ID: 1062297614

View in Genome Browser
Species Human (GRCh38)
Location 9:135841173-135841195
Sequence TACTCAAGCCTCAGTAATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4391
Summary {0: 377, 1: 1425, 2: 1153, 3: 673, 4: 763}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062297614_1062297622 29 Left 1062297614 9:135841173-135841195 CCACCATTACTGAGGCTTGAGTA 0: 377
1: 1425
2: 1153
3: 673
4: 763
Right 1062297622 9:135841225-135841247 AGCCGCCAGGAAGTTTAAACTGG No data
1062297614_1062297623 30 Left 1062297614 9:135841173-135841195 CCACCATTACTGAGGCTTGAGTA 0: 377
1: 1425
2: 1153
3: 673
4: 763
Right 1062297623 9:135841226-135841248 GCCGCCAGGAAGTTTAAACTGGG No data
1062297614_1062297621 16 Left 1062297614 9:135841173-135841195 CCACCATTACTGAGGCTTGAGTA 0: 377
1: 1425
2: 1153
3: 673
4: 763
Right 1062297621 9:135841212-135841234 ACAGTGTAAACAAAGCCGCCAGG 0: 32
1: 408
2: 637
3: 476
4: 364

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062297614 Original CRISPR TACTCAAGCCTCAGTAATGG TGG (reversed) Intronic
Too many off-targets to display for this crispr