
1076864190 10:133159364-133159386 CAGTGCCCACCTGGCTCCCGGGG + Intergenic
1076864846 10:133161486-133161508 CAGTCCCCACCTGCTGCCCCAGG + Intronic
1077220967 11:1416049-1416071 CAGGGCTCACCTGGTGCACGGGG + Intronic
1077420080 11:2445921-2445943 CAGAGTCCACCTGGGCCTCAGGG - Intronic
1081570938 11:44290393-44290415 CAGTGCATAGCTGGTGCTCCAGG - Intronic
1081587690 11:44398534-44398556 CAGTTCCCCCCTGCTGCTCCCGG - Intergenic
1081690175 11:45072695-45072717 CCCTCCCCACCTGGTGCTCTGGG - Intergenic
1083913866 11:65727400-65727422 CAGTGTCCAGCTGCTGCCCAAGG - Intergenic
1083934218 11:65862033-65862055 CAGTGCTCACCAGGTGCTCCCGG - Exonic
1084631677 11:70355881-70355903 CAGTTCCCACGCGGTGCTCCAGG + Intronic
1085350730 11:75796546-75796568 CAGTGCCCAGCAGGAGCACAGGG - Intronic
1086126205 11:83351172-83351194 CAGTGGCCCACAGGTGCTCAAGG + Intergenic
1088585894 11:111359997-111360019 CAGTGTCCACCTGCTGCTGAGGG + Intronic
1089170259 11:116506706-116506728 CAATGCCCTCCTTGTGTTCAGGG + Intergenic
1089979398 11:122759817-122759839 CAGTACCCATCTGTGGCTCAGGG + Intronic
1090764666 11:129866097-129866119 CAGTACCCACCAGGGTCTCAAGG + Intronic
1092397680 12:8142631-8142653 CAGGGCCCAGCAGGTGCTGAGGG + Intronic
1093309102 12:17556536-17556558 ATCTGCCCACCTGGAGCTCATGG + Intergenic
1096581191 12:52586449-52586471 CAGGGCCCATCTGGTGCTGCTGG + Intronic
1096651199 12:53062729-53062751 CAATGCCCCCTTGGTGCCCAGGG - Intronic
1099169452 12:79346448-79346470 CAGTTTCCACCTAGTGATCAAGG + Intronic
1100602373 12:96122856-96122878 CAGTGCCCACCTGCTGTTGGTGG - Intergenic
1100689414 12:97023886-97023908 CATTGCCCACCTGTGGCTCCAGG - Intergenic
1101878279 12:108609634-108609656 CACAGCCCAGCTGGGGCTCAAGG + Intergenic
1105596818 13:21846847-21846869 CAGTGCCTGCCTGCTGCTCTGGG + Intergenic
1106132749 13:26953193-26953215 CTGGGACCACCTGGTGCCCAGGG - Intergenic
1107204988 13:37773558-37773580 CAGTACCCACATGGTGCTGGAGG + Intronic
1108354957 13:49621736-49621758 CACTGCCCACGTTGTGCTCCAGG + Intergenic
1110760742 13:79227959-79227981 CAGTGCCCACTTGCTGGGCAAGG - Intergenic
1112064021 13:95772032-95772054 CAGAGACCACATGGTGCGCAGGG - Intronic
1113711343 13:112467289-112467311 CAATCCCCACCTGGGGCTCCTGG - Intergenic
1113885344 13:113655969-113655991 CTGAGCCCAGCTGGTGCTGAAGG - Intronic
1113944121 13:114034069-114034091 CACTGCCCGGCTGGTGTTCAGGG - Intronic
1113944136 13:114034130-114034152 CAGTGCCCGGCTGGTGTTCAGGG - Intronic
1116045616 14:39739773-39739795 CAGAGCTCAGCTGGTGCCCATGG + Intergenic
1117790065 14:59331245-59331267 AAGGGCCCTCCTGGTGCTCCAGG - Exonic
1120873645 14:89359904-89359926 CAGTTCCCACCATGAGCTCAAGG - Intronic
1120901345 14:89578465-89578487 CTGTACCCATCTGGAGCTCAGGG - Intronic
1125726018 15:41868487-41868509 CAGTGCCCACCAGTGGCTCCGGG - Exonic
