ID: 1062297619

View in Genome Browser
Species Human (GRCh38)
Location 9:135841207-135841229
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1615
Summary {0: 69, 1: 630, 2: 464, 3: 273, 4: 179}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062297619_1062297625 -1 Left 1062297619 9:135841207-135841229 CCCTCACAGTGTAAACAAAGCCG 0: 69
1: 630
2: 464
3: 273
4: 179
Right 1062297625 9:135841229-135841251 GCCAGGAAGTTTAAACTGGGTGG No data
1062297619_1062297622 -5 Left 1062297619 9:135841207-135841229 CCCTCACAGTGTAAACAAAGCCG 0: 69
1: 630
2: 464
3: 273
4: 179
Right 1062297622 9:135841225-135841247 AGCCGCCAGGAAGTTTAAACTGG No data
1062297619_1062297627 15 Left 1062297619 9:135841207-135841229 CCCTCACAGTGTAAACAAAGCCG 0: 69
1: 630
2: 464
3: 273
4: 179
Right 1062297627 9:135841245-135841267 TGGGTGGAGCCCTCCAGAGCTGG No data
1062297619_1062297623 -4 Left 1062297619 9:135841207-135841229 CCCTCACAGTGTAAACAAAGCCG 0: 69
1: 630
2: 464
3: 273
4: 179
Right 1062297623 9:135841226-135841248 GCCGCCAGGAAGTTTAAACTGGG No data
1062297619_1062297628 16 Left 1062297619 9:135841207-135841229 CCCTCACAGTGTAAACAAAGCCG 0: 69
1: 630
2: 464
3: 273
4: 179
Right 1062297628 9:135841246-135841268 GGGTGGAGCCCTCCAGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062297619 Original CRISPR CGGCTTTGTTTACACTGTGA GGG (reversed) Intronic
900039049 1:441590-441612 TGGCTTTGTTTACACTGTGGGGG - Intergenic
900060481 1:676566-676588 TGGCTTTGTTTACACTGTGGGGG - Intergenic
900783202 1:4631303-4631325 GGGCTTTGTTGAGACTGTGGCGG - Intergenic
902141570 1:14361216-14361238 CAGCTTTGTTTACACTGTGAGGG + Intergenic
903324034 1:22559474-22559496 AGGCTTGGTTCACTCTGTGAGGG - Intergenic
903566900 1:24274533-24274555 AGGCGTTGTTTACACTGTGAGGG + Intergenic
906557870 1:46728699-46728721 AGGCTTTGTTTACACTGTGAGGG - Intergenic
906586765 1:46985065-46985087 CTGCTTAGTTTACACTGTGAGGG - Intergenic
906739937 1:48173003-48173025 CCGCTTTCTTTATACTGTGAGGG + Intergenic
906753222 1:48285211-48285233 CAGCTTTGTTTACACTGTGAGGG + Intergenic
906843081 1:49160833-49160855 TGGCTTTATTTACACTGCAAGGG + Intronic
906890650 1:49709340-49709362 AGGCTGTGTTTATACTGTGAGGG + Intronic
906901114 1:49837339-49837361 CAGCTTTGTTTATACTGTGAGGG + Intronic
907015198 1:51005580-51005602 TGGCTTTGTTTACACTGTGAGGG - Intergenic
907565647 1:55430921-55430943 TGTCTTTGTTTACACTGTGAGGG - Intergenic
907600143 1:55760736-55760758 CGGCTTTGTTTACACCGTGAGGG - Intergenic
907953555 1:59206841-59206863 TGGCTTTGTTTACACTGTGCGGG - Intergenic
908584609 1:65554495-65554517 AGACCTTGTTTACACTGTGAGGG + Intronic
908601389 1:65743982-65744004 CAGCTTTGTTTACATTGTGAAGG + Intergenic
909415684 1:75403053-75403075 CAGCTTTGTTTACACTGTGAGGG - Intronic
909536410 1:76741420-76741442 CAGCTGTGTTTACACTGTGAGGG + Intergenic
909672418 1:78203764-78203786 CTGCTTTGTTTACACTGTGAGGG - Intergenic
909690126 1:78398009-78398031 CAGCTTTGTTCACACTGTGAGGG + Intronic
909874377 1:80783898-80783920 TGGCTTTATTTACATTGTGAAGG - Intergenic
910177215 1:84443427-84443449 TGGCTTTGTTTACACTGTGAGGG - Intergenic
910331015 1:86072367-86072389 CAGCTTTGTTTACACTGTGAGGG - Intronic
910805720 1:91188423-91188445 CAGCTTTGCTTACACTGTGAGGG + Intergenic
910827829 1:91428252-91428274 CAGCTTCCTTAACACTGTGAGGG + Intergenic
911270668 1:95797571-95797593 TGGCTTTGTTTACACTGTGTGGG - Intergenic
911632670 1:100200264-100200286 TGGCTTTATTTACACTGTGAGGG - Intronic
911692031 1:100845424-100845446 TGGCTTTATTTACACTGCGAGGG + Intergenic
911982763 1:104586733-104586755 TGGCTTTGTTTACACTGTGAAGG - Intergenic
912076713 1:105884470-105884492 CAGCTTTATTTATACTGTGAGGG + Intergenic
912150532 1:106853608-106853630 TGGCTTTGTTTACACTGTGAGGG - Intergenic
912235350 1:107844661-107844683 AGGCTTTGTTTATACTGTGAGGG - Intronic
912271026 1:108209228-108209250 GGGCTCTGTTTACACTGTGAGGG + Intergenic
912675811 1:111679762-111679784 AGGCTTTGTTTACATTGTGAGGG - Intronic
912894858 1:113575973-113575995 CGGCTTCCTTAACACTGTGAGGG + Intronic
912966259 1:114239934-114239956 TGGCTTTGTTTTCACTGTGAGGG - Intergenic
913036282 1:114969422-114969444 TGGCTTTGTTTACACTGTGAAGG + Intronic
913108645 1:115639255-115639277 TGGCTTTCTTTACACTGTCAGGG + Intergenic
913430089 1:118781061-118781083 TGGCTTTGTTTACACTGTGAGGG + Intergenic
913720365 1:121586936-121586958 TGGCTTTGTTTACACTGTGAGGG + Intergenic
914458067 1:147855205-147855227 CGGCTTTGTTTACACTGTGAGGG - Intergenic
914967116 1:152269932-152269954 CAGCTTTGTTTATACTGTGAGGG + Intergenic
914969251 1:152292185-152292207 CAGCTTTGTTTATACTGTGAGGG - Intergenic
915649094 1:157294583-157294605 CAGCTTTGTTTGCACTGTGACGG - Intergenic
915771759 1:158432815-158432837 TGGCTTTGTTTACACTGTGAGGG + Intergenic
915806577 1:158859576-158859598 AGGCTTTGTTTACTCTTTGCTGG - Intergenic
915992251 1:160529732-160529754 CAGCTTTGTTTACACTGTGAGGG + Intergenic
916359565 1:163952912-163952934 CAGCTTTGTTTACACTGTAGGGG - Intergenic
916362885 1:163990640-163990662 AGGCTTTGTTTACACTGTGAGGG - Intergenic
916379679 1:164195792-164195814 AGTCTTTGTTTACACTGTGAGGG - Intergenic
916406293 1:164500836-164500858 TGGCTTTGTTTACACTGTGAGGG - Intergenic
916545681 1:165801752-165801774 TGGCTTTGTTTACACTGTGAAGG - Intronic
916612786 1:166409690-166409712 TGGCTTTGTTTACACTGTGAGGG + Intergenic
916625585 1:166552202-166552224 TGGCTTTGTTTACACTGTGAGGG + Intergenic
916878709 1:168998354-168998376 AGGCGTTGTTTACACTGTGAGGG + Intergenic
916938563 1:169656622-169656644 CAACTTTGTTTACACTGTGAGGG - Intergenic
917009755 1:170457844-170457866 CAGCTTTGTTTACACTGTGAGGG + Intergenic
917023358 1:170614312-170614334 TGGCTTTGTTTACACTATTAGGG + Intergenic
917091747 1:171359893-171359915 TGGCTTTATTTACACTCTGAGGG - Intergenic
917157957 1:172025159-172025181 TGGCTTTGTTTACACTGTGAGGG - Intronic
917163131 1:172080407-172080429 CAGCTTTGCTTACACTGTGAGGG + Intronic
917357769 1:174144227-174144249 CAGTTTTGTTTATACTGTGAGGG - Intergenic
917401360 1:174653080-174653102 AGGCTTTGTTTACACTGTGAGGG + Intronic
917405979 1:174709029-174709051 AGGCTTTGTTTACACTGTGAGGG - Intronic
917584966 1:176416952-176416974 CAGCCTTGTTTACACTTTGAGGG + Intergenic
918163374 1:181921092-181921114 AGGCTTTGTTTATGCTGTGAGGG - Intergenic
918167228 1:181961709-181961731 CGGCTTTGTTTACACTGTGAGGG + Intergenic
918195670 1:182219135-182219157 CATCTTTGTTTAAACCGTGAGGG - Intergenic
918360387 1:183751345-183751367 TGGCTTTGTTTACACTGCGAGGG + Intronic
918501486 1:185201033-185201055 GGGCTTTGTTTACACTGTGAGGG + Intronic
918612827 1:186512199-186512221 TGGGTTTGTTTACACTGTGAGGG + Intergenic
918632074 1:186730382-186730404 CGGCTTTGTTTACGCTGTGGGGG + Intergenic
918684414 1:187397172-187397194 CGGGTTTATTTACACTGTGAGGG - Intergenic
918726434 1:187931282-187931304 CAGATTTGTTTACAAAGTGAAGG - Intergenic
919146764 1:193645178-193645200 AGGCTTTGTTTACACTGTGAGGG + Intergenic
919167312 1:193911942-193911964 CGGCTTTATGTCAACTGTGAGGG + Intergenic
919461651 1:197884301-197884323 CAGCTTTGTTTACACTGTGAGGG + Intergenic
919599008 1:199599825-199599847 AGGCTTTGTTTTCATTGTGAGGG - Intergenic
919601907 1:199633200-199633222 AGGCTTTGTTTACACTGTGAGGG - Intergenic
920041439 1:203100277-203100299 GGGCTTTGTCTCCACTGTGGGGG - Intronic
920304055 1:205007612-205007634 GGGCTTTGTTTAAGCTGGGAAGG + Intronic
920985603 1:210885751-210885773 CAGCTTTTTTTATACTGTGAGGG - Intronic
921296838 1:213712297-213712319 CAGCTTTGTTTACACTGTGAGGG + Intergenic
921401370 1:214727432-214727454 TGGCTTTGTTTACACTGTGAGGG + Intergenic
921461539 1:215432915-215432937 TGGCTTTGTTTACACTGTGAGGG + Intergenic
921484843 1:215703595-215703617 TGGCTTTGTTCACACTGTGAGGG + Intronic
921626196 1:217380023-217380045 CGGCTTTGTTTACACTGTGAGGG - Intergenic
921631359 1:217437591-217437613 CAGCTTTGTTTACACTGTGAGGG - Intronic
921943125 1:220863889-220863911 CGTCTTTGTTTACACTGTGAGGG + Intergenic
921962251 1:221047793-221047815 CAGTTTTGTTTACACTGTGAGGG - Intergenic
921976345 1:221207257-221207279 CGGCTTTGTTTACACTATGAGGG - Intergenic
922066222 1:222146131-222146153 CAGCTTTGTTTACACTGTGAGGG - Intergenic
922351334 1:224736849-224736871 CGGCTTTGTCCACACTCTGTAGG - Intronic
922380016 1:225013737-225013759 GGGCTTTGTTTACACTGTGAGGG + Intronic
922396809 1:225210368-225210390 TTCCTTTGTTTACACAGTGAGGG - Intronic
922406206 1:225316134-225316156 CAGCTTTGTTTACACTGTGAGGG + Intronic
922666555 1:227474255-227474277 CGGCTTTGTTTACACTGTGATGG - Intergenic
922691926 1:227699986-227700008 AGGCTTTGTTTACACTGTTAGGG - Intergenic
922716023 1:227872545-227872567 AGGCTTTGTTTACACTGTTAGGG - Intergenic
923421743 1:233822645-233822667 TGGCTTTGTTTACACTGTGAGGG - Intergenic
923690896 1:236192104-236192126 CGGCTTTGTTTACACTGTGAGGG + Intronic
923853445 1:237820880-237820902 TGGCTTTGTTTACATTGTGAGGG - Intronic
924179966 1:241430732-241430754 CAGCTTTGTTTACACTGTGAGGG + Intergenic
924243315 1:242059984-242060006 TGGCTGTTTTTACATTGTGAGGG - Intergenic
924254597 1:242169790-242169812 CTGCTTTGTTTACACCGTGAGGG - Intronic
924296033 1:242587307-242587329 CAGCTTTGTTTACACTGTGAGGG - Intergenic
924493988 1:244568625-244568647 CAGCTTTATTTCCACTGTGAGGG + Intronic
