ID: 1062295454

View in Genome Browser
Species Human (GRCh38)
Location 9:135822921-135822943
Sequence CAGCTGTCCTTGGGGAGACC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 280}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062295446_1062295454 14 Left 1062295446 9:135822884-135822906 CCAAGAAAAAACTGTCAGGCTTA 0: 1
1: 0
2: 1
3: 16
4: 221
Right 1062295454 9:135822921-135822943 CAGCTGTCCTTGGGGAGACCGGG 0: 1
1: 0
2: 1
3: 28
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062295454 Original CRISPR CAGCTGTCCTTGGGGAGACC GGG Exonic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
901171404 1:7260597-7260619 CATGTGTCCTTGTTGAGACCAGG + Intronic
901238766 1:7681033-7681055 CAGCCATCCTGGGAGAGACCGGG + Intronic
901917021 1:12507747-12507769 CAGCTGACCTTGAGGAGCCGGGG + Intronic
902530969 1:17090431-17090453 CCCCTGGCCTTGGGGAGAGCTGG + Intronic
902824331 1:18962630-18962652 CAGCAGCCCTGGGGGAGCCCTGG + Intergenic
903662195 1:24984942-24984964 CAGCTGTCCTGGTGGATTCCAGG + Intergenic
904285212 1:29449607-29449629 CAGCTGACCTGGGGGAGCCCCGG - Intergenic
904471484 1:30739304-30739326 CTGTTGTCCTTGAAGAGACCGGG - Intronic
905363518 1:37436218-37436240 CAGCTGAGCTTCGGGAGACCTGG + Intergenic
905785742 1:40755932-40755954 CAGCTGTAGTTGGGGATAACTGG + Intronic
906876187 1:49541639-49541661 CAGCGCTCCTTGGGGAGGCTGGG - Intronic
907387289 1:54134297-54134319 CTGCTGTCCCTGGGGTGGCCAGG - Intronic
910415100 1:86989285-86989307 GAGCTATCCTTGTGGAGTCCAGG - Intronic
912554722 1:110507936-110507958 TAGCTTTCCCGGGGGAGACCAGG + Intergenic
913142826 1:115958343-115958365 CAGCTGCTCTGTGGGAGACCAGG - Intergenic
913339812 1:117747449-117747471 CAGGGGTCCTTGGGGAGTGCTGG - Intergenic
914245332 1:145881566-145881588 CTGCTTTCCTGGGGGTGACCTGG - Intronic
914334244 1:146700542-146700564 CAGCTGTCCCTGGGTAGCTCAGG + Intergenic
914444165 1:147735671-147735693 CAGCTGTACTTGTGGTGACAGGG + Intergenic
914444794 1:147740712-147740734 CAGCCTTCCTTCAGGAGACCTGG + Intergenic
915086285 1:153391040-153391062 CAGCTGTCTTTCAGAAGACCTGG - Exonic
915248661 1:154573029-154573051 CAGCTGTCCTAGAGGAAACCTGG - Intronic
916925356 1:169513719-169513741 GTGCAGTCCTTAGGGAGACCAGG + Intergenic
917790758 1:178497275-178497297 CGGCTGGCCTTGGGGAGAGTGGG - Intergenic
918417031 1:184320748-184320770 CAGCTGTCCATGAGGAGAGCTGG + Intergenic
920825511 1:209421181-209421203 CAGCTGGCCCTGGGGAAGCCTGG + Intergenic
921541447 1:216421377-216421399 CAGCTCTTCTTGGGGAAACGAGG + Intronic
922028208 1:221773018-221773040 TAGATGTCCTGGGGGAGCCCAGG - Intergenic
923092444 1:230750717-230750739 CAGCTGTACTTGGGGAGGGTGGG + Intronic
1062770144 10:92558-92580 CAGCTGTGCCTGGGGGGACAAGG + Intergenic
1062906025 10:1180245-1180267 CAGCTATGCTTGGGGGGGCCGGG - Exonic