1127924456 15:63525239-63525261 AAGTGGCCACCTGGGACTCAAGG - Intronic
1127935004 15:63628667-63628689 CATTCCTCACCTGGTGCTCTTGG + Exonic
1128786639 15:70402446-70402468 CAGTGCCCTCCAGGTCCTCAAGG - Intergenic
1129110134 15:73332364-73332386 CAGTGCCCACCAGCAGCTCCAGG - Intronic
1129779856 15:78263583-78263605 CAGCTCCCAACGGGTGCTCAGGG - Intergenic
1130919839 15:88334792-88334814 CAGTGGGCACCGGCTGCTCAGGG - Intergenic
1131258006 15:90874068-90874090 CAGGGCCCTGCTGCTGCTCAGGG + Intronic
1131806434 15:96127027-96127049 GAGTGCCAAGCTGGAGCTCAGGG - Intergenic
1132580532 16:682735-682757 CACGTCCCACCTCGTGCTCACGG - Exonic
1132846189 16:2001939-2001961 CAGATCCCACCTGGGGCTCGGGG - Intronic
1132862314 16:2077772-2077794 CACTGCCACCCAGGTGCTCACGG - Intronic
1133899254 16:9957898-9957920 CAGTGGCCAAGTGTTGCTCATGG - Intronic
1135622801 16:23970345-23970367 CAGAGCCCAGGTGGTGCTCTGGG - Intronic
1136990401 16:35148216-35148238 CTGTGCACACCTGGATCTCATGG - Intergenic
1137578722 16:49620884-49620906 CACTGCCCTCCTGGGGCACATGG - Intronic
1138207343 16:55134578-55134600 CAGCTCTCACCTGGGGCTCAGGG - Intergenic
1138345294 16:56316690-56316712 CACTCCCCAGCTGGTGCTGATGG + Intronic
1138420316 16:56894732-56894754 CAGTGCCCACCTGGGGGTGGTGG - Intronic
1138551495 16:57751328-57751350 CAATGCCCGCAAGGTGCTCATGG - Intronic
1141285524 16:82668245-82668267 CATTGCTCACCTTGTGATCAGGG - Intronic
1142033284 16:87848964-87848986 CAGGGCCCACCTGGGGGCCAAGG + Intronic
1142389411 16:89789054-89789076 CAGAATCCACCTGGTGCTCTTGG - Intronic
1143479443 17:7220081-7220103 CAGTGCCGGCCCGGTGCCCAGGG - Intronic
1144585453 17:16484994-16485016 CAGTGCCCACGTGGCTCTCCAGG - Intronic
1144858259 17:18282930-18282952 CACTGACCAGCTGGTTCTCAAGG - Intronic
1144875672 17:18395877-18395899 CTGGGACCACCTGGAGCTCAAGG + Intergenic
1145156554 17:20548544-20548566 CTGGGACCACCTGGAGCTCAAGG - Intergenic
1146011368 17:29197273-29197295 CACTGCCCACGTGGTGCTGCGGG - Intergenic
1146242671 17:31244541-31244563 CAGAGCTCAGCTGGTGCTCAAGG - Intronic
1146679674 17:34797977-34797999 CAAAGCCCACGTGGTGCACAAGG - Intergenic
1147261902 17:39213624-39213646 CAGTGTCCCCCAGGTGCCCAGGG - Intronic
1148237071 17:45976128-45976150 CTGTGCCCACATGGGGCCCACGG + Intronic
1152311950 17:79556886-79556908 CTGTGTCCAGCTGGTGCTCAGGG + Intergenic
1152572782 17:81127856-81127878 CAGTGCCCAGGTGGTGGTGAAGG - Exonic
1152588434 17:81199393-81199415 CACTGCCCACCAGGCCCTCAAGG - Exonic
1152956436 18:45587-45609 CAGTTCCCACCTGGGTCTGAGGG - Intergenic
1153535827 18:6100750-6100772 CACTCCCCACCTGGTGCCAATGG - Intronic
1154018973 18:10645803-10645825 CCATGCCCAGCTGGTGCTGAAGG + Intergenic
1154109486 18:11553556-11553578 CTTTGCCCACCTGCTCCTCACGG - Intergenic
1154185240 18:12177420-12177442 CCATGCCCAGCTGGTGCTGAAGG - Intergenic