924828998 1:247572953-247572975 CGGCTTTGTTTACACTGTGAGGG + Intronic
1065075989 10:22080067-22080089 TGGCTTTGTTTACACTGTGAGGG + Intergenic
1065427434 10:25619869-25619891 AGGCTTTGTTCACACTGTGAAGG - Intergenic
1065651751 10:27899671-27899693 AGGCTTTGTTTACACTGTGAGGG - Intronic
1066159674 10:32714753-32714775 CAGCTTTGTTTACACTGTGAGGG - Intronic
1066257627 10:33696067-33696089 TGGTTTTGGTTACACTGTGAGGG + Intergenic
1066993477 10:42539489-42539511 CAGCTTTGTTTACACTGTGAGGG + Intergenic
1067209678 10:44249697-44249719 AAGCTCTGTTTACACTGTGAGGG + Intergenic
1067236364 10:44453979-44454001 CAGTGTTGTTTACACTGTGAGGG + Intergenic
1068086083 10:52375010-52375032 TGGCTTTGTTTACACTGTGAGGG + Intergenic
1068357094 10:55923293-55923315 GGGCTTTGTTTACACTGTGAGGG + Intergenic
1068469946 10:57448261-57448283 TGGTTTTGTTTATACTGTGAGGG + Intergenic
1068622971 10:59207472-59207494 TGGCTTTGTTTACACTGTGAGGG - Intronic
1069093462 10:64229731-64229753 CAGCTTTGTTTACACTGTGAGGG + Intergenic
1069264280 10:66438481-66438503 TGGCTTTGTTTACACTGTGAGGG + Intronic
1069348969 10:67502750-67502772 CAGCTTTGTTTACATTGTGAGGG + Intronic
1070234449 10:74609020-74609042 CATCTTTGTTTACACTGTTAGGG + Intronic
1070349271 10:75576226-75576248 TGGCTTTGTTTACACTGTGAGGG - Intronic
1070632494 10:78096728-78096750 GGTTTTTATTTACACTGTGAGGG - Intergenic
1071190066 10:83089550-83089572 TGGCTTTGTTTACATTGTGAGGG - Intergenic
1071272430 10:84020264-84020286 TGGCTTTGTTTACACTGTGATGG - Intergenic
1071401772 10:85280167-85280189 TGGCTTTGTTTACACTGTGAAGG + Intergenic
1071975843 10:90955084-90955106 CAGCTTTGTTTACACTGTGAGGG + Intergenic
1072044903 10:91644520-91644542 TAGCTTTGTTTACACTGTGAGGG - Intergenic
1072049653 10:91690680-91690702 CGGCTTTGTTGACACTGTGGAGG - Intergenic
1072358951 10:94640129-94640151 GAGCTTTGTTTGCACTATGAGGG + Intergenic
1072365345 10:94703516-94703538 AGGTTTTGTTTACACTGTGAGGG + Intronic
1072375674 10:94813564-94813586 AGGCTTTGTTTACACTGTGAGGG + Intronic
1072389544 10:94969211-94969233 AGGCTTTGTTTACACTGTGAGGG + Intronic
1072394682 10:95026563-95026585 TGGCTTTGTTTACACTGTGAGGG + Intergenic
1072404417 10:95136540-95136562 TGGCTTTCTTTACACTGTGAGGG - Intergenic
1072493684 10:95934162-95934184 TGGCTTTGTTTACACTGTAAGGG + Intronic
1072876194 10:99175478-99175500 CTGCTTTGTTTACACTGTGAGGG - Intronic
1073884200 10:108019553-108019575 CAGCTTTGTTTACACTGTGAGGG - Intergenic
1074407493 10:113191789-113191811 GGGTTTTATTTACACTGAGAGGG + Intergenic
1074648502 10:115491529-115491551 TGGCTTTGTTTACACTGTGAGGG + Intronic
1074668475 10:115758798-115758820 TGGTTTTGTTTGCACTATGAGGG + Intronic
1074795494 10:116938948-116938970 TGGCTTTGTTTACACTGTGAGGG + Intronic
1074985158 10:118652057-118652079 CAGCTCTGTTCACACTGTGAGGG + Intergenic
1075983904 10:126766828-126766850 CAGCTTTGTTTACACTGTGAGGG + Intergenic
1076389817 10:130090775-130090797 AGGCTTTGTTTACACTGTGAGGG - Intergenic
1076965261 11:77499-77521 TGGCTTTGTTTACACAGTGGGGG - Intergenic
1077562035 11:3270196-3270218 GGGCTTTGTTTACACTGTGAGGG + Intergenic
1077567929 11:3316016-3316038 GGGCTTTGTTTACACTGTGAGGG + Intergenic
1077696449 11:4397228-4397250 CAGTTTTGTTTACACTGTGAGGG - Intergenic
1078331472 11:10425871-10425893 TGGCTTTGTTTACACTATGAGGG + Intronic
1078336367 11:10466398-10466420 TGGCTTTGTTTACACTGTGAGGG - Intronic
1078392890 11:10952046-10952068 GGGCTTTGTTTACACTGTGAGGG + Intergenic
1078686179 11:13534451-13534473 CAGCTTTGTTTACACTGTGAGGG + Intergenic
1078809414 11:14743343-14743365 CAGCTTTATTTATGCTGTGAGGG + Intronic
1078814111 11:14801912-14801934 CTGCTTTGTTTACACTGTGAGGG + Intronic
1079262529 11:18897389-18897411 TGGCTTTGTTTACACTGTGAAGG + Intergenic
1079316539 11:19412281-19412303 GGGCTTTATTTACACTGTGAGGG - Intronic
1079510562 11:21205395-21205417 CGGCTTTGTTTACACCGTGAGGG + Intronic
1079517881 11:21289850-21289872 CAGCTTTGTTTACACTGTGAGGG - Intronic
1079696135 11:23484378-23484400 CAGCTTTGTTTACACTGTGAGGG - Intergenic
1079867919 11:25758650-25758672 AGGCTTTGTTTACACTGTGAAGG - Intergenic
1080334550 11:31181072-31181094 CGGCTTTGTTTACAATGTGAGGG - Intronic
1080965608 11:37210895-37210917 CTGCTTTTTACACACTGTGAGGG + Intergenic
1080977166 11:37356929-37356951 CTGCTTTGTTTACACTGTGAGGG - Intergenic
1081080195 11:38731875-38731897 CTGCTTTGTTTACACTGTGAGGG + Intergenic
1081094944 11:38921099-38921121 TAGCTTTGTTTACACTGTGAGGG + Intergenic
1081198808 11:40192810-40192832 TGGCTTTGTTTACACTGTGAGGG - Intronic
1081317720 11:41650872-41650894 TAGCCTTGTTTACACTGTGAGGG + Intergenic
1081874296 11:46398068-46398090 CGGATTGGTTTTCACAGTGATGG - Intronic
1082670715 11:56033483-56033505 CAGCTTTGTTTACACTATGAGGG - Intergenic
1082872128 11:57953321-57953343 GGGCTCTGTTTACACTGTGAGGG + Intergenic
1082876313 11:57992476-57992498 CAGCTTTCTTAACACTGTGAAGG + Intergenic
1082903596 11:58283094-58283116 TGGCTTTTTTTGCACTGTGCAGG + Intergenic
1082924395 11:58530406-58530428 TGGCTTTGTTTACACTGTGAAGG - Intronic
1083385513 11:62306437-62306459 TGGCTTAGTTTACTTTGTGAGGG + Intergenic
1083507047 11:63167523-63167545 TGGCTTCCTTAACACTGTGAGGG - Intronic
1083510232 11:63202510-63202532 TGTCTTTGTTTACACTGTGAGGG - Intronic
1085433871 11:76481604-76481626 TGGCTTTCTTTATACTCTGAGGG - Intronic
1085683784 11:78603217-78603239 CGGCTTTGTTTACACTGTGAGGG + Intergenic
1085884461 11:80505933-80505955 CGGCTTTGTTTACACTGTGAGGG - Intergenic
1086067906 11:82765701-82765723 TAGCTTCGTTTACACTGTGAGGG + Intergenic
1086086024 11:82956165-82956187 AGGCTTTGTTTACACTGTGAGGG + Intronic
1086129213 11:83383326-83383348 TGGCTTTGTTTACACTGTGAGGG - Intergenic
1086300324 11:85420714-85420736 CAGCTTTGTTTACACTGTGAGGG + Intronic
1086312293 11:85548772-85548794 TGTCTTTGTTTATACTGTGAGGG + Intronic
1086348884 11:85924968-85924990 TGGCTTTGTTTACACTGTGAGGG - Intergenic
1086410724 11:86541504-86541526 CAGCTTTGTTTACACTGTGAGGG - Intronic
1086421927 11:86645420-86645442 TGGCTTTGTTTACACTGTGAGGG - Intronic
1086505310 11:87498052-87498074 TGACTTTGTTTACACTGTGAGGG - Intergenic
1086532353 11:87800967-87800989 TGGCTTTGTTTATACTGTGAGGG + Intergenic
1086608460 11:88725242-88725264 TGGCTTTGTTTACACTGTGAGGG - Intronic
1086732814 11:90270845-90270867 TGCGTTTGTTTATACTGTGAGGG + Intergenic
1086907303 11:92433017-92433039 CAGCTTTATTTACACCGTGAAGG + Intronic
1086944600 11:92832439-92832461 CAGATTTGTTTCCTCTGTGAAGG - Intronic
1087305771 11:96487501-96487523 AGGCTTTGTTTACACTGTGACGG - Intronic
1087427786 11:98012744-98012766 TGGCTTTCTTTACACTGTGAGGG - Intergenic
1087484878 11:98748372-98748394 CAGCTTTGTTTACACTGTGAGGG - Intergenic
1087596133 11:100257143-100257165 TGGCTTTGTTTACACTATAAGGG - Intronic
1087667800 11:101070682-101070704 TGGTTTTGCTTACACTGTGAGGG - Intronic
1087695284 11:101369589-101369611 TGGCTTTGTTTACACTGTGAGGG + Intergenic
1087703774 11:101466485-101466507 CCGTTTTGTTTACACTGTGTGGG + Intronic
1087830962 11:102819672-102819694 TGGCTTTGTTTACACTATGAGGG + Intergenic
1087925156 11:103910941-103910963 TAGCTTTGTTTACACTTTGAGGG - Intronic
1088066471 11:105726249-105726271 AGGGTTTGTTTATACTATGAGGG - Intronic
1088211921 11:107466237-107466259 GTGCTTTGTTTAAACTGCGAGGG + Intergenic
1088294462 11:108277148-108277170 TGGCTGTGTTTATACTGTGAGGG + Intronic
1088702557 11:112426415-112426437 TAACTTTGTTTACACTGTGAGGG - Intergenic
1089285460 11:117404936-117404958 TGACTTTGTTTACACTGTGAGGG + Intronic
1089766013 11:120766235-120766257 CGGCTTTGTTTACACTGTAAGGG + Intronic
1090312707 11:125756271-125756293 AGACTTTGTTTACACTCTGTGGG - Intergenic
1090623261 11:128581122-128581144 GGGATTTGTTTCCACTGAGAAGG - Intronic
1090688881 11:129156449-129156471 GGGCTTTGTTTACATTGTGAGGG - Intronic
1090720422 11:129467406-129467428 GGGCTTTGTTTACACTGTGAGGG - Intergenic
1090896100 11:130976871-130976893 TAGCTTTGTTTACACTGTGATGG + Intergenic
1091090016 11:132762596-132762618 TGGCTTTGTTTACACTGTGAGGG + Intronic
1091213507 11:133885023-133885045 TGGCTTTGTTTACACTGTGAGGG + Intergenic
1092020063 12:5194315-5194337 CTGCTTTATCTACCCTGTGATGG + Intergenic
1092304378 12:7283911-7283933 TGGCTTTGTTTATGCTGTGAGGG - Intergenic
1092398780 12:8153664-8153686 TGGCTTTGTTTACATTGTGAGGG + Intronic
1092567686 12:9685637-9685659 GGGCTTTGTTTACACTGTGAGGG + Intronic
1092581669 12:9849372-9849394 TGGCATTGTTTACACCGTGAAGG + Intergenic
1092638899 12:10482023-10482045 TGGCTTTGTTTACACTGTAAGGG - Intergenic
1092690914 12:11109026-11109048 TGGCTTTGTTTACACCGTAAGGG - Intronic
1092703262 12:11256703-11256725 TGGCTTTATTTATGCTGTGAGGG - Intergenic
1093004431 12:14036134-14036156 TGGCTTTGTTTACACTGTGAGGG - Intergenic
1093402313 12:18761307-18761329 AGGCTTTATTTACACTGTACAGG - Intergenic
1093545034 12:20336393-20336415 CGGCTTTGTTTACAATGTAGGGG + Intergenic
1093610541 12:21150058-21150080 TGGCTTTGTTTGCATTGTGAGGG - Intronic
1093664454 12:21795332-21795354 CAGCTTTGTTTACACTGTGAGGG + Intergenic
1093694768 12:22146840-22146862 CAGCTTTGTTTACACTGTGAGGG - Intronic
1093714508 12:22366295-22366317 TGGCTTTGTTTACGCTGTGAGGG - Intronic
1094140019 12:27171657-27171679 TGGCTTTATTTACACTGTGAGGG + Intergenic