1063379468 10:5575313-5575335 CTGCTGTGCTGGGTGAGACCAGG - Intergenic
1064107511 10:12512515-12512537 CAGCTGCCCGTTGGGAGACTCGG + Intronic
1064643245 10:17435232-17435254 CAGAGGACCTTGGGGAGACCTGG - Intronic
1064967983 10:21034640-21034662 GAACTGTCCTTGGGGAGAGGAGG + Intronic
1065207999 10:23375286-23375308 CAGCTGTCCTTGGCCATTCCTGG - Intergenic
1067015798 10:42755556-42755578 CAGCTGAGCTTGGGGAGAATGGG - Intergenic
1067070285 10:43126101-43126123 CAGGGGTCCTTGGGGAAAGCTGG + Intronic
1067438959 10:46297539-46297561 CAACCGTCCTTGGGGTGGCCCGG - Intronic
1067529675 10:47061101-47061123 CCCCTGGCCTTGAGGAGACCAGG - Intergenic
1067557038 10:47279677-47279699 CAGCAGGCCTTGTGGAGTCCTGG + Intergenic
1067762015 10:49055545-49055567 CAGCTGACCTTGGGGAGAAGGGG - Intronic
1068572156 10:58642068-58642090 AAGCTGGCCTTGAAGAGACCTGG - Intronic
1068794987 10:61069656-61069678 CATGTGTCATGGGGGAGACCTGG - Intergenic
1069112642 10:64465752-64465774 CTCCTGTCCATGGAGAGACCAGG - Intergenic
1069724940 10:70571493-70571515 CTGCTGCCCTGGTGGAGACCCGG + Intergenic
1070276976 10:75016708-75016730 CAGCTCTCCCTGGAGAAACCTGG - Intronic
1070552733 10:77503619-77503641 CAGCTGTCCTTGTGCAGTCATGG + Intronic
1077172936 11:1176441-1176463 GAGCTGTCCCTGGGAGGACCTGG + Intronic
1077195321 11:1276968-1276990 CAGCATTCCTTGGGGAGCGCCGG + Exonic
1077416516 11:2426618-2426640 GAGCTGGTCTTGGGGAGCCCAGG - Intergenic
1077423674 11:2464600-2464622 GTCCTGTCCTTGGGGAGGCCTGG + Intronic
1077508515 11:2943181-2943203 CTGAGGTCCTGGGGGAGACCAGG + Intergenic
1078387600 11:10906565-10906587 CAGCTGTCACTGGGGAGAAATGG + Intergenic
1080970907 11:37275781-37275803 CACCTGTCACTGGAGAGACCAGG + Intergenic
1081136114 11:39442138-39442160 CAGCACTCCTTGGGGAGGCTTGG + Intergenic
1085528210 11:77176157-77176179 CAGCTGTCCTTGGAGTGCCCAGG - Intronic
1088059419 11:105628431-105628453 CATGTGTCGTTGGAGAGACCCGG + Intronic
1088359389 11:108975099-108975121 CTGGTGTCATTGGGGAGACGTGG + Intergenic
1088890505 11:114040671-114040693 CTGAGTTCCTTGGGGAGACCAGG + Intergenic
1089109780 11:116046242-116046264 CAGCTCGCCTTGGGGAGACGTGG + Intergenic
1090644661 11:128758007-128758029 AAGCTGTCCTGGGGCAGCCCTGG + Intronic
1091001912 11:131916907-131916929 CAGCTGTCCATGGGAAGATCAGG - Intronic
1091132683 11:133159746-133159768 CAGCTGGGCTTTGGGAGACAGGG - Intronic
1092477638 12:8832516-8832538 AAGCTGTCCTTGTGGATTCCTGG - Intronic
1096524765 12:52203876-52203898 CAGCTGACCTTGGGGAGCGAGGG + Intergenic
1099801269 12:87460045-87460067 CAGGTGTCAAGGGGGAGACCAGG - Intergenic
1101436971 12:104672246-104672268 GAGCTGACCTTGGGGAGAGAGGG - Intronic
1101947593 12:109149803-109149825 CCTCTGTCCTTAGGGAGACCAGG + Intronic
1102223984 12:111215098-111215120 CAGTTGGCTTTGGGGAGATCTGG - Intronic
1102261965 12:111448327-111448349 CAGCTGCCCTTGAGGAGCACAGG + Exonic