1154410802 18:14141164-14141186 GAGGGCCCATCTGCTGCTCATGG - Intergenic
1157771946 18:50356742-50356764 ATCTGCCCACATGGTGCTCACGG + Intergenic
1158416476 18:57253424-57253446 CAGTACCAACCTGGTGGTCATGG - Intergenic
1160810936 19:1012679-1012701 CAGCACCCACCTGGGGCCCAGGG - Intronic
1161003403 19:1922559-1922581 CAGTGCCCACCGGGTGATGGTGG + Intronic
1161299363 19:3535402-3535424 CAGTCCCCACCTGGGCTTCACGG + Intronic
1162395251 19:10414464-10414486 GAGGGCCCACCAGGTGCTAAAGG + Intronic
1163007427 19:14405761-14405783 CAGTCCCACCCTGGTGATCAGGG - Exonic
1163373964 19:16918885-16918907 TAGTGCCAACCTCATGCTCAAGG - Intronic
1163631368 19:18419527-18419549 CCGTGCCCGCCTGGGGCTCGGGG + Exonic
1163632869 19:18426071-18426093 CTGCCCCCACCTGGTCCTCATGG - Intronic
1163950787 19:20583305-20583327 CTGTGCCCACCTGGAGTTCATGG + Intronic
1163967304 19:20758756-20758778 CTGTGCCCACCTGGAGTTCATGG - Intronic
1165907851 19:39204407-39204429 CAGCGTCCACCTTGTACTCAGGG - Intergenic
1166531090 19:43544006-43544028 CTGTGCCCACCTGCTGGGCATGG + Intronic
1167433089 19:49464411-49464433 CAGTGCCCACCTGGAGCCTGTGG - Exonic
1168169447 19:54576081-54576103 CAGTGACCCCCTGGAGCTCGTGG + Exonic
1168172229 19:54596463-54596485 CAGTGACTCCCTGGAGCTCATGG + Exonic
1168176948 19:54633290-54633312 CAGTGACCCCCTGGAGCTCGTGG + Exonic
1168187740 19:54710381-54710403 CAGTGACCCCCTGGAGCTCGTGG + Intergenic
925068607 2:950077-950099 CGGTGCCCTCCTGGGGCGCACGG - Intergenic
928194235 2:29203127-29203149 CAGTTCCCAGGTGGTGCTGATGG + Intronic
929887583 2:45892628-45892650 GAGTGCCCACCTGGTTTTAAAGG + Intronic
930094479 2:47556513-47556535 GAGTGTCCAGCTGGTACTCAGGG + Intronic
932923916 2:75948060-75948082 CAGCTCCCACCTAGTTCTCATGG - Intergenic
934064174 2:88324402-88324424 CTGTGGCCACCTGGAACTCAAGG + Intergenic
934779983 2:96963794-96963816 CAGAGACCACCTGGTCCTCAAGG + Intronic
935932133 2:108138814-108138836 GATTGCCCACCTGTTGCTCATGG - Intergenic
936389673 2:112059770-112059792 CAGAGCCCTCCTGATCCTCAGGG + Intronic
943523901 2:188992884-188992906 CAGGGCCCTCCTGGTCCTCCTGG + Exonic
947834436 2:233164967-233164989 CAGATCCAACCTGGTGCACAGGG - Intronic
948020955 2:234732842-234732864 CAGTGCCTACAGGGAGCTCATGG - Intergenic
948661587 2:239510231-239510253 CTGTGCCCACCTTCTGCTCCAGG + Intergenic
1168859297 20:1034457-1034479 CAGTTTCCACCTGGTTCTCCTGG + Intergenic
1169112967 20:3045237-3045259 CAGTCACCACCTGGTCCTCTTGG - Intronic
1171515719 20:25732310-25732332 CAATGCCCTCCAGGTTCTCATGG + Intergenic
1174906490 20:54557496-54557518 CAGTACCCATCTGCTGCCCAGGG + Intronic
1175309007 20:57998498-57998520 GAGTACCCAGCCGGTGCTCAAGG - Intergenic
1175404516 20:58717634-58717656 CTGTGCACACCTGGGGCTGAGGG + Intronic
1175642337 20:60641368-60641390 GAGTGCCCACTGTGTGCTCATGG + Intergenic
