ID: 1062290804

View in Genome Browser
Species Human (GRCh38)
Location 9:135793557-135793579
Sequence CACCTCACCACGTTCACTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 101}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062290802_1062290804 -3 Left 1062290802 9:135793537-135793559 CCCAGGTGGGGATGTGTGTGCAC 0: 1
1: 0
2: 2
3: 24
4: 247
Right 1062290804 9:135793557-135793579 CACCTCACCACGTTCACTTCAGG 0: 1
1: 0
2: 0
3: 7
4: 101
1062290801_1062290804 -2 Left 1062290801 9:135793536-135793558 CCCCAGGTGGGGATGTGTGTGCA 0: 1
1: 0
2: 1
3: 46
4: 286
Right 1062290804 9:135793557-135793579 CACCTCACCACGTTCACTTCAGG 0: 1
1: 0
2: 0
3: 7
4: 101
1062290796_1062290804 20 Left 1062290796 9:135793514-135793536 CCTACACTGGGGGTCAGGGCTGC 0: 1
1: 0
2: 3
3: 23
4: 246
Right 1062290804 9:135793557-135793579 CACCTCACCACGTTCACTTCAGG 0: 1
1: 0
2: 0
3: 7
4: 101
1062290794_1062290804 22 Left 1062290794 9:135793512-135793534 CCCCTACACTGGGGGTCAGGGCT 0: 1
1: 0
2: 9
3: 82
4: 318
Right 1062290804 9:135793557-135793579 CACCTCACCACGTTCACTTCAGG 0: 1
1: 0
2: 0
3: 7
4: 101
1062290803_1062290804 -4 Left 1062290803 9:135793538-135793560 CCAGGTGGGGATGTGTGTGCACC 0: 1
1: 0
2: 0
3: 30
4: 292
Right 1062290804 9:135793557-135793579 CACCTCACCACGTTCACTTCAGG 0: 1
1: 0
2: 0
3: 7
4: 101
1062290795_1062290804 21 Left 1062290795 9:135793513-135793535 CCCTACACTGGGGGTCAGGGCTG 0: 1
1: 0
2: 1
3: 19
4: 191
Right 1062290804 9:135793557-135793579 CACCTCACCACGTTCACTTCAGG 0: 1
1: 0
2: 0
3: 7
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062290804 Original CRISPR CACCTCACCACGTTCACTTC AGG Intergenic
903569122 1:24291400-24291422 CACCTCTCCAAGTCCAATTCAGG + Intergenic
904393744 1:30204186-30204208 CATCTCACCAATTTCAATTCGGG + Intergenic
905823226 1:41010354-41010376 GACCTCACCACTTTCATTCCTGG - Intronic
909898814 1:81108480-81108502 CACCTCACCAAGTTCATTCCTGG + Intergenic
910800415 1:91139232-91139254 CACCTCTGCTCGTTCCCTTCAGG + Intergenic
913597397 1:120392116-120392138 TACTTCTCCAAGTTCACTTCAGG + Intergenic
914308676 1:146447018-146447040 TACTTCTCCAAGTTCACTTCAGG + Intergenic
914512642 1:148347379-148347401 TACTTCTCCAAGTTCACTTCAGG - Intergenic
914593432 1:149126113-149126135 TACTTCTCCAAGTTCACTTCAGG - Intergenic
916449484 1:164906572-164906594 CACCTCTCCACTTTGTCTTCTGG + Intergenic
1062792817 10:320562-320584 CACATCATCACAGTCACTTCTGG - Intronic
1063014124 10:2057822-2057844 CCCTGCACCACGTTCACTGCTGG - Intergenic
1064049241 10:12045960-12045982 CACCTCAACACATTTACTTTTGG - Intergenic
1064644091 10:17443056-17443078 CAACACACCATGTTCACTTTGGG - Intronic
1070272671 10:74972307-74972329 GCCCTCACCACCTTCACTCCAGG + Intronic
1073969137 10:109026795-109026817 CACCTCACCTCGTTCTGTGCAGG - Intergenic
1074231235 10:111537930-111537952 TACCTCCCCACCTCCACTTCAGG - Intergenic
1079747946 11:24156144-24156166 CGCCTCACCATGTTCCCTTTTGG - Intergenic
1080571559 11:33561873-33561895 CAGCTTACCCCATTCACTTCTGG - Intronic
1080576316 11:33602974-33602996 CACCTTACCCCGTTCAGTTTGGG + Intronic
1083728207 11:64639485-64639507 CACCCCACCGTGTTCATTTCTGG - Intronic