1102627536 12:114247420-114247442 CAGCTGTCCATGGGGGGAGAAGG + Intergenic
1104253334 12:127117425-127117447 CAGTTGTCACTGGGAAGACCAGG + Intergenic
1105416835 13:20220734-20220756 CAGCAGTCCTGGGGGAGAGGTGG + Intergenic
1105899102 13:24741344-24741366 CAGTTGTCCTCTGGGAGACGGGG + Intergenic
1106135237 13:26968623-26968645 CTGCAGTCCTTGGGGACTCCTGG - Intergenic
1106566051 13:30885651-30885673 TAAATGTCCTTGTGGAGACCAGG - Intergenic
1106647403 13:31651200-31651222 CAGCAGTCATTCAGGAGACCAGG - Intergenic
1109359649 13:61279581-61279603 CAGCTGTCCTTGGTCATTCCTGG + Intergenic
1111002572 13:82205167-82205189 CAGCTGTGCTTGGGAAGGCAGGG - Intergenic
1112226550 13:97545592-97545614 CGGCGCTCCTTGGGGAGGCCCGG - Intergenic
1112374700 13:98828154-98828176 CGAATGTCCTTGGGGAGAACTGG - Intronic
1113467693 13:110523931-110523953 TAGGTGCCCTTGGGGAGACACGG + Exonic
1113830448 13:113291410-113291432 CAGCAGTCCTGGTGGTGACCTGG + Intergenic
1114033214 14:18594499-18594521 TCGGTGTCCTTGGGGAGTCCTGG - Intergenic
1114066222 14:19061866-19061888 CATCTGTCCTGTGGGAGCCCGGG - Intergenic
1114078008 14:19173696-19173718 TCGGTGTCCTTGGGGAGTCCTGG - Intergenic
1114096046 14:19338158-19338180 CATCTGTCCTGTGGGAGCCCGGG + Intergenic
1114125727 14:19723266-19723288 TCGGTGTCCTTGGGGAGTCCTGG + Intronic
1115380180 14:32728022-32728044 CAGCTGTCCATGCGGAGTGCAGG - Intronic
1115770738 14:36662492-36662514 CAGCGTTCCTTCTGGAGACCCGG - Intronic
1116340532 14:43717395-43717417 CAGGTGTCCAGGGAGAGACCTGG - Intergenic
1117791678 14:59348577-59348599 CAGCTGACCTTAGGTAGACCTGG - Intronic
1118697668 14:68400343-68400365 CAGCTGCCTTTGGAGAGAGCTGG - Intronic
1119182388 14:72613844-72613866 CAGCTGTCCCCGGGGAGGCCTGG - Intergenic
1119323128 14:73743295-73743317 CAGCTGTATTTGGGGAGAATGGG - Intronic
1120128110 14:80771885-80771907 CAGCTATCCTTGGGTAGAAATGG - Intronic
1120229494 14:81827559-81827581 CAGCTGACCATGGGAAGACCTGG + Intergenic
1120861175 14:89256150-89256172 CAGGTGTCCTTGAGGGGACAGGG - Intronic
1122588355 14:102826807-102826829 CAGCTGTCCTTTGGCAGCCCTGG - Intronic
1123568968 15:21582565-21582587 TTGGTGTCCTTGGGGAGTCCTGG + Intergenic
1123605077 15:22017886-22017908 TTGGTGTCCTTGGGGAGTCCTGG + Intergenic
1125540506 15:40467275-40467297 CTGTTGTCCTTGTGGAGACTAGG + Exonic
1125676186 15:41503723-41503745 CAGGTGTCCATGGGGAGCACTGG - Exonic
1132293222 15:100717644-100717666 GAGTTGTCCATGGGGAAACCAGG + Intergenic
1202977322 15_KI270727v1_random:309655-309677 TTGGTGTCCTTGGGGAGTCCTGG + Intergenic
1132888783 16:2194333-2194355 CAGCTGTCCTTGAGGGGAAGAGG - Intronic
1132993460 16:2810127-2810149 CGGCTGTACTTTGGGAGGCCAGG - Intergenic
1133725012 16:8529305-8529327 CAGATGGCTTTGGGGAGTCCTGG - Intergenic
1133822343 16:9247778-9247800 CAGCTGTACTGGGTGGGACCAGG - Intergenic