1175741909 20:61425490-61425512 CAGAGCCCACGTCCTGCTCAGGG - Intronic
1175949872 20:62577701-62577723 CAGGTGCCACCGGGTGCTCAGGG - Intergenic
1176083006 20:63283351-63283373 CGGTTCCCACTTGGTGGTCAGGG + Intronic
1176183776 20:63766970-63766992 CTGAGCCCACCTGCTGCTCTGGG + Intronic
1176411141 21:6450240-6450262 CTGGGCCCACCTGGAGGTCAGGG - Intergenic
1176425565 21:6546243-6546265 CAGAGCCACCCTGATGCTCAGGG - Intergenic
1176862256 21:14017255-14017277 GAGGGCCCATCTGCTGCTCATGG + Intergenic
1178908634 21:36656251-36656273 CAGTGAGCACCAGGTGCTGACGG - Intergenic
1179686634 21:43058562-43058584 CTGGGCCCACCTGGAGGTCAGGG - Intronic
1179701056 21:43154560-43154582 CAGAGCCACCCTGATGCTCAGGG - Intergenic
1179816961 21:43912414-43912436 CAGAGCACCCCTGGTGCCCACGG - Intronic
1181137502 22:20778914-20778936 AAGTTCCCACCAGGGGCTCATGG - Intronic
1182126982 22:27822973-27822995 CAGTGCTCTCCTGGTTCTGAGGG - Intergenic
1182164883 22:28163143-28163165 CAATGCCCAGCTGCTGCTCATGG + Exonic
1182909702 22:33971972-33971994 CAGCTCCCACCTGGTTTTCATGG - Intergenic
1184041433 22:41946484-41946506 CCGTGCCCACCAGCTGCGCAGGG + Exonic
1184456915 22:44616098-44616120 CAGATCCCTCCTGATGCTCAGGG - Intergenic
1184490045 22:44803231-44803253 CAGTGCCACCCAGGTGCGCATGG + Intronic
1184779402 22:46638968-46638990 GTGCGCTCACCTGGTGCTCAAGG + Intronic
1185227497 22:49661241-49661263 AGGTGCCCCCCTGGTACTCAGGG + Intergenic
1185254332 22:49823954-49823976 CAGTGCCCTCCCGGAGCCCAAGG - Exonic
949146131 3:701741-701763 CAGTCCCCACCTTGAGCCCAGGG - Intergenic
950514471 3:13455207-13455229 CAGTGTCCAGCTCCTGCTCAAGG - Intergenic
952871575 3:37905602-37905624 CAGTGCCCAGCTGTGGCACAAGG - Intronic
954659454 3:52219183-52219205 CAGAGCCCACGTGGGGCACAGGG + Intergenic
955384871 3:58471327-58471349 CAGTGCAACCCTGGTGCACAGGG + Intergenic
956857664 3:73291786-73291808 CATTGCCCACAGGGAGCTCAGGG - Intergenic
957712403 3:83878200-83878222 CATTGGCCATCTGTTGCTCATGG - Intergenic
958548369 3:95587142-95587164 CAGTGCCTTCCTGGAGCTCTCGG + Intergenic
960754993 3:121001573-121001595 CAGCTCCCACTTGGAGCTCATGG + Intronic
962317437 3:134367595-134367617 CAGTGCCCACCTGGCCCAGATGG - Exonic
962638908 3:137362233-137362255 CAGAACTCAGCTGGTGCTCATGG - Intergenic
962890314 3:139666295-139666317 CAGCTCCCACCTGGTCCTCCAGG + Intronic
964059817 3:152507593-152507615 CTGTGCCCACCTCTTGCACAAGG + Intergenic
967957522 3:194888736-194888758 CTGTGCCCTCCCAGTGCTCAGGG + Intergenic
967972992 3:195012857-195012879 CACTGCCCACCTTGTGTTAAAGG - Intergenic
968177442 3:196563306-196563328 CCGTGCCCGCCTGCTGGTCAAGG + Intronic
968666002 4:1822703-1822725 CAGTGCCCACCCTCTCCTCAGGG - Intronic
969608645 4:8215035-8215057 GTGTGCGCACCTGGTGCTCAGGG + Intronic
969973544 4:11073436-11073458 CTGTTTCCACCTGGGGCTCAAGG + Intergenic