1094208674 12:27867469-27867491 CGGTTTTTTTTCCTCTGTGATGG - Intergenic
1094733105 12:33200648-33200670 CTGCTTTGTTTACACTGTGAGGG + Intergenic
1094755417 12:33463074-33463096 TGGTTTTATTTACACTGTGAGGG - Intergenic
1094757869 12:33492927-33492949 CAATTTTGTTTACACTGTGAGGG - Intergenic
1094782051 12:33802615-33802637 AGGCTTTGTTTACACTGTAAGGG + Intergenic
1094809496 12:34123844-34123866 TGGCTTTGTTTACACCCTGGAGG + Intergenic
1095078077 12:37957949-37957971 CGGTTTTGTAGAAACTGTGAAGG + Intergenic
1095119925 12:38405144-38405166 CAGCTTTGTTTACACTGTGAGGG + Intergenic
1095230487 12:39733686-39733708 TGGCTTTGTTTACACTGTGAGGG + Intronic
1095247857 12:39943537-39943559 CAGCTTTGTTTACACTGTGAGGG + Intronic
1095356436 12:41280570-41280592 TAGCTTTGTTTACACTGTGAGGG - Intronic
1095488500 12:42708550-42708572 CAGCTTTGTTTACACTGTGAGGG - Intergenic
1095647009 12:44559032-44559054 TGGCTTTGTTTACACCATGACGG - Intronic
1095694878 12:45132906-45132928 TGGCTTTCTTTACACTGTGAGGG - Intergenic
1095778884 12:46037238-46037260 TGGCTTTGTTTACAGTGTGAGGG - Intergenic
1095832328 12:46601367-46601389 TGGCTGTGTTTACACTGTGAAGG + Intergenic
1095917836 12:47497924-47497946 CGGCTTTGTTTACACTGTGAGGG - Intergenic
1096941857 12:55355585-55355607 TGGCTTTGTTTACACTGTGAGGG - Intergenic
1097339924 12:58426222-58426244 CAGCTTTGTTTACACTCAGTTGG - Intergenic
1097375804 12:58841158-58841180 CAGCTTTGTTTACACTGTGAGGG + Intergenic
1097412137 12:59268264-59268286 TGGCTTCCTTAACACTGTGAGGG - Intergenic
1097435549 12:59549124-59549146 CGGCTTTGTTTACACTGTGAGGG + Intergenic
1097488451 12:60235031-60235053 TGCCTTTGTTTACACTGTGAGGG - Intergenic
1097517188 12:60620125-60620147 AGGCTTTGTTTACACTGTGAAGG - Intergenic
1097526634 12:60745794-60745816 TGGCTTTGTTTACACTGTGAGGG - Intergenic
1097619524 12:61922953-61922975 TGGCTTTGTTTACGCTGTCGGGG - Intronic
1097635182 12:62113775-62113797 CGGCTTTGTTTACAATGTGAGGG + Intronic
1097737396 12:63196879-63196901 CAGCTTTGTTTACACTGTGAGGG - Intergenic
1097948793 12:65403388-65403410 CGGCTTTGTTTACACTGTGAGGG + Intronic
1098052945 12:66473184-66473206 TGGCTTTGTTTACACTGTGAGGG - Intronic
1098151858 12:67555492-67555514 AGGCTTTGTTTACACTGTGAGGG + Intergenic
1098438774 12:70496988-70497010 TGGCTTTGTTTACACTGTGAGGG + Intergenic
1098635636 12:72780558-72780580 TGGCTTTGTTTACACTGTGAGGG - Intergenic
1098697076 12:73572753-73572775 TGGCTGTGTTTACACTGTGAAGG - Intergenic
1098906637 12:76169629-76169651 GAACTTTGTTTACACTGTGAGGG + Intergenic
1099053454 12:77808957-77808979 TGGCTTTTTTTACACTGTGAGGG + Intergenic
1099071354 12:78049001-78049023 CGGGTTTGTTTACATTGTGAGGG + Intronic
1099236091 12:80084056-80084078 TGGCTTTGTTTACATCGTGAGGG + Intergenic
1099238916 12:80115833-80115855 TGGCTTTGTTTACACTGTGAGGG + Intergenic
1099253701 12:80289678-80289700 TGGCTTCTTTAACACTGTGAGGG + Intronic
1099435254 12:82634938-82634960 TGGCTTTGTTTACACTGTGAGGG + Intergenic
1099492050 12:83300105-83300127 AAGCTTTTTTTACACTGTGAGGG - Intergenic
1099551024 12:84043539-84043561 TGGCTTTGTTTACACTGTGAAGG + Intergenic
1099554787 12:84097782-84097804 TGGCTTTGTTTACACTGTGAGGG - Intergenic
1099699131 12:86061731-86061753 TGACTTTGTTTACACTGTGAGGG - Intronic
1099744965 12:86690097-86690119 TGGCTTTGTTTACACTATTAGGG + Intronic
1099797996 12:87422440-87422462 AGGCTTTGTTTAAACTGTGAGGG + Intergenic
1099897559 12:88667813-88667835 CGGCTTTGTTTACACTGTGAGGG - Intergenic
1100111063 12:91242914-91242936 CCGGTTTGTTTACATTGTGAGGG - Intergenic
1100136286 12:91557139-91557161 GAGCTTTGTTTACACTGTGAGGG - Intergenic
1100740058 12:97581746-97581768 TGGCTTTGTTTACACTGTGAGGG - Intergenic
1100768722 12:97898089-97898111 TGGCTTTGTTTACACTGTGAGGG + Intergenic
1100798009 12:98202343-98202365 TGGCTTTGTTTATACTGTGAGGG - Intergenic
1100996251 12:100304039-100304061 CGGCTTTGTTTACACTGTGAGGG + Intronic
1101069850 12:101062667-101062689 CGGCTTTGTTTACACTGTGAGGG + Intronic
1101296096 12:103425043-103425065 TGGCTTTGTTTACACTGTGAGGG - Intronic
1101296241 12:103425885-103425907 TGGCTTTGTTTACACTGTGAGGG + Intronic
1101487986 12:105185039-105185061 TGGCTTTCTTTACACTCTAAGGG + Intronic
1102345563 12:112158972-112158994 CAGCTTTGTTTACACTGTGAGGG + Intergenic
1103255635 12:119539465-119539487 TGGCTTTGTTTACACTGTGAGGG + Intronic
1104115589 12:125746327-125746349 TGGCTTTGTTTCCACTGTGTGGG + Intergenic
1105355119 13:19652789-19652811 AGGCTTTGCTTACACTATGAGGG - Intronic
1105552464 13:21410642-21410664 CGGCTTTGTTTACACTGTGAGGG + Intronic
1105645778 13:22316230-22316252 CGGCTTTGTTTACACTGTGAGGG + Intergenic
1105737373 13:23285391-23285413 CGGCTTTGTTTGCACTGTGAGGG + Intronic
1105769418 13:23594461-23594483 TGGCTTTGTTTACACTGTGAGGG - Intronic
1106025818 13:25954214-25954236 TGGCTTTGTTTACACTGTGAGGG - Intronic
1106335067 13:28776666-28776688 CAGCTTTGTTTACATTGTGAGGG + Intergenic
1106336008 13:28783958-28783980 TGGCTTTGTTTACACTGTGAGGG + Intergenic
1106361886 13:29038825-29038847 TGGCTTTGTTTACACTGTAAGGG + Intronic
1106377427 13:29203294-29203316 CAGCTTTGTTTACACTGTGAGGG + Intronic
1106378798 13:29216161-29216183 CAGCTTCGTTTACACTGTGAGGG + Intronic
1106391147 13:29336925-29336947 CAGCTTTGTTTACACTGTGAGGG + Intronic
1106429435 13:29665930-29665952 CAGCTTTGCTTACACTGTAAGGG - Intergenic
1106608071 13:31250569-31250591 TGGCTTTGTTTACACTGTGAGGG - Intronic
1106612291 13:31295597-31295619 CAGCTTTGTTTATACTCTGAGGG + Intronic
1106874222 13:34054552-34054574 TGGCTTTGTTTACACTGTGAGGG + Intergenic
1106983848 13:35321879-35321901 TGGCTTTGTTTACACTATGCAGG + Intronic
1107289813 13:38839738-38839760 AGGCTTTTTTTACTCTGTGAGGG + Intronic
1107473452 13:40712650-40712672 TGGCTTTGTTTACACTGTGAGGG + Intergenic
1107641949 13:42452952-42452974 TGGTTTTATTTACACTGTGAGGG + Intergenic
1107779351 13:43880762-43880784 TGGCTTTGCTTTCACTGTCATGG + Intronic
1107968831 13:45622163-45622185 TGGCTTTGTTTACATTCTGAGGG + Intergenic
1107970842 13:45640962-45640984 TGGCTTTGTGTACACTATGAGGG + Intergenic
1108030069 13:46220389-46220411 TGGCTTTGTATACACTGTGCAGG + Intronic
1108048800 13:46408875-46408897 TGGCTTTGTTTATACTGTGAGGG + Intronic
1108153795 13:47564290-47564312 CAGCTTTGTTTACACTGCGAGGG - Intergenic
1108217710 13:48201245-48201267 CAGCTTTGTTTACACTGTGAGGG - Intergenic
1108235062 13:48394603-48394625 TGGCTTTGTTTACACTGTGAGGG - Intronic
1108262785 13:48675423-48675445 CAGCTTTGTTTACACTGTGAGGG + Intronic
1108304613 13:49118712-49118734 TGGCTTTGTTTACACTGCTCAGG - Intronic
1108383815 13:49879733-49879755 AGGCTTTGTTTACACTGTGAGGG - Intergenic
1108599877 13:51983272-51983294 TGGCTTTGTTTACACTATGAGGG - Intronic
1108858247 13:54822162-54822184 CAGCTTTGTTTACACTGTGAGGG - Intergenic
1108998321 13:56763501-56763523 TGGCTTTGTTTACACTGTGAGGG - Intergenic
1109033863 13:57230302-57230324 CTGCTTTGTTTACACTGTGAGGG - Intergenic
1109187909 13:59292056-59292078 CAGCTTTGTTTACACTGTGAGGG - Intergenic
1109195940 13:59377484-59377506 TGACTTTGTTTACACTGTGAGGG - Intergenic
1109293748 13:60505297-60505319 TGGCTTTGTTTACACTGTGAGGG - Intronic
1109328664 13:60900694-60900716 CAGCTTTGTTTACACTGTGAGGG - Intergenic
1109366609 13:61364571-61364593 CGGCTTTGTTTACACTGTGAGGG - Intergenic
1109457490 13:62611530-62611552 TGGCTTTGTTTATACTGTGAGGG + Intergenic
1109541330 13:63782220-63782242 TGGCTTTGTTTACACTGTGAGGG + Intergenic
1109615430 13:64828373-64828395 CAGCTTTGTTTACACCGTGAGGG - Intergenic
1109626623 13:64982802-64982824 AGGCTTTGTTTACAATGTGAGGG + Intergenic
1109661618 13:65467383-65467405 TGGCTTTGTTTACACTGTGATGG + Intergenic
1109731567 13:66420030-66420052 TGGCTTTGTTTCCACTTTGAGGG - Intronic
1109891179 13:68616982-68617004 CAGCTTTGTTTACACTGTAAGGG - Intergenic
1109902787 13:68795659-68795681 AGGCTTTGTTTACACTGTGAGGG + Intergenic
1110135533 13:72062778-72062800 CAGCTTTGTTTACATTGTGAGGG - Intergenic
1110389721 13:74959815-74959837 TGACTTTGTTTACACTGTAAGGG - Intergenic
1110824699 13:79958479-79958501 TGGCTTTGTTTACACTGTGAGGG - Intergenic
1111114219 13:83754786-83754808 TGGCTTTGTTAACACTGTGAGGG - Intergenic
1111627960 13:90813551-90813573 CTGCTTTGTTTATACTGTGAGGG - Intergenic
1111635087 13:90893030-90893052 AGGCTTTGTTTACACCGTGAGGG - Intergenic
1112151934 13:96773534-96773556 TGGCCTTGTTTACACTGTGAGGG - Intronic
1112165858 13:96919074-96919096 TGGCTTTGTTTACACTGTGAGGG - Intergenic
1112546498 13:100376604-100376626 TGGCTTTGTTTATTCTCTGAGGG + Intronic
1112834216 13:103493806-103493828 CTGCTTTGTTTTCACTGTGATGG - Intergenic
1113131505 13:107042400-107042422 CACCTTTGTTTACTCTGTCAGGG + Intergenic
1114133549 14:19820712-19820734 TGGCTTTATTTACACTGTGAAGG + Intronic
1114341952 14:21754434-21754456 TGGCTTTCTTTACACTGTAAGGG - Intergenic
1114744995 14:25137079-25137101 CGGCTTTGTTTAAACTGTGAGGG - Intergenic
1114817681 14:25979518-25979540 TGGCTTTGTTCACACTGTGAGGG - Intergenic
1114854604 14:26423343-26423365 TTGATTTGATTACACTGTGAAGG + Intergenic
1114870105 14:26645579-26645601 CGGCTTTGTTTACAGTATGAGGG + Intergenic
1115008170 14:28511552-28511574 TGGCTTTGTTTATGCTGTGAGGG + Intergenic
1115043116 14:28955638-28955660 CAGCTTTGTTTACACTGTAAGGG - Intergenic