1136622693 16:31440833-31440855 CAGCTCTCCTTTGGGAGTCAGGG + Intronic
1137453193 16:48596648-48596670 CAGCTGTCCTTGCTCAGTCCTGG + Intronic
1139047330 16:63077518-63077540 CAGCTTTGCTTGGTGAGTCCAGG - Intergenic
1139999374 16:71010690-71010712 CAGCTGTCCCTGGGTAGCTCAGG - Intronic
1140778662 16:78274133-78274155 AAGCAGTGTTTGGGGAGACCAGG - Intronic
1141357858 16:83365452-83365474 CAGCTGACCATGGGGTAACCAGG - Intronic
1141575942 16:84963692-84963714 CACCTCTCCTTGGGCAGAGCGGG - Intergenic
1141876306 16:86827082-86827104 GGGCTGGGCTTGGGGAGACCAGG - Intergenic
1141889199 16:86915314-86915336 CCGCTGTCCTAGGGAAGACGAGG + Intergenic
1142129788 16:88427419-88427441 CAGCTGTCCGAGGGGGGCCCTGG - Intergenic
1142497385 17:313522-313544 CAGCTGGCCCTGGGAAGATCTGG - Intronic
1144406678 17:14958716-14958738 CAGGTGGACTTTGGGAGACCAGG - Intergenic
1144489952 17:15700051-15700073 AAGCTGTCCCTGGGGGAACCGGG - Exonic
1144768161 17:17744198-17744220 CAGCTTGCCTGGGGGAGGCCAGG + Intronic
1144911009 17:18681908-18681930 AAGCTGTCCCTGGGGGAACCGGG + Intronic
1146727537 17:35168444-35168466 CTGCTGTCCTTGAGGAGACCAGG + Intronic
1147437666 17:40427468-40427490 GGGCTGTCCTTGGGGACACTGGG + Intergenic
1147923622 17:43933463-43933485 CAGCTGGCCTAGGAGAGGCCTGG - Intergenic
1150246960 17:63683387-63683409 CAGCTGTTCTAGGGGTGACTTGG + Intronic
1152822589 17:82444903-82444925 CAGCCAACCTTGGGGAGACCTGG - Intronic
1153361951 18:4207391-4207413 CAGGTGTCATGGGAGAGACCAGG - Intronic
1155429222 18:25738111-25738133 CAGCTGTCCCTGGGCAGATGAGG + Intergenic
1156381437 18:36565056-36565078 CAGTTGCCCTTGGGGAAAACTGG + Intronic
1157324254 18:46657497-46657519 CACCTGTCCCTGGGGTGGCCTGG - Intergenic
1159183935 18:64945666-64945688 CATGTGTCCTTGGAGGGACCTGG - Intergenic
1160280747 18:77487900-77487922 CAGCTTTGGTTGGGGAGACAGGG + Intergenic
1160867446 19:1262146-1262168 GAGCGGTGCTTGGGGAGACGCGG + Intronic
1161408533 19:4103415-4103437 CTGCTGTCCTGGGGGTGGCCTGG - Intronic
1161553255 19:4926309-4926331 CAGCTGGCTTTGGGGAGAGGTGG - Intronic
1161738113 19:6004161-6004183 CAGCCATCGTTGGGGAGCCCAGG + Intronic
1162140649 19:8583731-8583753 CTGTAGTCCTTGGGGAGACTTGG + Intronic
1163027408 19:14520284-14520306 CAGCTGCCCCTGGGCAGACAGGG + Intronic
1163208716 19:15824017-15824039 CAGCTCTCCTTGGTGGGTCCAGG + Intergenic
1164916052 19:32053138-32053160 CAGCCTCCCTTGGGAAGACCTGG - Intergenic
1165050769 19:33140035-33140057 TAGCTGTCCTTATGGACACCTGG + Intronic
1165460010 19:35938855-35938877 AAGCTGGCCATGGGGAGACGGGG - Intronic
1165833434 19:38740873-38740895 CTGTGGTCCTTGGGGTGACCAGG + Intronic
1167440806 19:49507746-49507768 TAGCTGTCCTGGGGGAGCCCAGG + Intronic
1167491988 19:49798404-49798426 CACCAGTCCTTGGGAAGGCCTGG + Intronic