978218487 4:106238968-106238990 CAGGTCCCACCAGGTTCTCAGGG + Intronic
982719643 4:158847019-158847041 CAGAGCTCAGCTGGTGCCCACGG + Intronic
986572587 5:9181046-9181068 CATTTCCTCCCTGGTGCTCAGGG + Intronic
988520897 5:31944833-31944855 CACAGCTCACCTGGTGCACATGG - Intronic
989408650 5:41091607-41091629 GAGTGCCAGCCTTGTGCTCAAGG + Intergenic
990907928 5:60823421-60823443 CCGTGCCTTCCTGGTGCTTATGG - Intronic
995508884 5:112888332-112888354 CAGAGCCAACATGGTGCTGATGG - Intronic
995631143 5:114134119-114134141 CACTTCCCACCTGGTGCTAGGGG + Intergenic
996607194 5:125337246-125337268 CAGTGCCCAGGCGGTGCTGAGGG - Intergenic
997379971 5:133428610-133428632 GTGTGACCACTTGGTGCTCAGGG - Intronic
997411510 5:133694603-133694625 CAGTACCCTCCTAGTGCTCTGGG + Intergenic
998499222 5:142617472-142617494 CAGAGCCCAGCAGGTCCTCAGGG + Intronic
999671589 5:153963491-153963513 TAGTGGCCACCTGGGGCTGAGGG + Intergenic
999705950 5:154272511-154272533 CACTGCCCACGTGGTGTTCCTGG - Intronic
1001982677 5:176047387-176047409 CAGTGTCCACTTGGTCCTGATGG + Intergenic
1002234786 5:177796670-177796692 CAGTGTCCACTTGGTCCTGATGG - Intergenic
1002496297 5:179614107-179614129 CTGTGCCCACCTGGGGCCTAGGG - Intergenic
1005670957 6:28105574-28105596 GAGACCACACCTGGTGCTCAGGG - Intergenic
1007075756 6:39065204-39065226 CAGTGCCAACCTTGTTCCCAGGG + Intronic
1007118379 6:39360630-39360652 CAGAGCTGCCCTGGTGCTCAGGG + Intronic
1007939669 6:45768248-45768270 CAGAGCAAATCTGGTGCTCAAGG + Intergenic
1008542612 6:52558274-52558296 CTGCTCCCACCTGGTGCTCCCGG - Intronic
1014252134 6:119126391-119126413 CAGTTCCCACCTGCTGCAAAGGG - Intronic
1016080387 6:139848063-139848085 AAGTTCCCACCTGGTTTTCAGGG + Intergenic
1018034136 6:159867072-159867094 CAGTGGGGACCTGGTCCTCAGGG - Intergenic
1019135993 6:169908001-169908023 GAGACCCCACCTGGTGCTCAGGG + Intergenic
1019160155 6:170063999-170064021 CAGTCCCCACTTGTGGCTCATGG - Intergenic
1019412977 7:914602-914624 AGGTGTCCATCTGGTGCTCAGGG - Intronic
1019443217 7:1057775-1057797 CAGCGCCCACCGGGAGCTCGGGG - Exonic
1019761301 7:2814830-2814852 CAGTGCACACCCGGTGCTGTCGG - Intronic
1020469176 7:8516515-8516537 CAGATATCACCTGGTGCTCAAGG + Intronic
1021111041 7:16694934-16694956 CAGTTCCTTCCTGGTGCCCAGGG - Exonic
1023891433 7:44394761-44394783 CCCTGCCCACATGGTGCTGATGG - Intronic
1023983393 7:45082155-45082177 CAGAGCCCAGCTGGCCCTCAAGG - Exonic
1026200142 7:68207304-68207326 CAGAGCCAGCCTGGTGGTCATGG + Intergenic
1026804033 7:73418408-73418430 CAGAGCCCACCACGTGCTCAGGG + Intergenic
1029176880 7:98670900-98670922 CAGTGCTCATCTGGAGATCATGG + Intergenic
1029207614 7:98878778-98878800 CAGAGCCCACCTGGGGCTGCGGG + Intronic
1029489174 7:100861128-100861150 CCTTGCCCAGCTGGTGCTCCTGG + Exonic