1115048689 14:29029159-29029181 AGGCTTTGTTTACATTGTGAGGG + Intergenic
1115162328 14:30410232-30410254 CAGCTTTGTCTACAAGGTGAAGG + Intergenic
1115277055 14:31621065-31621087 CGGCTTTGTTTACACTGTGAGGG + Intronic
1115359801 14:32488311-32488333 TGGCTTTGTTTACACTGTGAGGG + Intronic
1115511288 14:34139997-34140019 AGGCTTTGTTTACACTGTGAGGG - Intronic
1115538062 14:34391876-34391898 AGGCTTTGTTTCTACTGTGAGGG - Intronic
1115691017 14:35843969-35843991 TGGCTTTGTTTACACTGTGAGGG + Intronic
1115721081 14:36161991-36162013 CAGCTTTGTTTACACCGTGAGGG + Intergenic
1115856248 14:37632892-37632914 CGGCTTTGTTTACACAGTGAAGG + Intronic
1115912145 14:38268738-38268760 TGGCTTTGATTACACTGTAAGGG + Intergenic
1115940321 14:38601599-38601621 CAGCTTTTTTTAAACTGTGAAGG + Intergenic
1115974392 14:38980974-38980996 TGACTTTGTTTACACTGTGAGGG + Intergenic
1116511872 14:45756380-45756402 TGGCTTTATTTACACTGTGGAGG + Intergenic
1116572432 14:46534890-46534912 CAGCTTTATTTACAATGTGAGGG + Intergenic
1116743873 14:48792823-48792845 TAGCTTTGTTTACACTGTGAGGG - Intergenic
1116771454 14:49131555-49131577 TGGCTTTGTTTACACTGTGAGGG + Intergenic
1116775736 14:49178834-49178856 TGGCTTTGTTTACACTTTGAGGG - Intergenic
1117104279 14:52382510-52382532 AGGCTTTGTTTATATGGTGAGGG - Intergenic
1117121078 14:52568651-52568673 TGGCTTTGTTTACACCCTGAGGG - Intronic
1117237983 14:53798571-53798593 TGGCTTTGTTTACACTGTGAGGG - Intergenic
1117299241 14:54407629-54407651 TGGCTTTGTTTACACTGTGAGGG + Intronic
1117655482 14:57951642-57951664 AGGCTTTGTTTACACTGTGAGGG - Intronic
1117821871 14:59658102-59658124 CGGCTTTGTTTACACTGTGAGGG - Intronic
1117859379 14:60073841-60073863 CAGTTTTGTTTACACCGTGAGGG - Intergenic
1117930528 14:60837004-60837026 ATGCTTTGTTTACACTGTGAGGG + Intronic
1118516079 14:66530229-66530251 GGGCTTTGTTTACACCGTGAGGG + Intronic
1118544729 14:66873621-66873643 CTGCTTTGTTTATGCTGTGAGGG - Intronic
1119018469 14:71084629-71084651 CAGCTTTGCTTACACTGTGAGGG + Intronic
1120201345 14:81541035-81541057 TGGCTTTGTTTACACTGTGAGGG - Intergenic
1120271768 14:82321872-82321894 CAGCTTTGTTTACACTGTGAGGG + Intergenic
1120450028 14:84655352-84655374 CGACTTTGTTTACACTGTGAGGG + Intergenic
1120554102 14:85907703-85907725 TGGCTTTGTTTACACTGTGAGGG + Intergenic
1120565313 14:86048119-86048141 TGGCTTTGTTTATACTGTGAGGG + Intergenic
1120770129 14:88370227-88370249 CAGCTTTGTTTACACTGTGAGGG - Intergenic
1120773833 14:88411154-88411176 CGGCTTTGTTTACACTGTGAGGG + Intronic
1120843147 14:89104606-89104628 TGGCTTTGTTTACACTGTGAGGG + Intergenic
1120873490 14:89358692-89358714 TGGCTGTGTTGAAACTGTGAAGG - Intronic
1121899006 14:97674987-97675009 TGGCTTTTTTTACACTGTGAGGG - Intergenic
1123480839 15:20629447-20629469 TGACTCTGTTTACACTGTGAGGG - Intergenic
1123637173 15:22370918-22370940 TGACTCTGTTTACACTGTGAGGG + Intergenic
1124084216 15:26531715-26531737 CGGCTTTGTTTACACTGTAAGGG - Intergenic
1124592532 15:31066013-31066035 CAGCCTTGTTTCCACTGTGATGG + Intronic
1124666718 15:31598864-31598886 CGGCTTTGTTTACACTGTGAGGG - Intronic
1124893961 15:33758500-33758522 CAGCTTTGTTTATACTGTGAGGG - Intronic
1125227184 15:37408513-37408535 CAGCTATGTTTACATTCTGAGGG - Intergenic
1125288527 15:38120080-38120102 TGGCTTTGTTTACACTGTGAGGG - Intergenic
1125329993 15:38573350-38573372 CGGCTTCATTTACACTGTGAGGG + Intergenic
1125354534 15:38803254-38803276 CAGCTTTCTTTACACTGTGAGGG + Intergenic
1125784308 15:42301711-42301733 TGCCTCTGTTTAGACTGTGAGGG - Intronic
1125984742 15:44039044-44039066 AGGCTTTGTTTACACTGTGAGGG - Intronic
1126425636 15:48524410-48524432 TGGATTTGTTTATACTGTCAGGG + Intronic
1126500532 15:49339900-49339922 AGGCTTTGTTTACACTGTGCGGG + Intronic
1126554097 15:49966478-49966500 TGGCTTTGTTTACACCGTGAGGG - Intronic
1126720099 15:51569297-51569319 CAGCTTTGTTTACACTGTGAGGG - Intronic
1126952186 15:53893632-53893654 CAGCTTTGTTTACACTCTGAGGG + Intergenic
1127030033 15:54851394-54851416 TGGCTTTGTTTACACTGTGAGGG - Intergenic
1127056300 15:55135566-55135588 TGGCTTTGTTTATACTGCGAGGG - Intergenic
1127373743 15:58363258-58363280 CGGCTTTTTTTACACTGTGAGGG - Intronic
1127452576 15:59131321-59131343 CAGCTTTGTTTACACTGTGAGGG + Intergenic
1128883686 15:71265815-71265837 CGGCTTTGTTTACATTGTGAGGG - Intronic
1129126783 15:73448356-73448378 TGGCTTTGTTTACACTGTAAGGG - Intronic
1129495575 15:75977112-75977134 CAGTTTTGTTTACACTATGAGGG + Intronic
1129499141 15:76019114-76019136 CGGCTTTGTTTACACTGTGAGGG + Intronic
1129563218 15:76593179-76593201 TGGCTTTGTTTACCCTGTGAGGG - Intronic
1130441934 15:83963365-83963387 AGGCTTTGTTTACACTGTGAGGG - Intronic
1130724038 15:86419821-86419843 CGGCTTTGTTTACACTGTGAGGG - Intronic
1130728663 15:86467255-86467277 TGGCTTTGTTTACACTGTGAGGG + Intronic
1132096429 15:98988348-98988370 TGGCTTTGTTTACACTGTGAGGG - Intronic
1132442866 15:101886021-101886043 TGGCTTTGTTTACACTGTGGGGG + Intergenic
1133956975 16:10452866-10452888 TGGCTTTGTTTGCACTGTGAGGG + Intronic
1134514616 16:14876612-14876634 CGGCTTTGTTCACACCCTGCAGG - Intronic
1134702293 16:16275265-16275287 CGGCTTTGTTCACACCCTGCAGG - Intronic
1134767608 16:16774524-16774546 CAGCTTTGTTTACACTGTGAGGG + Intergenic
1134969537 16:18519385-18519407 CGGCTTTGTTCACACCCTGCAGG + Intronic
1135807567 16:25556498-25556520 CGGCTTTGTTTACACTGTGAGGG - Intergenic
1137296332 16:47097380-47097402 TGGCTTTGTTTACACTGTGAGGG - Intronic
1137336466 16:47554299-47554321 TGACTTTGTTTACACTGTGAGGG + Intronic
1137713525 16:50583621-50583643 CGGTTTTTTTTACACAATGATGG + Intronic
1137828109 16:51517132-51517154 AGGCTTCGTTTACACTGTGAGGG - Intergenic
1137969977 16:52975350-52975372 GGGCTTTGTTTACACTGTGAGGG + Intergenic
1137984273 16:53094440-53094462 CGGGTGAGTTTTCACTGTGACGG - Intronic
1138151558 16:54662020-54662042 AGGCTTTGTTTATACTGTGAGGG - Intergenic
1138843640 16:60539055-60539077 AACCTCTGTTTACACTGTGAGGG + Intergenic
1138886924 16:61091127-61091149 TGGCTTTGTTTGCACCGTGAGGG - Intergenic
1140165249 16:72543864-72543886 GGGCATTGTTTACAGTGTGAAGG - Intergenic
1141246102 16:82309195-82309217 CGGCTTTGTTTACATTGTGAGGG + Intergenic
1142992827 17:3743148-3743170 CGGCTCTGATGACGCTGTGATGG - Intronic
1143427131 17:6848975-6848997 TGGCTTTGTTTACACTGTGAGGG + Intergenic
1146742851 17:35301507-35301529 AGGCTTTGTTTACACTGTGAGGG - Intergenic
1146746316 17:35333710-35333732 CAGCTTTGTTTACGCTGTGAGGG + Intergenic
1146825924 17:36023321-36023343 TGGCTTTGTTTACACTGTGAGGG + Intergenic
1147428944 17:40359865-40359887 CTGCTTTGTTTTCACAATGATGG - Intergenic
1147525274 17:41216524-41216546 CAACTTTGTTTACACTGTGAGGG - Intronic
1148967396 17:51447330-51447352 CGGCTTTGTTTACACTGTGAGGG - Intergenic
1148981043 17:51575064-51575086 TGGCTTTGCTTACTCTGTGAAGG - Intergenic
1149222897 17:54436206-54436228 CAGCATTGTTTACACTGTGAGGG - Intergenic
1149281261 17:55108191-55108213 CAGCTTTGTTTACACTCTGAGGG + Intronic
1150899375 17:69254521-69254543 TTGCTTAATTTACACTGTGAAGG + Intronic
1153059367 18:979877-979899 TGGCTTTGTTTACACTATGAGGG + Intergenic
1153106714 18:1536503-1536525 CGGTTTTGTTAATATTGTGAGGG - Intergenic
1153313400 18:3699906-3699928 TGGCTTTGTTTACACTGTGAAGG + Intronic
1153562230 18:6383093-6383115 CAGCTTTGTTTACACTGTGAGGG + Intronic
1153743264 18:8151408-8151430 TGGCTTTGTTTATACTATGAGGG + Intronic
1153798474 18:8647083-8647105 GGGCTTTGTTTACACTGTGAAGG - Intergenic
1153799488 18:8656965-8656987 CGGCCTTGTTTTCACTGTTTTGG + Intergenic
1154101534 18:11479214-11479236 TGGCTTTGTTTACACTGTGAAGG + Intergenic
1155384951 18:25267134-25267156 CAGCTTTGTTTACACTGTGAGGG - Intronic
1155395335 18:25380444-25380466 CAGCTTTATTTACACGGTGAGGG - Intergenic
1155665172 18:28299308-28299330 CAGCTTTGTTTACACTGTGAGGG + Intergenic
1155857328 18:30850055-30850077 TGGTTTTGTTTACACTGTGAGGG + Intergenic
1156626860 18:38920034-38920056 TGGCTTTGTTTACACTGTGAGGG + Intergenic
1156750249 18:40444561-40444583 TGGGTATGTTTACACTGTGGAGG + Intergenic
1156979271 18:43265591-43265613 AGGCTTTGTTTACACTGCGAGGG + Intergenic
1157066543 18:44356962-44356984 TGGCTTTGTTTACACTGTAAGGG + Intergenic
1157067286 18:44366729-44366751 CAGCTTTGTTTACACTGTGGGGG + Intergenic
1157071758 18:44416577-44416599 TGGCTCTGTTTACACTGTGGGGG - Intergenic
1157766495 18:50301508-50301530 CTTCCTTATTTACACTGTGACGG + Intergenic
1158399025 18:57104259-57104281 TAGCTTTATTTACACTGTGAGGG + Intergenic
1158853391 18:61517977-61517999 TGGCTTTGTTTACACTGTTAGGG - Intronic
1159204783 18:65235560-65235582 CTGCTTTGTTTATGCTCTGAAGG + Intergenic
1159254734 18:65931293-65931315 TGTCTTTGTTTACACCCTGAGGG - Intergenic
1159385957 18:67725817-67725839 TGTCTTTGTTTACACTGTGAGGG + Intergenic
1159562206 18:70007614-70007636 TGCCTTCGTTTGCACTGTGAAGG - Intronic
1159581339 18:70237075-70237097 AGGCTTTGTTTACACTGTGAGGG - Intergenic
1159636376 18:70809829-70809851 CGGCTTTGTTTCCGTTGTGATGG - Intergenic
1159645790 18:70916539-70916561 TGGCTTTGTTTACACTGTGAGGG + Intergenic
1159690586 18:71482792-71482814 TGGTTTTGTTTACACTGTGAGGG + Intergenic
1159901776 18:74053609-74053631 TGGCTTTGTTTACACTGTGAGGG - Intergenic
1160466642 18:79083188-79083210 CGGCTTTGTTTACACTGTGAGGG + Intronic