1167623301 19:50570329-50570351 CATCTGGCCTGTGGGAGACCAGG - Intergenic
925873471 2:8291851-8291873 CATCTATCCTTGGTGAGAGCTGG + Intergenic
927508331 2:23628869-23628891 CAGCTGACCCTGGGGAGGGCGGG + Intronic
929564673 2:42976868-42976890 CAGCTGTCCTTAGGGAGTGCAGG - Intergenic
930728870 2:54709133-54709155 CAGCTGTCCCTGGGAAGGCGGGG - Intergenic
930769973 2:55120961-55120983 CAGCTGTCCTGGTGGCCACCAGG - Intergenic
931691354 2:64837270-64837292 GAGCTGGCCCTGGGGAGCCCTGG - Intergenic
932340494 2:70960214-70960236 CAGCTGTCCCTGGGCAGCTCAGG + Intronic
932588154 2:73045046-73045068 CATCTCTTCTTGGAGAGACCAGG + Intronic
933205517 2:79503060-79503082 CACTATTCCTTGGGGAGACCAGG + Intronic
933771165 2:85745059-85745081 CAGCTGTCCCTGGGGCATCCAGG + Intergenic
934149646 2:89134113-89134135 AAGCTGTCCTCAGGGAGAGCTGG - Intergenic
934217649 2:90047915-90047937 AAGCTGTCCTCAGGGAGAGCTGG + Intergenic
934559488 2:95305400-95305422 ATGCTGTCATTGGGGAAACCAGG - Intronic
936040012 2:109142523-109142545 CCGTTGTCCCTGGGGAGCCCAGG - Intronic
936433322 2:112482480-112482502 CGGCTGCCCTTCGGGAGACTGGG + Exonic
936492396 2:112983531-112983553 CAGCTGGCCTTGGGAAGATGTGG + Intronic
941063176 2:160871232-160871254 CAGCTGTCCTAGGGAACATCTGG - Intergenic
941508386 2:166375983-166376005 CAGCTGCCCTCGGGGAGGCGGGG - Exonic
948077153 2:235173899-235173921 TAGGTGTCCATGGGGAGGCCCGG + Intergenic
948788154 2:240363789-240363811 CTGCTGTCCTTGGGGAGATGTGG - Intergenic
1168895919 20:1323437-1323459 CAGCTGTCCCCTGGGAGAGCAGG + Intronic
1170324359 20:15139879-15139901 CAGCTGACCTTCTGGTGACCAGG + Intronic
1170605103 20:17869868-17869890 CACCTCACCTTGGGGAGACGAGG - Intergenic
1171150448 20:22822540-22822562 CAGGTGGGCTAGGGGAGACCAGG + Intergenic
1172171237 20:32934616-32934638 CAGCTGTCGTGGGAGGGACCTGG + Intronic
1172636175 20:36411482-36411504 AGGCTGTCCATGAGGAGACCGGG - Intronic
1174156947 20:48521752-48521774 CCGCTGGCCTTGGACAGACCAGG + Intergenic
1174575273 20:51532825-51532847 CAGCCGTCCTTGGGGGGCACAGG + Intronic
1175936930 20:62518251-62518273 CAGCTGTACTTGGGGAGCCATGG + Intergenic
1176239390 20:64068915-64068937 CAGCTGTCTGGGGGGAGACAAGG - Intronic
1178367664 21:32000828-32000850 TGGCTGACCTTGGTGAGACCTGG + Exonic
1178820643 21:35972009-35972031 CAGCTGTCCATGTGGTGACATGG - Intronic
1179710794 21:43211889-43211911 CAGCTGGCCTTGGGGAGCTGGGG + Intergenic
1179730681 21:43365674-43365696 GACCTGTCCTTGGGGTGAGCAGG + Intergenic
1179797531 21:43794084-43794106 CATCTGTCCTCAGTGAGACCCGG - Intronic
1179907978 21:44434032-44434054 CAGCTGTCCTGGGGCAGCCACGG + Intronic
1180457328 22:15521554-15521576 TCGGTGTCCTTGGGGAGTCCTGG - Intergenic
1180484700 22:15784457-15784479 CATCTGTCCTGTGGGAGCCCGGG - Intergenic
1181670059 22:24421765-24421787 CAGGTCTCCTTGGAAAGACCTGG + Intronic