1032223051 7:130008729-130008751 CTGTGCCCCACTGGTCCTCAGGG - Intergenic
1032901920 7:136320328-136320350 CATTGTCCACCTGGTGCCTAAGG - Intergenic
1035663555 8:1364285-1364307 CTGTCCCCACCTGGAGCACAGGG - Intergenic
1036587469 8:10137684-10137706 CACTGCCCACTTTGTGCACAAGG - Intronic
1037755853 8:21709725-21709747 CAGTTCCCACCCAGTGCACAGGG + Intronic
1038486181 8:27936744-27936766 CAGTGGCCAGCTGATGGTCACGG + Intronic
1039759706 8:40561532-40561554 GAGGTCCCAGCTGGTGCTCAGGG + Intronic
1046530179 8:115435476-115435498 CAGTTCCCACGAGGTCCTCAGGG + Intronic
1046978838 8:120313974-120313996 CAGGGTCCACCTGGACCTCAAGG + Exonic
1049180131 8:141217955-141217977 CTCTGCCCACCTGCGGCTCACGG - Intronic
1049806869 8:144545053-144545075 CAGTGCCCAGGTGGGGCTCCAGG + Intronic
1051201860 9:14634429-14634451 CAATGCCACCCTGGTGCCCACGG + Intronic
1051492578 9:17683251-17683273 CAGACCTCACCTTGTGCTCATGG + Intronic
1053177804 9:35941460-35941482 CATTGCCCCCATGGAGCTCATGG - Intergenic
1054883108 9:70165752-70165774 CAGTGGCCACATGCAGCTCATGG - Intronic
1056621283 9:88216896-88216918 CAGGGCCCACCTTGGGCTCCTGG - Intergenic
1057079302 9:92160325-92160347 CTGCGCCCACCTGGAGGTCAGGG - Intergenic
1057396243 9:94682971-94682993 CAGTAGCCACCAGGTTCTCATGG - Intergenic
1057434293 9:95025150-95025172 CAGTGCTCACCTGCTGCACCTGG + Intronic
1059506568 9:114804566-114804588 CAGCGCCCAGTTGGTGCTCTGGG - Intronic
1060136385 9:121159294-121159316 CAGATCCCACCTGTTTCTCATGG + Intronic
1060405349 9:123370326-123370348 CACTGCCCACCTGGTACCCATGG + Exonic
1060733569 9:126052451-126052473 CAGGGCTCACCTGGTCCTCAAGG - Intergenic
1060753582 9:126191858-126191880 CAGTGACCTCCTGGGGCTCTTGG + Intergenic
1060934937 9:127509249-127509271 GGATGGCCACCTGGTGCTCATGG + Intronic
1061488675 9:130933551-130933573 CAGTGCCCACCCAGGGTTCACGG + Intronic
1061509014 9:131049134-131049156 CAGCCCCCACCTGGTGCTGGAGG - Intronic
1062036483 9:134384825-134384847 CAGTGCCCTCCTGTGGTTCAGGG + Intronic
1062290421 9:135791915-135791937 CAGTGCCCACCTGGTGCTCAGGG - Intronic
1062380509 9:136284599-136284621 CAGTGCCCTCCTGGTCCCCGCGG - Intronic
1062428986 9:136518561-136518583 CTGCGCCCACCTGGGCCTCAAGG + Intronic
1062741770 9:138179202-138179224 CAGTTCCCACCTGGGTCTGAGGG + Intergenic
1186476646 X:9862764-9862786 CACTGCCCACATGGTGATCCTGG - Intronic
1194095650 X:89636082-89636104 CAGAACTCAGCTGGTGCTCATGG + Intergenic
1195942866 X:110179774-110179796 CAGACCCCACCTGGCCCTCAAGG - Intronic
1196462180 X:115942775-115942797 CAGGTCCCACCAGGTGCTCTGGG + Intergenic
1197731189 X:129811396-129811418 CCTTGCCCCCCAGGTGCTCAGGG - Exonic
1199746010 X:150772318-150772340 CTGACCTCACCTGGTGCTCATGG - Intronic
1200236039 X:154468194-154468216 CGAGGCCCACCCGGTGCTCAAGG + Exonic
1200448649 Y:3297450-3297472 CAGAGCTCAGCTGGTGCTCATGG + Intergenic