ID: 1062293686

View in Genome Browser
Species Human (GRCh38)
Location 9:135811742-135811764
Sequence CTGCTGTAATTGTTTACAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 126}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062293686_1062293688 -10 Left 1062293686 9:135811742-135811764 CCTGTTGTAAACAATTACAGCAG 0: 1
1: 0
2: 1
3: 9
4: 126
Right 1062293688 9:135811755-135811777 ATTACAGCAGACCCCTGTACGGG 0: 1
1: 0
2: 0
3: 6
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062293686 Original CRISPR CTGCTGTAATTGTTTACAAC AGG (reversed) Intronic
907042887 1:51279397-51279419 GTGCTATAATTGTATACAACTGG + Intergenic
910312419 1:85839191-85839213 CTGCTGTTGTTGTTTGAAACAGG - Intronic
912049705 1:105511401-105511423 TTGCTGTCATTCTTTAAAACTGG - Intergenic
912248983 1:107991375-107991397 CTGGAGTAATTGTTTATAAAGGG + Intergenic
915657604 1:157374785-157374807 CTGCTCTACGTGTTTACATCTGG - Intergenic
915671475 1:157492203-157492225 CTGCTCTACGTGTTTACATCTGG + Intergenic
917552692 1:176051448-176051470 GTGCTGTACTTTTATACAACTGG - Intronic
918762538 1:188430536-188430558 CTGCTCTAATTACTGACAACAGG - Intergenic
919057404 1:192588304-192588326 CTGCTGTAAATGTTTGCTAATGG - Intergenic
920719554 1:208374566-208374588 TTTCTCTAATTGTTTAAAACAGG - Intergenic
1064668569 10:17684328-17684350 GTTTTCTAATTGTTTACAACGGG + Intronic
1064857915 10:19792238-19792260 CTGCTGTAATATATTACCACAGG - Intergenic
1068801016 10:61139701-61139723 CTGCAGGAATTGATTAAAACAGG + Intergenic
1070994552 10:80764755-80764777 CTGCTGAATATGTTGACAACTGG - Intergenic
1071854991 10:89615035-89615057 CTCCTGTAAATATTAACAACTGG - Intronic
1076435942 10:130441356-130441378 TTGTGGTAATTGTTTACAGCTGG + Intergenic
1076568891 10:131419143-131419165 GTTTTGTAATTGTTTATAACTGG + Intergenic
1076881501 10:133241709-133241731 TTGTTGTAAGTGTTTACAACTGG + Exonic
1078105107 11:8353523-8353545 CTGCTGAAATCGGTTAGAACAGG + Intergenic
1079640367 11:22797363-22797385 CTGCTGTAATTGTTTCCCTCTGG - Intronic
1081082488 11:38759408-38759430 CTGCTGTGACTGTATACAAGTGG - Intergenic
1082214060 11:49545660-49545682 CTACTGTAATTAATTACCACAGG + Intergenic
1085333197 11:75669448-75669470 CTGCTGGAATTGGTCAAAACCGG + Intergenic
1086635542 11:89078831-89078853 CTACTGTAATTAATTACCACAGG - Intergenic
1089463400 11:118666528-118666550 CTGCACTAATTGCTGACAACAGG + Intronic
1091108132 11:132942367-132942389 CTGCTGTCATAATTTACAATAGG + Intronic
1093815479 12:23540692-23540714 CTGCTGAAATTGTTAACATAAGG - Intronic
1095617751 12:44212690-44212712 CTACTGTAATTGATTATAGCTGG + Intronic
1099892286 12:88604764-88604786 CTTGTGCAATTGTTTAAAACTGG + Intergenic
1100350071 12:93772879-93772901 CTGCAGGAACTGTTTGCAACTGG + Intronic
1106016777 13:25876941-25876963 TTGCTGAAATTGTTTCGAACAGG + Intronic
1106080807 13:26498861-26498883 CTGCTGTTAATATTTACAGCTGG - Intergenic
1114371626 14:22095615-22095637 ATGCAGTAATTGTTTAGAATAGG + Intergenic
1114463873 14:22906573-22906595 GTGCTGTATTTTTATACAACTGG - Intronic
1117344143 14:54816396-54816418 ATGCTGTACTTTTATACAACTGG - Intergenic
1121208770 14:92190805-92190827 CTGCTCTAAATGTTTACAAATGG - Intergenic
1125378800 15:39064073-39064095 CTGCTCTACTTGTTTCCTACTGG - Intergenic
1125695752 15:41635918-41635940 CTGCTATATTTTTATACAACTGG - Intronic
1126177470 15:45750522-45750544 CAGCTTTTATTGGTTACAACAGG - Intergenic
1127896518 15:63304725-63304747 CTTTTGTAATTGTTTAAAAGAGG + Intronic