1181749789 22:24981300-24981322 CAGCTCTCCTTGGGGGCACCAGG - Intronic
1182361613 22:29749706-29749728 CAGGTGTCCAGGGAGAGACCAGG + Intronic
1183619904 22:38966251-38966273 GAGCTTTCTGTGGGGAGACCCGG - Intronic
1184332089 22:43833601-43833623 CAGCTGTCCTCCGGGTGCCCTGG - Intronic
1184452463 22:44591256-44591278 TAGTTGACCTTGGGGAGATCTGG - Intergenic
1184858726 22:47161071-47161093 CAGCTGGCCCTGGGGACACCAGG + Intronic
1185068506 22:48643785-48643807 CAGCTGGCCCTGGGGTGGCCTGG + Intronic
1185385212 22:50528800-50528822 TACCTGTCCTTGGGGAAACAAGG + Intronic
1185404807 22:50641730-50641752 CTGCTGACCTTGTGGAGAGCAGG + Intergenic
950002785 3:9669850-9669872 CAGCTGTACTGGGTGAGATCTGG - Intronic
950990005 3:17424325-17424347 CAGCTGCCCTTGGGAAGAGGAGG + Intronic
951166893 3:19493339-19493361 CAGGTGTTCATGGGGAGAACTGG + Intronic
951242668 3:20305247-20305269 CAGCTGTTGTAGGAGAGACCTGG - Intergenic
952696195 3:36267494-36267516 CAGGTGTCCATGTGGAGACAAGG - Intergenic
953407412 3:42666304-42666326 CTGCTGTCCTGGGGGAGAGAAGG + Intergenic
953921617 3:46955791-46955813 CTGCTGTCCTTGGGGTGAGAAGG - Intronic
954273878 3:49529980-49530002 CTTCTGCCCTTGGAGAGACCAGG - Intronic
954637636 3:52079854-52079876 CTGCTGACCTTGGAGAAACCAGG + Intronic
954676541 3:52318815-52318837 TATCTGCCCTTGGGGCGACCAGG - Intronic
956663725 3:71622951-71622973 CAGCAGTCCTTGGAGCGACTTGG - Intergenic
958577460 3:95971141-95971163 CAACTGTCATTGGTTAGACCAGG - Intergenic
959904815 3:111699541-111699563 TAGCTGGCCTTGTGAAGACCAGG - Intronic
960478199 3:118157535-118157557 CATATGTCCTTGGAGGGACCTGG - Intergenic
960723380 3:120646325-120646347 TAGATGTCTTTGAGGAGACCAGG - Exonic
961388525 3:126538041-126538063 CAGCTCTCTTTGGGGAAGCCGGG - Intronic
962367187 3:134794453-134794475 CAGCTCAGCGTGGGGAGACCAGG - Intronic
962431446 3:135324210-135324232 CAACTGGCATTTGGGAGACCAGG - Intergenic
964747588 3:160026677-160026699 GATCTGACCTTGGAGAGACCAGG + Exonic
965319882 3:167240077-167240099 CAGGTGTCCTGGGAGGGACCTGG - Intergenic
966748503 3:183300627-183300649 CACCTGTCCTTGAGGAGAGTGGG + Intronic
966768635 3:183484524-183484546 CAGGTGTCATGGGAGAGACCTGG + Intergenic
967818114 3:193815921-193815943 CACCTGGCCTTGGGCAGACAAGG - Intergenic
968799656 4:2733613-2733635 AGGCTGTCCATGGGGAGAGCAGG - Intergenic
969467968 4:7368803-7368825 CAGGTGTCCTGGGAGAAACCCGG + Intronic
969584401 4:8083766-8083788 CAGCTGACATTGGGGGGTCCTGG - Intronic
973846526 4:54918361-54918383 CATCTGTCCTTTGGGAGGCAGGG - Intergenic
974441823 4:61928781-61928803 CAGAAGTCTTTGGGGAGACAGGG + Intronic
975890270 4:79019203-79019225 CAGCTGTCCTTGAGAAGTCAGGG + Intergenic
980706157 4:136498579-136498601 CAGATGTCCCTTGGGAGACTTGG + Intergenic
983928566 4:173429156-173429178 CAGCTGTCCCTGGGGAAATCAGG - Intergenic
984765090 4:183394247-183394269 CAGCTGCCCCTCGGTAGACCCGG - Intergenic
