ID: 1062292948

View in Genome Browser
Species Human (GRCh38)
Location 9:135805550-135805572
Sequence AGAGAGCAGCGGTGGGCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062292948_1062292956 3 Left 1062292948 9:135805550-135805572 CCACTGGCCCACCGCTGCTCTCT No data
Right 1062292956 9:135805576-135805598 CCGCACTGCAGAGCTCAGGGTGG No data
1062292948_1062292952 -1 Left 1062292948 9:135805550-135805572 CCACTGGCCCACCGCTGCTCTCT No data
Right 1062292952 9:135805572-135805594 TGACCCGCACTGCAGAGCTCAGG No data
1062292948_1062292953 0 Left 1062292948 9:135805550-135805572 CCACTGGCCCACCGCTGCTCTCT No data
Right 1062292953 9:135805573-135805595 GACCCGCACTGCAGAGCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062292948 Original CRISPR AGAGAGCAGCGGTGGGCCAG TGG (reversed) Intergenic
No off target data available for this crispr