1160642065 19:147129-147151 TGGCTTTGTTTACACAGTGGGGG - Intergenic
1161644682 19:5445765-5445787 CGGCCTTCTTCACACTGTCAGGG + Intergenic
1164093054 19:21977939-21977961 TGGCTTTGTTTATACTCTGAGGG - Intronic
1164152363 19:22566104-22566126 CAGCTTTGTTTATACTGTGAAGG + Intergenic
1164416651 19:28051216-28051238 CAGCTTTGTTTACACTGTGAGGG - Intergenic
1165254584 19:34567998-34568020 TGGCTTTGTTTATGTTGTGAGGG + Intergenic
1166263200 19:41657394-41657416 AGGCTTTGTTTACACTGTGAGGG - Intronic
1167974100 19:53210085-53210107 CAGCTTTGTTTACATTGTGAGGG + Intergenic
1168457712 19:56526711-56526733 TGGCTTTGTTTACGCTGTGAGGG - Exonic
924967632 2:92647-92669 CGGTTTTATTTACACTGTGAGGG - Intergenic
925252442 2:2451475-2451497 TGGCTTTGTTTACACTGTGAGGG + Intergenic
925484500 2:4313126-4313148 TGGCTTTGTTAATGCTGTGAGGG + Intergenic
925566365 2:5258474-5258496 CGGCTTTGTTTACACTGTGAGGG + Intergenic
925692358 2:6538035-6538057 TGGCTTTGTTTACACTGTGAGGG - Intergenic
926508600 2:13745531-13745553 AGGCTTTGTTTACACTGTGAGGG - Intergenic
926533560 2:14082476-14082498 TGGCTTTGTTTGCACTGTGAGGG - Intergenic
926943965 2:18167975-18167997 CAGCTGTGTTTACACTGTGAGGG + Intronic
927117169 2:19916596-19916618 CGGCTTTGTTTACACTGTGAGGG - Intronic
927182800 2:20458963-20458985 TGGCTTTGTTTACACTGTGAGGG - Intergenic
928576700 2:32662960-32662982 ATTCTTTGTTTACACTGTGTGGG + Intronic
928750662 2:34466869-34466891 CAGCTTTGTTTATACTGTGAGGG - Intergenic
929062891 2:37941677-37941699 TGGCTTTGTTTACACCGTGTGGG + Intronic
929064733 2:37962474-37962496 TGGCTTTGTTTACACTGTGTGGG + Intronic
929256128 2:39813458-39813480 TGGCTTTGTTTACACCGTGAGGG + Intergenic
929257731 2:39830760-39830782 CAGCTTTGTTTACACTGTCAGGG + Intergenic
929333531 2:40712716-40712738 AGGCTTTGTTTACACTGTGAGGG + Intergenic
929838029 2:45426207-45426229 CAGCTTTATTTACACTGTGAAGG - Intronic
930223322 2:48767522-48767544 TGGCTTTGTTTACACTGTGATGG + Intronic
930264721 2:49186265-49186287 CAGCTTTGTTTACACTGTGAGGG + Intergenic
930359338 2:50358438-50358460 GAGCTTTGTTTACATTGTGAGGG - Intronic
930476639 2:51891168-51891190 CGGCTTTGTTTACAGTGTGAGGG + Intergenic
930516119 2:52409925-52409947 GGGCTATGTTTACACTGTGAGGG + Intergenic
931004106 2:57828312-57828334 TGGCTTTGTTTACACTGTGAGGG - Intergenic
931030410 2:58168806-58168828 TGGCATTGTATACACTGTGAGGG - Intronic
931212078 2:60207114-60207136 CAGCTTTGTTTACACTGTAGAGG + Intergenic
931538678 2:63304953-63304975 CAGCTTTGTTTACAACGTGAGGG - Intronic
931566451 2:63620380-63620402 AGGCTTTGTTTACACTGTGAAGG - Intronic
931814843 2:65890310-65890332 CGGCTTTGTTTACACTGTGAGGG - Intergenic
931886691 2:66625764-66625786 TGGCTTTGTTTACACTGTGAGGG + Intergenic
932646778 2:73510969-73510991 CGGCTTTGTTTACACTGTGAGGG + Intronic
932913898 2:75834348-75834370 CAGCTTTGTTCACACTGTGAGGG - Intergenic
932938945 2:76139494-76139516 AGGGTTTGTTTACACTGTGAGGG + Intergenic
933413191 2:81950987-81951009 CAGCTTTGTTTACACTGTGAAGG + Intergenic
933488271 2:82950328-82950350 AGGCTTTGTTTACACTGTAAGGG + Intergenic
935325849 2:101936026-101936048 CGGCATTGTTTACACTGTGAGGG - Intergenic
935567941 2:104629483-104629505 TGGCTTTGTTTACACTGTGAGGG + Intergenic
935961503 2:108429802-108429824 TAGCTTTGTTCACAGTGTGAGGG - Intergenic
935982832 2:108643874-108643896 TGGCTTTGTTTACACTGTGAGGG - Intronic
936448304 2:112614670-112614692 CAGCTTTGCTTACACTGTGGTGG + Intergenic
936769514 2:115894879-115894901 TGGCTTTGTTTACACTGTGAGGG + Intergenic
936999962 2:118457064-118457086 CGGCTTTGTTTACACTGTGAAGG + Intergenic
937143145 2:119618944-119618966 TGGCTTTGTTTACACTGTGAGGG - Intronic
937188445 2:120068564-120068586 CGGCTTTGTTTATACTGTGAGGG - Intronic
937465008 2:122124913-122124935 TTCCTTTGTTTATACTGTGAGGG + Intergenic
937573530 2:123392032-123392054 CAGCTTTGTTTACACTGTGAAGG - Intergenic
937893314 2:126956955-126956977 GGGCTTTGTTTACACTGTGAGGG - Intergenic
938144751 2:128824046-128824068 CAGCTCTGTTTCCACTGTGAGGG - Intergenic
938168115 2:129050317-129050339 TGGCTTTGTTTACACCGTGTGGG + Intergenic
938874412 2:135518041-135518063 CAGCTTTGTTTACACCGTGAGGG + Intronic
938952309 2:136266535-136266557 GGGCTTTGTTTACACTGTGAGGG + Intergenic
939033282 2:137101747-137101769 CAGCTTTGTTTACACTGTGAGGG - Intronic
939116895 2:138071123-138071145 TGGCTTTGTTTACGCTGTGAGGG + Intergenic
939126094 2:138179124-138179146 CCACTGTGTTTACACTTTGAAGG + Intergenic
939180397 2:138796296-138796318 CCACTTTGTTTACACTATGAGGG - Intergenic
939382031 2:141448198-141448220 GGACTTTGTTTACACTGTGAGGG + Intronic
939640836 2:144638454-144638476 CGGCTTTGTTTACACTGTGAGGG + Intergenic
939652820 2:144785635-144785657 CAGCTTTGTTTACACTGTGAGGG - Intergenic
939687135 2:145213607-145213629 CAGCTTTGTTTCCACTGTGACGG + Intergenic
939840622 2:147182866-147182888 CAGCTTTGTTTACACTGTGAAGG - Intergenic
939876682 2:147586241-147586263 TGGCTTTGTTTACACTGTGAGGG + Intergenic
939937757 2:148313435-148313457 CAGCTTTGTTTACACTGTGAGGG + Intronic
939942014 2:148362343-148362365 TGGCCTTGTTTACACTGTGAGGG - Intronic
939946933 2:148421789-148421811 CAGCTTTGTTTACACTGTGAGGG - Intronic
940030547 2:149257432-149257454 AGGCTTTGTTTACACTGTGAGGG + Intergenic
940114422 2:150192534-150192556 GCACTTTGTTTACACTGTGAGGG - Intergenic
940370569 2:152896234-152896256 TGGCTTTGTTTACACTGTGAGGG - Intergenic
940408078 2:153328588-153328610 TGGCTTTGTTTACATTGTGAGGG + Intergenic
940417813 2:153442829-153442851 TGGCTTTGTTTGCACTGTGAGGG + Intergenic
940593998 2:155766860-155766882 CAGCTTTGTTTACACTGTGAGGG + Intergenic
940602612 2:155880566-155880588 CGGCTTTGTTTACACTGTGAGGG - Intergenic
940757952 2:157704840-157704862 TGGCTTTGTTTACACTGTGAGGG - Intergenic
940821412 2:158360033-158360055 TGGTTTTGTTTACACTGTGAGGG - Intronic
940925185 2:159356347-159356369 CAGCTTTATTTACACTGTGAGGG - Intronic
940999031 2:160181345-160181367 TGGCTTTGTTTACACTGTGAGGG - Intronic
941076398 2:161010659-161010681 TGGCTTTGTTTACACTGTCAGGG - Intergenic
941115002 2:161462183-161462205 CAGCTTTGTTTACACTGTGAGGG + Intronic
941119601 2:161513545-161513567 GGGCTTTGTTTACACGGTGAGGG - Intronic
941444949 2:165589169-165589191 CCGATTTGTTTATACTGTGTTGG - Intronic
941478057 2:165972116-165972138 TGGCTTCTTTAACACTGTGAGGG - Intergenic
941565342 2:167099288-167099310 TGGCTTTGTTTACTCTGTGAGGG + Intronic
941571499 2:167175900-167175922 CGGCTTTGTTTACCCTGTGAGGG + Intronic
941682323 2:168412825-168412847 TGGCTTTGTTTACACTGTAGGGG + Intergenic
941845302 2:170126261-170126283 TGGCTTTGTTTACACTGTGAGGG - Intergenic
942010852 2:171761317-171761339 TGGCTTTGTTTACACTTTGAGGG + Intergenic
942199913 2:173560272-173560294 CAGCTTTGTTTACAATGTGAGGG - Intergenic
942407235 2:175668681-175668703 AGGCTTCGTTTATACTGTGATGG - Intergenic
942411049 2:175709476-175709498 TGGCTTTGTTTACACTGTGGGGG - Intergenic
942431283 2:175914083-175914105 TGGCTTTGTTTACACTGTGAAGG + Intergenic
942732601 2:179076261-179076283 CAGGTCTGTTTACACTGTAAGGG - Intergenic
942816283 2:180057828-180057850 CGGCCTTGTTTACACTGATAAGG - Intergenic
942898762 2:181089577-181089599 GAGCTTTGTTTACACTGTGAGGG - Intergenic
942953674 2:181750321-181750343 TGGCTTTGTTTACACTGTGAGGG + Intergenic
943084985 2:183300586-183300608 TGGCTTTGTTTACACTGTGAGGG + Intergenic
943105718 2:183543902-183543924 CTGCTTTGTTTACACTGTGAGGG - Intergenic
943112336 2:183621738-183621760 TGGCTTTGTTTGCACTGTGAGGG + Intergenic
943129976 2:183842237-183842259 CAGCTTTGTTTACACTGTGAGGG - Intergenic
943352532 2:186812445-186812467 TGGCTTTGTTTTCACTGTGAGGG - Intergenic
943408753 2:187519930-187519952 GGGCTTTGTTTACACTGTGAGGG + Intronic
943409807 2:187532937-187532959 GGGCTTTGTTTACACTGTGAGGG - Intronic
943512321 2:188840977-188840999 TGGGTTTGTTTACACTGTGAGGG - Intergenic
943552473 2:189357498-189357520 TGGCTTTGTTTACACTGTGAGGG + Intergenic
943599131 2:189893016-189893038 TGGCTTTGTTTACACTGTGAGGG + Intronic
943660494 2:190554513-190554535 TGGCTTTGTTTACACTGTGAGGG - Intergenic
943836833 2:192524831-192524853 AGGCTTTGTTTACACTGTGAAGG - Intergenic
944292047 2:198018588-198018610 CGGCTTTGTTTACACTGTGAGGG - Intronic
944347401 2:198685149-198685171 TGGCTTTGTTTACACTGTGGGGG - Intergenic
944607938 2:201369974-201369996 CAGCTTTGTTTACACTGTGAGGG - Intergenic
945207234 2:207344814-207344836 TGGCTTTGTTTACACTGTGAGGG - Intergenic
945329717 2:208525311-208525333 TGGCTTTGTTTACACTGTGAGGG + Intronic
945409187 2:209488645-209488667 CAGCTTTGTTTACACTGTGAGGG - Intronic
945467054 2:210181673-210181695 TGGCTTTGTTTACACTGTGAGGG - Intergenic
945486885 2:210406977-210406999 TGGCTTTGTTTACACTGTGAGGG + Intergenic
945628237 2:212237860-212237882 TGGCTTTGTTTACACTGTGAGGG + Intronic
945885384 2:215370510-215370532 TTGCTTTGTTTAAACAGTGAGGG - Intronic
945927418 2:215819682-215819704 CAGCTTTGTTTACCCTGTGAGGG - Intergenic
945945209 2:215988751-215988773 CGGCTTTGTGTACACTGTGAGGG - Intronic
946065303 2:216982487-216982509 TGACTTTGTTTACACTGTGAGGG + Intergenic
946913009 2:224485480-224485502 AGGCCTTGTTTACACTGTGAGGG - Intronic
947086057 2:226454300-226454322 TGGCTTTGTTTACACTGTGAGGG - Intergenic
947225836 2:227839470-227839492 AAGCTTTGTTTTCACTGTGAGGG + Intergenic