985732379 5:1556526-1556548 CTGCTGGCCCTGGGGAGGCCAGG - Intergenic
986887694 5:12260350-12260372 AAGCTGTCCTTGCTGAGACTTGG - Intergenic
987303310 5:16616593-16616615 CAGGTGACCTTGGGGCGCCCGGG - Intronic
987883577 5:23782355-23782377 CACGTGTCATTGGAGAGACCTGG + Intergenic
989144595 5:38235913-38235935 CACGTGTCATTGGAGAGACCTGG + Intergenic
990056562 5:51587853-51587875 CTGCTGTCCTTGGGGAGTGATGG + Intergenic
990519683 5:56566861-56566883 CAGGTGTTCTTGGGAAGAGCAGG - Intronic
991726704 5:69542654-69542676 CAGGTGACCCTGGGAAGACCAGG - Intronic
991868253 5:71085220-71085242 CAGGTGACCCTGGGAAGACCAGG + Intergenic
995285382 5:110383050-110383072 CAGATGTTGGTGGGGAGACCTGG + Intronic
998487444 5:142515341-142515363 CAGGTGTCCTTGGACTGACCCGG - Intergenic
999153442 5:149441873-149441895 CAGCTGTTGTTTGGGAGCCCCGG + Intergenic
999673579 5:153977817-153977839 CAGCTGTGCTTGTGGAGTTCAGG - Intergenic
999718919 5:154384147-154384169 CAGGTGTCATAGGAGAGACCTGG - Intronic
1000772778 5:165377971-165377993 TAGCTGTCCTTGGGGCGAAGGGG - Intergenic
1001230562 5:169983789-169983811 CAACTCTCCCTGGAGAGACCAGG + Intronic
1002045428 5:176538875-176538897 CAATTGTCCTTAGGGAGAACTGG + Intergenic
1002164276 5:177334957-177334979 CAGCTGTGCCTGAGGAGACTGGG + Intronic
1003078119 6:3000019-3000041 GAGCGGTCCTTGGGGAGACGCGG + Exonic
1003368942 6:5506139-5506161 CAGCTGTCCCAGTGGAGAGCAGG + Intronic
1005856013 6:29863911-29863933 GCCCTGACCTTGGGGAGACCTGG + Intergenic
1006088716 6:31615435-31615457 CAGCTGGCCTAGGGTAGCCCGGG + Intronic
1006364957 6:33609916-33609938 CAGCGGTCCTTGGAGATAACAGG - Intergenic
1006787323 6:36677300-36677322 CAGCTGACCTCGGGGAGGACAGG - Intronic
1007939044 6:45759543-45759565 TAGCAGTCCTTGGGGACATCAGG - Intergenic
1008534711 6:52499032-52499054 CAGCTTTCACTGGGGAGAACTGG + Exonic
1008686400 6:53930310-53930332 CAGCAGTCCTTGGGAAACCCAGG + Intronic
1010900411 6:81421650-81421672 CACATGTCCTTGGAGGGACCTGG + Intergenic
1010916779 6:81628820-81628842 CAGAGGTCCTTGGGGAGGGCTGG + Intronic
1014268699 6:119312111-119312133 CTGCTGTTCTTGGGGACACAAGG + Intronic
1017520518 6:155197830-155197852 CACCTGTCCTGGGAGGGACCCGG - Intronic
1017958300 6:159198562-159198584 CAGCTGGACTTGGGGAGCCAAGG - Intronic
1018514470 6:164563185-164563207 CACATGTCCTTGGGGAGGCCTGG + Intergenic
1018991154 6:168675372-168675394 GAGCTGTCTGTGGGGACACCAGG - Intergenic
1019620725 7:1990647-1990669 CAGCTGTGCTTGGAGGAACCGGG + Intronic
1021530506 7:21639389-21639411 CAGCTTTCCTAGGGGAGAAAGGG + Intronic
1023612603 7:41986428-41986450 CAGCTTTCCTTGGGGAGGTCTGG - Intronic
1023860551 7:44215611-44215633 CAGCCTTCCTGGGGGAGGCCTGG + Intergenic
1024384888 7:48739536-48739558 CAGATGTCCTGGGAGGGACCTGG + Intergenic