1129612883 15:77074406-77074428 CTGCTGTGAGAGTTTATAACAGG + Intronic
1129813761 15:78533567-78533589 TTGCTGTAAGTGTTTCCACCCGG - Exonic
1131338147 15:91570378-91570400 CTCCAGCAATTGTTTACAAATGG - Intergenic
1132270759 15:100522243-100522265 GTGCACTAATGGTTTACAACTGG - Intronic
1133484539 16:6206715-6206737 CTGATGTAAGAGGTTACAACAGG - Intronic
1137814020 16:51381128-51381150 ATGCTGTAATTGTATACTAGAGG - Intergenic
1140050119 16:71473172-71473194 CTGCTGTTATCATTTACTACAGG + Intronic
1150657625 17:67050705-67050727 CTGCTCTAATTCTTTGAAACTGG + Intronic
1151411855 17:73936062-73936084 TTGCTCTAATTGTTTTCAATAGG + Intergenic
1155495337 18:26436832-26436854 CTGCTGTGGTTGTTTCCCACTGG + Intergenic
1156661578 18:39352234-39352256 CTGCTCTAATTCTTTACAAAGGG + Intergenic
1157046040 18:44103032-44103054 CTTCTGTAATTGTTTCCTAATGG + Intergenic
1157728657 18:49985042-49985064 CTGCTGTATTTATGTAAAACTGG + Intronic
1158986904 18:62827058-62827080 GTGCTGTAATTTTCTACAAGTGG + Intronic
1161955567 19:7492822-7492844 CTGCTGTAACTTTAAACAACAGG - Intronic
925035896 2:685685-685707 CTGCTGTAAAGGTCTCCAACAGG - Intergenic
925788087 2:7452603-7452625 CTGCTGTTATTGTAGACCACAGG - Intergenic
930459932 2:51660518-51660540 CTGCTGTTGTTGTTTTCAAGAGG - Intergenic
935618828 2:105111563-105111585 CTGCTGTGATGGATTACCACAGG - Intergenic
937580127 2:123475087-123475109 CTGCTATACTTATATACAACTGG - Intergenic
937896231 2:126978536-126978558 CTTATGTAATTGTTTAAAGCAGG - Intergenic
940198479 2:151123197-151123219 TTGCTGTTCCTGTTTACAACTGG - Intergenic
940660328 2:156537281-156537303 ATGCTGTCAGTGATTACAACAGG + Intronic
942159258 2:173164991-173165013 CTGCTCTTATTGTTTCCAGCTGG - Intronic
942255010 2:174088053-174088075 CTTCTCTAATTGTATATAACTGG + Intronic
943614563 2:190078335-190078357 ATGTTCTAATTGTTTACAGCAGG + Intronic
947251712 2:228113740-228113762 TTGCTTTAATTGTTTACCAAAGG - Intronic
1172687708 20:36769189-36769211 ATGTAGTAATTGTTTACAAGTGG - Intronic
1184274235 22:43401094-43401116 CTGCTGTGATTGTTTATCAAGGG + Intergenic
949095946 3:85740-85762 CTGATGTAATTCTCTCCAACTGG + Intergenic
951010543 3:17673002-17673024 TTGCTGTGATTTTTTACACCTGG - Intronic
951159443 3:19399277-19399299 ATGCTTTATTTGTTTACAAGAGG + Intronic
956075808 3:65504070-65504092 CTGCTGTTTTTGTTTATTACTGG - Intronic
956224413 3:66939956-66939978 CTGCTGAAATTATTTACCATTGG + Intergenic
959349395 3:105242218-105242240 CTGTTGTAATTGGTTAAAACTGG - Intergenic
962521128 3:136198340-136198362 CTTCTGAAATTGGTTGCAACTGG + Intergenic
963623659 3:147644090-147644112 ATGAAGAAATTGTTTACAACTGG + Intergenic
964164948 3:153692056-153692078 CTGATGTTATTGTTGAGAACTGG - Intergenic
964849875 3:161083956-161083978 GTGCTGTACTTTTATACAACTGG + Exonic
964928892 3:161991446-161991468 CTGATGTAATTGCTTCCAATCGG - Intergenic
970111371 4:12641226-12641248 GTGTTGTGATTGTTTACACCTGG + Intergenic
970456687 4:16229615-16229637 CTGCTGAAATTATTTCCCACTGG - Intergenic
970939655 4:21616445-21616467 GTGTTGCAATTGTCTACAACAGG + Intronic
971244387 4:24914933-24914955 GTGCTGCAGTTGTATACAACAGG - Intronic
975590317 4:75993341-75993363 TTGCTGGAATTGTATACAAATGG + Intergenic
976695953 4:87919892-87919914 CTACTGTATTTGTTTCCTACGGG + Intergenic
977802374 4:101251566-101251588 GTCCTATAATTGTTAACAACAGG + Intronic
980424545 4:132609195-132609217 ATGATGTATTTGTTTTCAACTGG + Intergenic
981291084 4:143076173-143076195 CTTTTGTATTTGTTTACAGCTGG + Intergenic