947364695 2:229381635-229381657 CGGCTTTGTTTACACTGTGAGGG - Intronic
947492132 2:230603999-230604021 TGGCTTTGTTTACACTGTGAGGG - Intergenic
947681410 2:232037319-232037341 TGGCTTTGTTTACACTGTGAGGG + Intronic
1169320036 20:4625106-4625128 TGGCTTTGTTTACACTGTGAGGG + Intergenic
1169960331 20:11152543-11152565 CAGCTTTGTTTACACTGTGAGGG + Intergenic
1170133920 20:13052749-13052771 CTGCTTTGTTTACACTGTGAGGG - Intronic
1170167883 20:13380859-13380881 TGGCTTTGTTTACACTGTGAGGG + Intergenic
1170229377 20:14028195-14028217 GCGCTTTGTTTACACTGTAAGGG + Intronic
1170266371 20:14470706-14470728 TGGCTTTGTTTACACTGTGATGG + Intronic
1170294251 20:14806798-14806820 CAGCTTTGTTTACAGTGTGAAGG - Intronic
1170454612 20:16520386-16520408 CGGCTTTGTTTACACTGTGAGGG - Intronic
1170720434 20:18873183-18873205 CAGCTTTGTTAACACTATGAGGG + Intergenic
1170727325 20:18941634-18941656 CGTCTTAGTTTACACTATGAGGG + Intergenic
1171000862 20:21414192-21414214 TGGCTTTGTTTACACTGTGAAGG - Intergenic
1171441403 20:25166294-25166316 TGGCTTTGTTTACACTGTGAGGG - Intergenic
1171513386 20:25706485-25706507 TGGCTTTGTTTACACTCTGAGGG + Intergenic
1171845903 20:30274534-30274556 TGGCATTGTTTACACTTTGCAGG + Intergenic
1172466843 20:35161633-35161655 CAGCTTTGTTTACACTGTGAGGG - Intergenic
1173511009 20:43628398-43628420 CAGCTTTGTTTACGCTGTAAAGG + Intronic
1173751150 20:45477943-45477965 TGGCTTTGTTTACTCTGTGAGGG + Intronic
1175040962 20:56050224-56050246 CGGCTTTGTTTACACTGTGAGGG - Intergenic
1176891796 21:14327523-14327545 CAGCTTTGTTTACACTGTGAGGG - Intergenic
1177042694 21:16132976-16132998 AGGCTTTGTATCCACGGTGAGGG + Intergenic
1177129678 21:17240828-17240850 CAGCTTTGTTTACACTGTAAGGG - Intergenic
1177136387 21:17308974-17308996 TGGGTTTGTTTACACTGTGAGGG - Intergenic
1177184179 21:17775524-17775546 AGGCTTTGTTTACACTATGAGGG + Intergenic
1177313246 21:19424521-19424543 CAGCTTTGTTTACATTGTAAGGG - Intergenic
1177541006 21:22493854-22493876 TGGCTTTGTTTATACTGTCAGGG - Intergenic
1177820097 21:26022029-26022051 CTACTTTGTCTTCACTGTGAAGG + Exonic
1178007114 21:28234400-28234422 TGGCTTTGTTTACACCGTGAGGG - Intergenic
1178393576 21:32219833-32219855 AGGCTTTGTTTACACTGTGAGGG - Intergenic
1178637572 21:34318150-34318172 GGGCTGTCTTTACACTTTGAAGG - Intergenic
1178864436 21:36316457-36316479 CAGTTTTGTTTACACTGTGAGGG + Intergenic
1180025268 21:45157461-45157483 CTGCTGCGTTTGCACTGTGAAGG + Intronic
1180596248 22:16975367-16975389 AGGGTTTGTTTACACTATGAGGG - Intronic
1180710713 22:17837591-17837613 CAGCTTTGTTTTCACTGGAAAGG - Intronic
1182204499 22:28609945-28609967 TGGCTTTGTTTACACTGTGAGGG - Intronic
1182952477 22:34390593-34390615 CTGCTTTGTTTACATTGTGAGGG + Intergenic
1183021480 22:35030726-35030748 CGGCGTTGTTTACGCTGTGAGGG + Intergenic
949155024 3:816858-816880 CAGCTTTGTTCACTCTGTAAGGG - Intergenic
949173866 3:1034905-1034927 TTGCTTTGTTTACACTGTGAGGG + Intergenic
949377668 3:3407927-3407949 CGGCTTTGTTTACACTGTGAGGG - Intergenic
949423516 3:3891405-3891427 CAGCTTTGTTTACACTGTGAAGG + Intronic
949575579 3:5335902-5335924 CAGCTCTGTGTACACTGTGCTGG + Intergenic
949580594 3:5384058-5384080 TGGCTTTGTTTACACTGTGAGGG + Intergenic
949583377 3:5412878-5412900 CAGCTTTGTTTACAATGTGAGGG - Intergenic
949594577 3:5530756-5530778 CGGCTTTGTTTATGCTCTGAGGG + Intergenic
949641027 3:6036170-6036192 CTGCTTTGTTTACACTGTGAAGG + Intergenic
949683400 3:6541272-6541294 CAGCTTTGTTTACACTGTGAAGG + Intergenic
949801181 3:7906117-7906139 GGGCTTTGTTTACACTGTGAAGG + Intergenic
949846103 3:8372262-8372284 CAGCTTTATTTACACTGTGAGGG - Intergenic
950561969 3:13736158-13736180 CGGCTTTGTTTACACTGTGAGGG + Intergenic
950597442 3:13997062-13997084 GCGCTTTGTTTACACTGTGAGGG + Intronic
950847069 3:16024846-16024868 AGGCCTTCTTTTCACTGTGAAGG - Intergenic
950992040 3:17449592-17449614 TGGCTTTCTTTATACTCTGAGGG - Intronic
951254485 3:20432908-20432930 AGGCTTTGTTTACACTGTGAGGG + Intergenic
951310921 3:21125214-21125236 TGGCTTTGTTTATACTGTGAGGG - Intergenic
951347219 3:21560929-21560951 TGGCTTTGTTTACACTGTGAGGG + Intronic
951415118 3:22414325-22414347 TGGCTTCCTTTACACTGTGAGGG + Intergenic
951434251 3:22643386-22643408 AGCCTTTGTTTACACTGTGAGGG + Intergenic
951503659 3:23417839-23417861 CGATTTTGTTTACACTGTGAGGG + Intronic
951629108 3:24699251-24699273 AGGCTTTGTTTACACTGTGAGGG + Intergenic
951687585 3:25362271-25362293 CAGCTTTCTTTACACTGTGAAGG + Intronic
951741686 3:25931827-25931849 CAGCTTTGTTTATGCTGTGAGGG - Intergenic
951777237 3:26323855-26323877 TGGCTTTGTTTACACTGTAAGGG + Intergenic
951795476 3:26533784-26533806 TTTGTTTGTTTACACTGTGAGGG + Intergenic
951826684 3:26876195-26876217 CAGCTTTGTTTACCCTGTGAGGG - Intergenic
951846671 3:27091964-27091986 CGGCTTTCTTTTCTCTGTGTGGG - Intergenic
952098599 3:29985163-29985185 CAGCTTTGTTTACACTGTGAGGG + Intronic
952771218 3:37002818-37002840 AGACTTGGTTTACACTGAGACGG + Intronic
953047252 3:39304888-39304910 AGGCTTCGTTTACACTGTGAGGG - Intergenic
953102338 3:39842242-39842264 TGGCTTCGTTTATACTGTAAGGG + Intronic
953264295 3:41371002-41371024 CAGCTTTGTTTACACTGTGAAGG - Intronic
953315881 3:41925761-41925783 TGGCTTTGTTTATGCTGTGAGGG - Intronic
953433361 3:42857880-42857902 TGGCTTTGTTTACACTGCGAGGG - Intronic
953555771 3:43945842-43945864 TGGCTTTGTTTACACTGTGAGGG + Intergenic
954490611 3:50901256-50901278 TGGCTTTGTTTACACTGTGAGGG + Intronic
954510488 3:51120748-51120770 TGACTTGGTTTACACTGTGAGGG + Intronic
954524958 3:51261770-51261792 AGCTTTTTTTTACACTGTGAGGG - Intronic
954531090 3:51320683-51320705 TGGCTCTGTTTCCACTGTGAGGG - Intronic
954950543 3:54468786-54468808 CAGCTTTGTTTACACTGTGAGGG - Intronic
955175094 3:56606054-56606076 CCGCTTTGTTTACACTATGAGGG + Intronic
955414282 3:58678379-58678401 CCCCTTTGTTTACACTGTGAGGG + Intergenic
955439768 3:58942932-58942954 TGGCTTTGTTTTCACTGTGAGGG - Intronic
955447819 3:59032555-59032577 TGGCTTTGTTTTCACTGTGAGGG - Intronic
955657815 3:61263591-61263613 AGGCTTTGTTTACACTGTGAGGG + Intergenic
956005827 3:64777145-64777167 CAGCTTTGTTTATACTTTGAGGG - Intergenic
956157320 3:66312265-66312287 CAGCTTTGTTTACACTGTGAGGG + Intronic
956207710 3:66771605-66771627 TGGCTTTGTTTACACTGTGAGGG + Intergenic
956220101 3:66893384-66893406 TGGCTTTGTTTACACTGTGAGGG - Intergenic
956242116 3:67142199-67142221 TGGCTTCCTTAACACTGTGAGGG + Intergenic
956243420 3:67154630-67154652 CGGCTTTGTTTACACTGTGGGGG - Intergenic
956355733 3:68390212-68390234 AGGCTTTGTTTACACTGTGAGGG - Intronic
956363313 3:68471816-68471838 GTGCTTTGCATACACTGTGATGG - Intronic
956364762 3:68488498-68488520 GTGCTTTTTGTACACTGTGATGG - Intronic
956383056 3:68686237-68686259 CCAGTTTGTTTACACTGTGAGGG + Intergenic
956398109 3:68847300-68847322 CCACTTTGTTTACACTGTTAGGG + Intronic
957011221 3:75008351-75008373 TTGCTTTGTTTACACTGTGAGGG + Intergenic
957249678 3:77757102-77757124 AGGCTTTGTTTACACTGTGAGGG - Intergenic
957695729 3:83636071-83636093 TGGCTTTGTTAAAACTGTGAGGG - Intergenic
957747669 3:84366048-84366070 TGGTGTTGTTTACACTGTGAGGG + Intergenic
957776506 3:84761368-84761390 CAGCTTTATTCACACTGGGAGGG - Intergenic
957850433 3:85800168-85800190 AGGCTTTGTTTACATTGTGAGGG + Intronic
957993243 3:87653655-87653677 TGGCTTTGTTTACACTGTGAGGG + Intergenic
958257450 3:91341171-91341193 CAGCTTTGTTTACATTGTGAGGG + Intergenic
958434511 3:94080686-94080708 TGGCTTTGTTTACACTGTGAGGG + Intronic
958520901 3:95184535-95184557 TGTCCTTGTTTACACTGTGAGGG + Intergenic
958586256 3:96091549-96091571 AGGCTTTGTTTACACTGTGAGGG - Intergenic
958622206 3:96576046-96576068 AGACTTTGTTTACACTGTGAAGG + Intergenic
958694556 3:97510971-97510993 CAGCTTTGTTTACACTGTGAGGG + Intronic
958793595 3:98682229-98682251 TGGCTTTGTTTACACTGTGAGGG - Intergenic
959025660 3:101237074-101237096 CGGCTTTATTTACACTGTGAGGG - Intronic
959074561 3:101736053-101736075 AGATTTTGTTTACACTGTGAGGG - Intronic
959091803 3:101911237-101911259 TGGTTTTGTCTACACTGTGAGGG + Intergenic
959120100 3:102222873-102222895 TGGCTTCCTTAACACTGTGAGGG + Intronic
959278223 3:104304657-104304679 TGGCTTTGTTTACACTGTGAGGG - Intergenic
959291900 3:104485306-104485328 CAGCTTTGTTTACACTGTGAGGG - Intergenic
959534621 3:107470719-107470741 TGGCTTTGTTTACACTGTGAGGG - Intergenic
959734992 3:109648257-109648279 CAGCTTTGTTTACACTGTGATGG - Intergenic
959801008 3:110495375-110495397 TGGCTTTGTTTACACTGTGAGGG - Intergenic
959842879 3:110998980-110999002 GGGGTTTGTTTACACTGTGAAGG - Intergenic
959848086 3:111057016-111057038 GGGCTTTGTTTACACTGTAAGGG - Intergenic
959881188 3:111446889-111446911 TGGCTTTGTTTATACTGTGAGGG + Intronic
960177296 3:114532345-114532367 TGGCTTTGTTTTCACTGTGAGGG - Intronic
960378110 3:116928078-116928100 TGGCTTTGTTTAGCCTGTGATGG + Intronic
960768649 3:121167535-121167557 TGGCTTTGTTTACACTCTGAGGG - Intronic
960773143 3:121216965-121216987 TGGCTTTGTTTATACTGTCAGGG + Intronic
960827898 3:121811628-121811650 TGGCTTCCTTAACACTGTGAGGG - Intronic
961310601 3:125996939-125996961 TGGCTTTGTTTACACTGTGAGGG - Intergenic
961977532 3:131042469-131042491 CAGCTTTGTTTATACTGTGAAGG - Intronic
961998237 3:131269050-131269072 CAGCTTTGTTTACACTATGAGGG + Intronic