1085759797 11:79232253-79232275 GTCCTCACCAGCTTCACTTCAGG - Intronic
1104969706 12:132525675-132525697 CACCTCACCGCGTCCGCATCGGG - Intronic
1107408675 13:40138756-40138778 CTCCTCTCAACGTTCACTTGAGG - Intergenic
1110171626 13:72507583-72507605 CTTCTCACCACGTTCTCTGCTGG + Intergenic
1114396048 14:22362868-22362890 TCCCTCACCAGGTTCACTCCTGG + Intergenic
1115954400 14:38762029-38762051 CACCTCCCCACTACCACTTCAGG + Intergenic
1119998537 14:79278762-79278784 CACCGCTCCACCTTCACTTTTGG + Intronic
1121780281 14:96617779-96617801 CAGCTCTCCAGTTTCACTTCCGG - Intergenic
1125195038 15:37036185-37036207 AAGCTAACCATGTTCACTTCTGG - Intronic
1127935754 15:63636066-63636088 GACCTCACCACTTTCAGTTAGGG + Exonic
1129510082 15:76115322-76115344 CATCTTCCCACGTTCACATCAGG - Intronic
1130386818 15:83419261-83419283 CACCTCTCCACGCCCACTGCAGG + Intergenic
1131130182 15:89894004-89894026 CGCCACAACACGATCACTTCCGG + Exonic
1139582704 16:67882814-67882836 CACCTCAGCACGAACACTGCCGG - Exonic
1141739395 16:85880693-85880715 CACCACACCATGCTCATTTCAGG - Intergenic
1142050492 16:87954922-87954944 CACCTCACCCCGTTGACTGTGGG - Intronic
1147361541 17:39933830-39933852 GACCTCACCACCCTCCCTTCAGG - Intergenic
1147486438 17:40819156-40819178 GACCTCACCCCGTTTAGTTCCGG - Exonic
1156759513 18:40570551-40570573 CACCTCCCCATTTTCATTTCAGG + Intergenic
1159088144 18:63818056-63818078 CCCCTCACTAGGTTCACTCCTGG + Intergenic
1160277058 18:77446696-77446718 CACCTCAAAGCGTTCATTTCAGG - Intergenic
1163755728 19:19105315-19105337 CACCCCACCAAGTTCTCTTGGGG - Intronic
1165510604 19:36264644-36264666 CATCTCACCAATTTCACTTCCGG - Intergenic
1166352100 19:42204095-42204117 CACCTCACCAGTCTCTCTTCTGG + Intronic
1167071327 19:47223657-47223679 CACCTAACCTCCTTCCCTTCAGG + Intronic
1167713185 19:51124757-51124779 CACCACCCCATGTTCACTCCTGG - Intergenic
926569127 2:14510163-14510185 CAGTTCACCACGTTCCCTTCCGG + Intergenic
926720335 2:15955472-15955494 CACCTCACCAGGTTCTCATAAGG + Intergenic
927105263 2:19818568-19818590 CTCCCCACCACCTTCATTTCTGG + Intergenic
931850134 2:66244463-66244485 CATCTCACCAATTTCAATTCCGG + Intergenic
932736186 2:74256324-74256346 CCCCTCTCCACCTTCACTTTTGG + Intronic
933876892 2:86629027-86629049 CAACTCATGACGTTCAGTTCTGG + Intronic
935763376 2:106342203-106342225 CACCTCACCACGGGCATCTCTGG - Intergenic
936500564 2:113062798-113062820 CACCTGACCACTTTGTCTTCTGG + Exonic
938091015 2:128434814-128434836 CCTCTCACCAAGTTCACTTGGGG - Intergenic
939262021 2:139822536-139822558 CATCTCACCATGTTCACTCTGGG - Intergenic
947415546 2:229891486-229891508 CACCTCACCACCTTAGCCTCCGG - Intronic
1176511250 21:7750165-7750187 CACCTCACCTTATTGACTTCCGG - Intronic
1177090026 21:16756218-16756240 CAGCACACAACGTCCACTTCTGG - Intergenic
1178436658 21:32565859-32565881 TCCCTCACCAGGTCCACTTCTGG + Intergenic
1178436783 21:32567126-32567148 CCCCTCACCAGGTCCACTCCTGG + Intergenic
1178645364 21:34380694-34380716 CACCTCACCTTATTGACTTCCGG - Intronic
1179149802 21:38800103-38800125 CACCTCAACACCATCACCTCGGG - Intergenic
1180002266 21:45000626-45000648 CATCTCTCCACATTCACTCCCGG - Intergenic