982940208 4:161541238-161541260 TTACTGTAAATTTTTACAACAGG - Intronic
987987550 5:25167842-25167864 ATGCTATAATTTTATACAACTGG + Intergenic
988599530 5:32626774-32626796 CTGCTGTCACTCTTTACAGCAGG + Intergenic
989287489 5:39719612-39719634 CCGATATGATTGTTTACAACAGG + Intergenic
990590609 5:57259500-57259522 CTGCTATCATTGCTTACAAAAGG - Intronic
991049931 5:62261948-62261970 CAGCTGTAACTGTTTATAAATGG - Intergenic
992083225 5:73254665-73254687 CTGCTGCATTTCTTTACATCTGG - Intergenic
994542187 5:101113336-101113358 CTGCTGAAATGGTTTACTCCAGG + Intergenic
994740763 5:103615634-103615656 CTGCTGCAATAGTTCACCACAGG + Intergenic
999640912 5:153672380-153672402 ATGCTGAGATTGTCTACAACAGG + Intronic
1001153769 5:169255105-169255127 GTGCTGTACTTGCATACAACTGG - Intronic
1004949876 6:20657345-20657367 CTGCTGTAAATCTTTACATTTGG - Intronic
1006710707 6:36067475-36067497 GTGCTGTCACTGTTTATAACTGG + Intronic
1008951629 6:57166728-57166750 GTGCTGTACTTTTATACAACTGG + Intronic
1009309239 6:62128768-62128790 TCGTTGTAATTGTTTACATCTGG - Intronic
1011868213 6:91858866-91858888 CTGCTGGATTTGTTTACATCAGG + Intergenic
1016122100 6:140356688-140356710 CTGAACTAATTGTCTACAACAGG + Intergenic
1016215048 6:141589393-141589415 CCTTTGTAATTGTTAACAACAGG + Intergenic
1021675673 7:23078316-23078338 GTGCTGTAATTGATTGCAAATGG - Intergenic
1024401681 7:48930981-48931003 CTGCTATAATTTTATATAACTGG + Intergenic
1026419883 7:70223509-70223531 ATGCTGTACTTTTATACAACTGG - Intronic
1029871296 7:103695746-103695768 CTGCTGTCATTGTTCAACACTGG - Intronic
1031484836 7:122313447-122313469 CTGTTGAAATTGTACACAACTGG + Intergenic
1032334793 7:131015629-131015651 CTTATTTAATTGTGTACAACTGG + Intergenic
1034695693 7:153051342-153051364 CTGCTGTAACTAATTACTACAGG - Intergenic
1037439913 8:18904672-18904694 CAGCTGTAATTGTTTACTCAAGG + Intronic
1037938379 8:22930331-22930353 GTGCTCTAATTGTTTATAACAGG - Intronic
1038405472 8:27319338-27319360 CTGTTGTAACTTTTTAAAACGGG - Intronic
1038937422 8:32267635-32267657 CTGATGTAATTCTGTCCAACAGG - Intronic
1039985753 8:42446346-42446368 CTGCTGTCAATGGTGACAACAGG + Intronic
1040717745 8:50278341-50278363 CTGCAGAGATTGTTTTCAACTGG + Intronic
1041333013 8:56748785-56748807 CTGCTATACTTGTTTTCTACAGG + Intergenic
1043100996 8:76045547-76045569 AGTCTGCAATTGTTTACAACAGG + Intergenic
1049132392 8:140858758-140858780 CTTCTGTAATTGTTTGGCACAGG - Intronic
1052713805 9:32090300-32090322 GTGCTATAATTTTATACAACTGG - Intergenic
1055544227 9:77350359-77350381 CTGGTTTAATTGTTCACTACAGG + Intronic
1057331957 9:94123116-94123138 CTTCTGTATTAGTTTACTACGGG - Intergenic
1058357583 9:104101835-104101857 ATGCTATAATTGTTTAATACAGG + Intronic
1058667690 9:107335762-107335784 CTACTGTAATGGTTTCCAAGTGG + Intergenic
1060735171 9:126062135-126062157 CTGCTGGAATTGTGAACAACTGG + Intergenic
1061639554 9:131941546-131941568 CTGTTGTCGTTGTTTACCACTGG - Intronic
1062293686 9:135811742-135811764 CTGCTGTAATTGTTTACAACAGG - Intronic
1188565234 X:31519582-31519604 CTGATGTAATTGTTTACAATAGG + Intronic
1189954035 X:46260309-46260331 CTGTTTTAATTTTTTACAATAGG + Intergenic
1190425622 X:50332422-50332444 CTGCTGTCAGTGTATACATCAGG - Intronic
1194419309 X:93652675-93652697 GTGCTGTACTTTTCTACAACTGG - Intergenic
1197916908 X:131545293-131545315 CTTCTGTAACTGTTGACAGCAGG + Intergenic
1198015892 X:132610612-132610634 CTGGTGTACTTTTTTCCAACAGG - Intergenic