962156874 3:132957078-132957100 TGGCTTTGTCTACACAGTGAGGG - Intergenic
962181095 3:133207086-133207108 TGGCTTTGTTTACAATGTGAGGG + Intronic
962512358 3:136114642-136114664 GTGCTTTGTTTACACTGTGAGGG - Intronic
962634766 3:137319369-137319391 CGGCTTTGTTTACACTGTGAGGG + Intergenic
962640123 3:137377087-137377109 TGGCTTTGTTTACACTGTGAGGG + Intergenic
962642348 3:137400605-137400627 TGGCTTTGTTTATGCTATGAGGG + Intergenic
962666060 3:137654569-137654591 CAGCTTTGTTTATACTGTGAGGG - Intergenic
962668405 3:137679702-137679724 TGGCTTCGTTTACACTGAGAGGG - Intergenic
963013952 3:140803068-140803090 CAGCTTTGTTTACACTGTGAGGG + Intergenic
963027457 3:140933746-140933768 CAGCTTTGTTTACACTGTGAGGG - Intergenic
963629282 3:147712943-147712965 CAGTTTTGTTTACACTGTGAGGG + Intergenic
963898675 3:150712500-150712522 TGGCTTTGTTTACACTGTGAGGG - Intergenic
963976331 3:151484157-151484179 CGGCTTTGTTTATACTGTGAGGG - Intergenic
963980254 3:151529060-151529082 CAGCTTTGTTTACACTGTGAGGG - Intergenic
964010381 3:151885499-151885521 CAGCTTTGTTTACACTGTGAGGG - Intergenic
964049470 3:152373081-152373103 AAGCTTTGTTTATACTGTGAGGG + Intronic
964053110 3:152419963-152419985 CAGCTTGGTTTACATCGTGAGGG - Intronic
964053312 3:152421520-152421542 CGGCTTTGTTTACACTGTTTGGG - Intronic
964371353 3:156003870-156003892 TGGCCTTGTTTACACTGTGAGGG + Intergenic
964378016 3:156068944-156068966 CAGCTTTGTTTACACTGTGAAGG + Intronic
964649079 3:158991340-158991362 TGGCTTTGTTTACATTGTAAGGG + Intronic
964904848 3:161707442-161707464 TGGCTTTGTTTACACAGTGAGGG - Intergenic
965017419 3:163175071-163175093 CAGCTTTGTTTACACTGTGAGGG - Intergenic
965025511 3:163297124-163297146 TGGCTTTGTTTACAGTGTGAGGG - Intergenic
965199265 3:165635591-165635613 AGGCATTGTTTAAACTTTGATGG + Intergenic
965293172 3:166909676-166909698 TGGTTTTGCTTACACTGTGAGGG + Intergenic
965457841 3:168926147-168926169 CTGCTTTGTTTCCAATGTTATGG + Intergenic
965497277 3:169413744-169413766 TGGCTTTGTTTACACTGTGAGGG - Intronic
965511122 3:169568576-169568598 TGGCTTTGTTTACACTGTGAGGG - Intronic
965618718 3:170621437-170621459 TGGCTTTGTTTACACTGTGAGGG + Intronic
965880463 3:173382509-173382531 CAGCTTTGTTTACACTGGGAGGG - Intergenic
966255096 3:177908461-177908483 CAGTTTTGTTTACACTGTGAGGG + Intergenic
966255149 3:177908829-177908851 CAGTTTTGTTTACACTGTGAGGG - Intergenic
966309423 3:178576700-178576722 TGGCTTTGTTTACACTGTGAGGG - Intronic
966493735 3:180556649-180556671 CGGCTTTGTTTACACTGTGAGGG - Intergenic
966533288 3:181004289-181004311 CGACTTTGTTTATACTGTGAGGG + Intergenic
966561440 3:181325020-181325042 GGGCTTTGTTTACACTGTGAGGG + Intergenic
966637902 3:182156489-182156511 TGGCTTTGTTTACACTGTGAGGG + Intergenic
967181486 3:186909319-186909341 CGGTTTTGTTTACACTGTGAGGG + Intergenic
967343523 3:188427694-188427716 GGGCTTTGTTTACACTGTGATGG + Intronic
967419558 3:189258786-189258808 TGGCTTTGTTTACACTGTGAGGG + Intronic
967562652 3:190934794-190934816 CAGCTTTGTTTACACTGTAAGGG + Intergenic
967638619 3:191834818-191834840 GGGCTTTGTTTACACTGTGAGGG - Intergenic
968829089 4:2922920-2922942 CAGCTTTGTTTACACTGTGAGGG + Intronic
969164802 4:5298568-5298590 TGGCTTTGTTTACACTGTGAGGG + Intronic
969693322 4:8719870-8719892 CATCATTGTTTACACTGGGAGGG + Intergenic
969909178 4:10427854-10427876 TGGCTTTGTTTACACCGTGAGGG + Intergenic
970304727 4:14719299-14719321 AGGCTTTGTTTACACTGTGAGGG - Intergenic
970315233 4:14822677-14822699 CAGCCTGGTGTACACTGTGATGG - Intergenic
970685258 4:18559775-18559797 CAGCTTTGTTTACACTCTGAGGG - Intergenic
970727188 4:19060498-19060520 AGGCTTTGCTTACACTGTGAGGG - Intergenic
970775452 4:19669065-19669087 CGTCTTTGTTTACCCTATGAAGG - Intergenic
971004506 4:22357905-22357927 CAGCTTTGTTTGCACTGTTAGGG - Intronic
971430050 4:26556304-26556326 TGGCTTCGTTTACACTGTGAGGG + Intergenic
971647694 4:29229972-29229994 CAGCTTTGTTTAAACTGTGTGGG - Intergenic
972219333 4:36935974-36935996 TGGCTTTGTTTACACTGTGAGGG - Intergenic
972447612 4:39160585-39160607 CAACTTAGTTTACACTGTGGAGG + Intergenic
972743262 4:41909291-41909313 CAGCTTTGTTTACACTATGAGGG + Intergenic
972755579 4:42042430-42042452 TGGCTTTGTTTACACTGTGAGGG - Intronic
972962757 4:44474069-44474091 AGGCTTTCTTTATGCTGTGAGGG - Intergenic
973081843 4:46003057-46003079 TGGCCTTGTTTATACTGTGAGGG + Intergenic
973273016 4:48280271-48280293 TGGCTTTGTTTACACTGTGAGGG - Intergenic
973562652 4:52151855-52151877 TGGCTTTGTTTACACTGTGAGGG - Intergenic
973660918 4:53105544-53105566 TGGCTTTGTTTACACTGTTAGGG - Intronic
973715209 4:53669600-53669622 TGGCTTTGTTTACACTTTGAGGG + Intronic
973798405 4:54451559-54451581 TGGCTTTGTTTATACTGTGAGGG - Intergenic
973837504 4:54825057-54825079 CGTCTTTGTTTACACTGTGAGGG - Intergenic
974251767 4:59394289-59394311 AGGCTTTTTTCACACTGTGAGGG + Intergenic
974263966 4:59560388-59560410 CAGCTTTGTTTACACTGTGAGGG + Intergenic
974265736 4:59584014-59584036 TGGCTTTGTTTACGCTGTGAGGG + Intergenic
974307084 4:60156141-60156163 CAGCTTTGTTTACACTGTGAGGG + Intergenic
974326289 4:60419143-60419165 CAGCTTTGTTTACACTGTGAGGG + Intergenic
974453297 4:62094128-62094150 CGGCTTTGTTTACACTGTGAGGG + Intergenic
974793012 4:66714253-66714275 GGGCTTTGTTTACACTGTGAGGG - Intergenic
974851771 4:67412501-67412523 TGGCTTTGTTTACACTGTGAGGG + Intergenic
975096650 4:70464605-70464627 TGGCTTTTTTTACACTGTGAGGG - Intronic
975104128 4:70548955-70548977 CGGCTTTATTTATACTATGAGGG - Intergenic
975149396 4:71004741-71004763 TGGTTTTGTTTACACTGTGAGGG + Intronic
975307617 4:72867144-72867166 CAGCTTTGTTTACATGTTGAAGG - Intergenic
975367373 4:73544811-73544833 TGTCTTTGTTTACACTGTGAGGG - Intergenic
975424963 4:74214978-74215000 TGGCTTTGTTTACACTGTGAGGG + Intronic
975466330 4:74713743-74713765 TGGCTTTGTTTACATGGTGAGGG + Intergenic
975484161 4:74915975-74915997 CAGCTTTGTTTACATTGTGAGGG + Intergenic
975524264 4:75331658-75331680 TGGCTTTGTTTACACTGTGAGGG - Intergenic
975533046 4:75420715-75420737 TGGCTTTGTTTACACTGTGAGGG + Intergenic
975638801 4:76478335-76478357 TGGCTTTGTTTACACTGTGAGGG - Intronic
975764700 4:77655103-77655125 CGGCTTCGTTTACACTGTGAGGG - Intergenic
976061247 4:81130766-81130788 CGGCTTTGTTTACACTGTAAGGG + Intronic
976065565 4:81183851-81183873 CAGCTTTGTTTTCACTATGAGGG - Intronic
976114863 4:81715596-81715618 CGGCTTTGTTTACAATGTGAGGG - Intronic
976370822 4:84286290-84286312 CGGCTTTGTTTACACTTTTAGGG - Intergenic
976394924 4:84545311-84545333 AGGCTTTGTTTACACTGTGAGGG - Intergenic
976438306 4:85044003-85044025 CAGCTTTGTTTACACTGTAAGGG - Intergenic
976439290 4:85055125-85055147 TGGTTTTGTGTACACTGTGAGGG - Intergenic
976445966 4:85129898-85129920 AGGCTTTGTTTACACTGTGAGGG + Intergenic
976534315 4:86193535-86193557 CATCTTTGTTTACACTGTGAGGG + Intronic
976546949 4:86346767-86346789 CAGCTGTGTTTAAACTGTGTGGG - Intronic
976655910 4:87488871-87488893 CAGCTTTGTTTACACTGTGAAGG + Intronic
976669517 4:87636532-87636554 CGGCTTTGTTTACACTGTGAGGG - Intergenic
976715952 4:88122520-88122542 AGGCTTTGTTTACACTGTGAGGG - Intronic
976809923 4:89089809-89089831 CAGCTTTGTTTACGCTTTTAGGG + Intronic
976903508 4:90208285-90208307 CAGCTTTGTTTATGCTGTAAAGG + Intronic
977154486 4:93555466-93555488 AAGCTTTGTTTACACTGTGAGGG - Intronic
977185642 4:93932586-93932608 TGGCTTTGTTTACACTGTGAGGG + Intergenic
977438959 4:97037878-97037900 TGGCTTTGTTTATACTGTGAGGG + Intergenic
977467747 4:97403140-97403162 GGGCTTTGTTTACACTGTGAGGG + Intronic
977631462 4:99247981-99248003 CAGCTTTGTTTACAATGTGAGGG + Intergenic
977632969 4:99263598-99263620 CAGCTTTGTTTACACTGTGAGGG + Intergenic
977671404 4:99699428-99699450 TGCCTTTGTTTACACTGTGAGGG - Intergenic
977723471 4:100267556-100267578 CAGCTTTGTTTACACTGTGAGGG + Intergenic
977774439 4:100900803-100900825 CGGCTTTGTTTCCACTGTGAGGG - Intergenic
977792948 4:101129105-101129127 GGGCTTTGTTTACACTGTGAGGG - Intronic
977887898 4:102273303-102273325 AGGCTTTGTTTACATTATGAAGG - Intronic
977986190 4:103385753-103385775 TGGCTTTGTTTACACTGTGAGGG - Intergenic
978090301 4:104707210-104707232 CAGCTTTGTTTACACTGTGAGGG - Intergenic
978108281 4:104930917-104930939 CCGCTTTGTTTACACTGTGAGGG - Intergenic
978139080 4:105297303-105297325 AAGCTTTGTTTACACTGTGAGGG - Intergenic
978179523 4:105776127-105776149 TGGCTTTGTTTATACTGCGAGGG + Intronic
978186045 4:105858192-105858214 CGGCTTTGTTTACATTGTGAGGG + Intronic
978278317 4:106978523-106978545 AGGCTTTGTTTGCACTGGAAGGG + Intronic
978313291 4:107409648-107409670 CAGCTTTGTTTATACTGTGAGGG - Intergenic
978601403 4:110431948-110431970 TGGCTTTGTTTACACTGTGAGGG + Intronic
978664303 4:111164386-111164408 TGGCTTTGTTTACACCATGAGGG - Intergenic
978699755 4:111628235-111628257 TTGCTTTGATTACACTATGAGGG + Intergenic
979012335 4:115387605-115387627 CAGCTTTGTTTACACTGTGAAGG - Intergenic
979022859 4:115525067-115525089 CGGCTTCCTTAACACTGTCAGGG + Intergenic
979417468 4:120461013-120461035 TGGCTTTGTCTACACTGTGAGGG - Intergenic
979421405 4:120509470-120509492 TGGCTTTGTTTATGCTGTGAGGG - Intergenic
979457609 4:120944426-120944448 TGGCTTTGTTTACACTGTGAGGG - Intergenic
979461599 4:120990478-120990500 TGGCTTTGTTTACACTGTGAGGG + Intergenic
979588249 4:122446087-122446109 TGGCTTTGTTTACACTGTGAGGG + Intergenic