963893373 3:150660192-150660214 CACCTCCCCAGTTCCACTTCTGG - Intronic
967264811 3:187681114-187681136 CACTTCACCACCCTCCCTTCTGG + Intergenic
968831565 4:2934885-2934907 CATCTCTGCACGTTCTCTTCCGG + Intergenic
970087303 4:12364393-12364415 CACCTCACCAATTTCAAATCTGG + Intergenic
971187507 4:24394429-24394451 CACTTCACGACCTTCACTTGAGG + Intergenic
971877052 4:32320460-32320482 CACCTGACATCGTTCAGTTCTGG - Intergenic
972057029 4:34815672-34815694 CCCCTCACCAGGTCCACTTCTGG - Intergenic
975655252 4:76635044-76635066 CATCTCCCCCCGTTCTCTTCTGG - Intronic
981543623 4:145871943-145871965 CACCGCACCACCTCCACTTCTGG + Intronic
990478638 5:56186014-56186036 CACCCCTCCTCTTTCACTTCTGG - Intronic
1004793205 6:19051470-19051492 CTCCTCACCAGGTTCATTCCTGG - Intergenic
1006784168 6:36653770-36653792 CACCTGACCAAGGTCAGTTCAGG + Intergenic
1011629330 6:89309271-89309293 TACCTCACCACCTACACGTCTGG - Intronic
1014926587 6:127278159-127278181 CACCTCACCATGTCCACTACAGG - Intronic
1017352357 6:153457601-153457623 CCCCTCACCAGGTCCACTTCTGG + Intergenic
1017838714 6:158204267-158204289 CACCTCACCTGGCTAACTTCTGG - Intergenic
1018145017 6:160877602-160877624 CCCCTCACCAGGTGCACTCCTGG - Intergenic
1018429791 6:163713729-163713751 CCCCTCACCCTGTTCTCTTCAGG + Intergenic
1022572985 7:31471828-31471850 CACCTCACCAATTTCAAATCTGG - Intergenic
1023203501 7:37723468-37723490 TCCCTCACCATGTCCACTTCAGG - Intronic
1024390905 7:48811139-48811161 CACCTGACTCTGTTCACTTCAGG - Intergenic
1028754540 7:94420386-94420408 GACCTCACCACGTTCACCCTAGG - Exonic
1031372115 7:120981100-120981122 CACCTCACCACCTTCCTTTTGGG + Intergenic
1035458320 7:159023740-159023762 CACCTCACCACGCCCACCCCTGG + Intergenic
1041756406 8:61317646-61317668 CACTTCTCCACTTTCTCTTCTGG + Intronic
1044072206 8:87776331-87776353 CACCTCACTAAATGCACTTCTGG + Intergenic
1047164455 8:122421483-122421505 CTCCTCACCCTGTTCATTTCAGG + Intergenic
1047795024 8:128246601-128246623 CACCTCACAACATTCTCTTAAGG - Intergenic
1049849583 8:144823595-144823617 CACCTCCCCAGGCTCACTCCAGG - Intergenic
1051104433 9:13562994-13563016 CACCTCACCAGGTATGCTTCTGG + Intergenic
1051162957 9:14229686-14229708 CTCCTCTCCACCTTCCCTTCCGG + Intronic
1062290804 9:135793557-135793579 CACCTCACCACGTTCACTTCAGG + Intergenic
1203775034 EBV:68196-68218 TACGTCACCACGTATACTTCTGG + Intergenic
1187506759 X:19884874-19884896 CAACTAACCAGCTTCACTTCAGG + Intronic
1189307985 X:40001621-40001643 CAGCACACCAGGCTCACTTCTGG + Intergenic
1189491535 X:41474630-41474652 AACCTCACCACGTCCAGTCCAGG + Exonic
1189679516 X:43501140-43501162 CCCCTCTCCAGTTTCACTTCTGG + Intergenic
1193689352 X:84622060-84622082 ACCCTCACCAGGTCCACTTCTGG + Intergenic
1197355240 X:125431388-125431410 CTCCTCACTACCTTCACTTTTGG + Intergenic
1197834042 X:130675713-130675735 CCCCTCACCACTCTCCCTTCAGG - Intronic
1198277710 X:135112401-135112423 CTCCTCACCAAGTCCACTCCTGG + Intergenic
1199219978 X:145306532-145306554 CCCCTCACCAGGTCTACTTCTGG + Intergenic
1199369828 X:147034829-147034851 TGGCTCACCACGTTCACTCCTGG + Intergenic
1200886599 Y:8278138-8278160 CGCCCCACCACGTGCCCTTCGGG + Intergenic