1024385096 7:48741902-48741924 CAGATGCCCTAGGGAAGACCTGG + Intergenic
1025025736 7:55514898-55514920 CAGCTGTCCTTGTAGTGAGCTGG + Intronic
1025210913 7:57019263-57019285 CAGCTGTCCTTGGGGGGCTGGGG - Intergenic
1025661042 7:63557584-63557606 CAGCTGTCCTTGGGGGGCTGGGG + Intergenic
1029105041 7:98167992-98168014 CAGCTGTGCTTGGGGAGAAGTGG + Intronic
1029449522 7:100633115-100633137 CAGCTCTCCCTGGGGACACGAGG + Exonic
1032449806 7:132020227-132020249 CAGCTGTTCATGTTGAGACCAGG - Intergenic
1035233839 7:157483933-157483955 CAGCTGTCCTTGGGGTCTCGGGG + Intergenic
1037765974 8:21772525-21772547 CAGCTGTGTCTGGGGAGACTTGG - Intronic
1038343710 8:26712247-26712269 CAGCACTTCTTGGGGAGAGCAGG - Intergenic
1039587369 8:38718537-38718559 CTTCTGCCCTTGGGGAGACATGG - Intergenic
1044969670 8:97606753-97606775 AAGGTGTCCTTGGGGACAGCTGG + Intergenic
1045485404 8:102627529-102627551 CAGCTGTCCTGGAGGAAAGCGGG + Intergenic
1047305044 8:123645808-123645830 CAGCTGTCCCTGGGATGTCCAGG + Exonic
1047778696 8:128094113-128094135 CAGCTGTCATTTAGGTGACCTGG - Intergenic
1049075908 8:140396039-140396061 CAGAGGCCCTTGGGGAGCCCAGG - Intronic
1049473397 8:142786129-142786151 GGGCTGTGCTGGGGGAGACCTGG + Intronic
1050482121 9:6097954-6097976 AAGCTGTCCTTGGTCATACCTGG - Intergenic
1051162475 9:14223841-14223863 CCGTTGCCCTTGAGGAGACCAGG - Intronic
1052738646 9:32372159-32372181 CAACTGTCCCAGGGGAGAACAGG + Intergenic
1056497897 9:87178123-87178145 CACCTGTCTTTGAGGAGACAAGG + Intergenic
1056986027 9:91364342-91364364 CAGCTGCCCTCGGGGAGGGCAGG - Intergenic
1060186808 9:121568601-121568623 ATGCGGTCCTTGGGGAGGCCAGG + Intronic
1060979509 9:127784590-127784612 AGGCTGTCCTTGGGCAGAGCTGG + Intergenic
1061806365 9:133139718-133139740 CCGCTGCCCTTGGGGAGCCAGGG - Intronic
1062050261 9:134443440-134443462 CATCTGTCCTTGGGGACACTCGG - Intergenic
1062295454 9:135822921-135822943 CAGCTGTCCTTGGGGAGACCGGG + Exonic
1062654113 9:137593356-137593378 CAGGGGCCCTAGGGGAGACCCGG + Intergenic
1186018691 X:5228694-5228716 CACATGTCCTGGGAGAGACCTGG - Intergenic
1186122045 X:6373717-6373739 CAGGTGTCCAGGGAGAGACCCGG - Intergenic
1187003270 X:15204533-15204555 CAACAGTCCTTGGTGACACCAGG - Intergenic
1188911618 X:35854796-35854818 CAGCTGTCCTTGGTGATTCCTGG - Intergenic
1190385243 X:49878472-49878494 CAGCTGGCCTTGGAGAGAAGAGG + Intergenic
1191249588 X:58254045-58254067 CGGGTTTCCTTGGGAAGACCCGG + Intergenic
1192418083 X:71002470-71002492 CATATGTCCTGGGAGAGACCAGG + Intergenic
1194447323 X:94004652-94004674 CAGGTGTCATGGGAGAGACCAGG + Intergenic
1200969219 Y:9132370-9132392 CAGTTGTAGTTGTGGAGACCTGG - Intergenic
1201514383 Y:14802198-14802220 CACCTGTGCTTGGAGATACCTGG + Intronic
1202141606 Y:21730126-21730148 CAGTTGTAGTTGTGGAGACCTGG + Intergenic
1202145259 Y:21773676-21773698 CAGTTGTAGTTGTGGAGACCTGG - Intergenic