ID: 1062297616

View in Genome Browser
Species Human (GRCh38)
Location 9:135841176-135841198
Sequence ACCTACTCAAGCCTCAGTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6221
Summary {0: 224, 1: 1946, 2: 1882, 3: 1130, 4: 1039}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062297616_1062297625 30 Left 1062297616 9:135841176-135841198 CCATTACTGAGGCTTGAGTAGGT 0: 224
1: 1946
2: 1882
3: 1130
4: 1039
Right 1062297625 9:135841229-135841251 GCCAGGAAGTTTAAACTGGGTGG No data
1062297616_1062297622 26 Left 1062297616 9:135841176-135841198 CCATTACTGAGGCTTGAGTAGGT 0: 224
1: 1946
2: 1882
3: 1130
4: 1039
Right 1062297622 9:135841225-135841247 AGCCGCCAGGAAGTTTAAACTGG No data
1062297616_1062297623 27 Left 1062297616 9:135841176-135841198 CCATTACTGAGGCTTGAGTAGGT 0: 224
1: 1946
2: 1882
3: 1130
4: 1039
Right 1062297623 9:135841226-135841248 GCCGCCAGGAAGTTTAAACTGGG No data
1062297616_1062297621 13 Left 1062297616 9:135841176-135841198 CCATTACTGAGGCTTGAGTAGGT 0: 224
1: 1946
2: 1882
3: 1130
4: 1039
Right 1062297621 9:135841212-135841234 ACAGTGTAAACAAAGCCGCCAGG 0: 32
1: 408
2: 637
3: 476
4: 364

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062297616 Original CRISPR ACCTACTCAAGCCTCAGTAA TGG (reversed) Intronic
Too many off-targets to display for this crispr