979668265 4:123336467-123336489 CAGCTTTGTTTACACTATGAGGG + Intergenic
979698282 4:123639040-123639062 GGGCTTTGTTTACACTGTGAGGG + Intergenic
979705376 4:123713935-123713957 TGGCTTTCTTTACATTGTGAGGG - Intergenic
979819367 4:125151635-125151657 AGGCTTCCTTAACACTGTGAGGG + Intergenic
979965964 4:127077121-127077143 CAGCTTTGTTTACACTGTGAGGG + Intergenic
979981500 4:127261656-127261678 CAGATTTGTTTACACTGTGAAGG + Intergenic
979998698 4:127463934-127463956 TGACTTTGTTTACACTGTGAGGG + Intergenic
980223295 4:129947748-129947770 CGGCTTTCTTTACACTGTGAGGG + Intergenic
980330373 4:131403367-131403389 AGACTTTGTTTACACTGTGAGGG + Intergenic
980439060 4:132817356-132817378 CGCCCTTGTTTACACTGACAAGG + Intergenic
980583629 4:134786388-134786410 CGCCTTTGTTTACACTGTGAGGG + Intergenic
980633913 4:135473733-135473755 GGGCTTTGTGTACACTGTGAGGG + Intergenic
980769339 4:137351236-137351258 GGGCTTTGTTTACACTGTGAGGG - Intergenic
980888117 4:138785408-138785430 GGACTTTGTTTACACTCTGAGGG + Intergenic
981131592 4:141163160-141163182 TGGCTTTGTTTACACTGTGAGGG - Intronic
981133969 4:141189681-141189703 TGGCTGCGTTTACACTGTGAGGG + Intronic
981273189 4:142868078-142868100 CAGCTTTGTTTACACTGTGAGGG - Intergenic
981296671 4:143140720-143140742 TGGCTTTGTTTACACTGTGAGGG - Intergenic
981411266 4:144435286-144435308 TGGCTTTGTTTACACTGTGAGGG - Intergenic
981443486 4:144809238-144809260 AGTCTGAGTTTACACTGTGAGGG - Intergenic
981481461 4:145243278-145243300 TGGCTTTGTTTATACTGTGAGGG + Intergenic
981629708 4:146804592-146804614 AGGCTTTCTTTACACTGTGAGGG - Intronic
981662529 4:147184240-147184262 CACCTTTGTTTACACTGTGAGGG - Intergenic
981749873 4:148082934-148082956 TGGCTCTGTTTACACTGGGAGGG - Intronic
981787975 4:148502682-148502704 CATCTTTGTTTACACTGTGAGGG + Intergenic
981789619 4:148521689-148521711 CAGCTTTGTTTACACTATGAGGG + Intergenic
981794929 4:148585378-148585400 TGGCTTTGTTTACACTGTGAGGG + Intergenic
981846530 4:149176210-149176232 TGGCTTTGTTTACACTGTGATGG - Intergenic
981859839 4:149341318-149341340 TGGCTTTGTTTACACTGTGAGGG + Intergenic
981885346 4:149666784-149666806 CAGCTTTGTTTACACTGTGAGGG - Intergenic
981939978 4:150271716-150271738 AGGCTTTGTTTACACCGTGAGGG - Intronic
982060263 4:151597812-151597834 TGACTTTGTTTATACTGTGAGGG + Intronic
982323888 4:154109139-154109161 CGACTTTGTTTACACTGTGAGGG - Intergenic
982733263 4:158979134-158979156 AGACTTTGTTCACACTGTGAGGG + Intronic
982733429 4:158980062-158980084 AAGCTTTGTTTACACTGTGAGGG - Intronic
982794528 4:159629509-159629531 TGGCTTTGTTTACACTGTGAGGG + Intergenic
982825743 4:160002011-160002033 CAGCTTTGTTTACACTGTGAAGG - Intergenic
982852947 4:160342257-160342279 TGGCTTTGTTTACATTGTGAGGG + Intergenic
982909209 4:161118030-161118052 AGGCTTTGGTTACACTGTAAGGG + Intergenic
983044507 4:162969645-162969667 TGGCTTTGTTTGCACTGTGAGGG + Intergenic
983047466 4:163004502-163004524 CAGCTTTGTTTACACTGTGAGGG + Intergenic
983179459 4:164630799-164630821 TGGCTTTGTTTACACTATGAGGG - Intergenic
983299021 4:165902027-165902049 CATGTTTGTTTACACTGTGAGGG + Intronic
983331373 4:166333523-166333545 CGGCTTTGTTTACACTGTGAAGG + Intergenic
983602731 4:169548751-169548773 TGGCTTTGTTTACACCATGAGGG + Intronic
983840871 4:172455565-172455587 TGGCTTTGTTTACACTGTGAAGG - Intronic
983896212 4:173084596-173084618 CAGCTTTGTTTACACTGTGAGGG + Intergenic
983949444 4:173622336-173622358 TGGCTTTGTTTACACCATGATGG + Intergenic
983958796 4:173727730-173727752 TGGCTTTTTTTACACTGTGAGGG + Intergenic
984269816 4:177536894-177536916 AGGCTTTGTTTACACTGTGAGGG + Intergenic
984354212 4:178637340-178637362 GGGCTTTGTTTACACTGTGAGGG - Intergenic
984493689 4:180468783-180468805 CGGCTTTGTTTACACTGTGGGGG - Intergenic
984526043 4:180860517-180860539 GGGCTTTGTTTACACTGTGAGGG + Intergenic
984618655 4:181927380-181927402 CGGCTTTATTTACACTGTGAGGG - Intergenic
984902964 4:184601038-184601060 GAGCTCTGTTTACACTGTGAGGG - Intergenic
985194002 4:187408214-187408236 TGGCTTTGATTTCACTGTGAAGG + Intergenic
986110366 5:4709997-4710019 TGGCTTTGTTTACATGGTGAGGG - Intergenic
986323055 5:6649390-6649412 GGGCTTTGTTTACACTATGAGGG + Intronic
986378821 5:7162586-7162608 TGGCTTTGTTTACACCGTGAGGG + Intergenic
986484356 5:8220368-8220390 TGGCTTTGTTTACATTGTGAGGG - Intergenic
986581668 5:9272226-9272248 TGGCTTTGTTTACACTGTGAGGG - Intronic
986664977 5:10093918-10093940 TGGATTTGTTTACACTGTGAGGG - Intergenic
986675198 5:10178016-10178038 TGGCTTTGTTTATGCTGTGAGGG - Intergenic
986838825 5:11672555-11672577 CAGGCTTGTTTACACTGTGAGGG + Intronic
986879599 5:12153858-12153880 TGGCTTTGTTTACACTGTGAGGG - Intergenic
987019276 5:13852727-13852749 CGGCTTTGTTAACACTGTGAGGG - Intronic
987704607 5:21446800-21446822 GGGCTTTGTTTACACTGAGAGGG + Intergenic
987720558 5:21627687-21627709 AGGCTTTGTTTACCCTGTGAGGG + Intergenic
987746401 5:21978938-21978960 AGGCTTTGCTTACAATGTGAAGG + Intronic
987924070 5:24317750-24317772 CAGCTTTGTTTACACTGTGAGGG + Intergenic
988289819 5:29270694-29270716 TGGCTTTGTTTACACTGTGAGGG - Intergenic
988402114 5:30775793-30775815 GGGCTTTGTTTGTATTGTGAGGG - Intergenic
988618229 5:32795366-32795388 TGGCTTTGTTTACACTGTGAGGG - Intergenic
988628009 5:32898649-32898671 CAGCTTTGTTTACACTGTGAGGG + Intergenic
988719224 5:33859366-33859388 CAGCTTTGTTTACACTGTGAGGG - Intronic
989084067 5:37656729-37656751 TGGCTTTGTTAAAACTGTGAGGG + Intronic
989194179 5:38699992-38700014 CAGCTTTGTTTACACTGTGAGGG - Intergenic
989244765 5:39242071-39242093 TGGCTTTGTTTCAACTGAGAGGG - Intronic
989312468 5:40036170-40036192 CGGCTGAGGCTACACTGTGATGG + Intergenic
989675232 5:43965724-43965746 CAACTTTGTTTACACTGTGAGGG + Intergenic
989687614 5:44108316-44108338 TGGCTTTGTTTACACTGTGAGGG + Intergenic
989825347 5:45848141-45848163 CTGCTTTGTTTACACTGTGAGGG - Intergenic
989958892 5:50387397-50387419 TGGCTTTGTTTACACTGTGGGGG - Intergenic
990098866 5:52157000-52157022 AGGTTTTGCTTACACTGTGAGGG - Intergenic
990164325 5:52977694-52977716 TAACTTTGTTTACACTGTGTGGG + Intergenic
990183758 5:53191117-53191139 TGGCTTTGTTTACACTGTGAGGG + Intergenic
990673869 5:58162102-58162124 TGGCTTTGTTTACACTGTGAGGG + Intergenic
990745842 5:58958870-58958892 TGGCTTTGTTTACACTGTGAGGG + Intergenic
990803518 5:59632100-59632122 CAGCTTTGTTTACACTGTGAGGG - Intronic
991151482 5:63376168-63376190 TGGCTTTGTTTACACCATGAGGG - Intergenic
991161385 5:63507619-63507641 CGACTTTGTTTACATTGTGAGGG - Intergenic
991223584 5:64243442-64243464 CGTCTTTGTTTACATTATGAGGG - Intronic
991236722 5:64407333-64407355 TGGCTTTGTTTACACTGTGAAGG - Intergenic
991283222 5:64939899-64939921 CGGCTTTGTTTACACTGTGAGGG + Intronic
991397740 5:66222636-66222658 TGGCTTTGCTTACACTGTGAGGG + Intergenic
991417215 5:66405309-66405331 TGGTTTTGTTTACACTGTGAGGG + Intergenic
991652083 5:68865625-68865647 TGGTTTTGTTTACACTGTGAGGG - Intergenic
991766610 5:69989008-69989030 AGGCTTTGCTTACAATGTGAAGG + Intergenic
991845841 5:70864095-70864117 AGGCTTTGCTTACAATGTGAAGG + Intergenic
992038866 5:72808812-72808834 AGGCTTTGTTTACACTGTGAGGG + Intergenic
992077876 5:73207427-73207449 CGGGTTTGTTTACACTGTGAGGG - Intergenic
992254868 5:74911549-74911571 TGGCTTTGTTTACACTGTGAGGG + Intergenic
992316960 5:75566148-75566170 TGGGTTTGTTTACACTGTGAGGG + Intronic
992506066 5:77388854-77388876 TGGCTTTGTTTACACTATGAGGG + Intronic
992740605 5:79770085-79770107 AGGCTTTGTTGACACCGTGAGGG + Intronic
992908721 5:81373726-81373748 TGGCTTTGTTTACACTGTAAGGG - Intronic
992976892 5:82130126-82130148 CGGCTTTCTTTACACTGTGAGGG + Intronic
992977689 5:82138008-82138030 AGGCTTTGTTTATACTGTGAGGG + Intronic
993081096 5:83301991-83302013 TGGCTTTGTTTACCCTGTGAGGG + Intronic
993119139 5:83753819-83753841 CAGCTTTGTTTACACTGTGAGGG - Intergenic
993255708 5:85588009-85588031 TGGCTTTGTTTACACTGTGAAGG + Intergenic
993265494 5:85721680-85721702 CAGCTTTGTTTATGCTGTGAGGG - Intergenic
993381843 5:87217650-87217672 CAGCTTTGTTTACACTGTGAGGG + Intergenic
993410465 5:87567309-87567331 GGCCTTTTTTTACACTGTGAGGG + Intergenic
993455297 5:88120591-88120613 TGGCTTTGTTTACACTATGAGGG - Intergenic
993460151 5:88172910-88172932 AGGCTTTGTTTACATTGTGAGGG + Intergenic
993541642 5:89159537-89159559 TGGCTTTGTTTACACTGTGAGGG - Intergenic
993544191 5:89190796-89190818 CTGCTTTGTTTGAACAGTGATGG + Intergenic
993609023 5:90031867-90031889 CGGATTTGTTTACACTGTGAGGG - Intergenic
993673970 5:90795359-90795381 TGGCTTTGTTTACACTGTGAGGG - Intronic
993757612 5:91750995-91751017 AGGCTTTGTTTACATCGTGAGGG + Intergenic
993891699 5:93482809-93482831 AGGCTTTGTTTACACTGTGAGGG - Intergenic
993894998 5:93523206-93523228 AGGCTTTGTTTACACTGTGAGGG - Intergenic
993960950 5:94296188-94296210 TGGCTTTGTTTACACTGTGAGGG + Intronic
994005155 5:94828737-94828759 CAGCTTTGTTTACACTGTGAGGG + Intronic
994015055 5:94955624-94955646 CAGCTTTGTTTATACTGTGAGGG - Intronic
994137945 5:96309235-96309257 CGGCTTTGTTTACAATGTGAGGG + Intergenic
994142845 5:96361113-96361135 CAGCTTTGTTTACACTCTTAGGG + Intergenic
994233523 5:97336172-97336194 CAGCTTTGTTTATACTATGAGGG + Intergenic
994378085 5:99037961-99037983 ATGCTTTGTTTACACTGTGAGGG - Intergenic
994438052 5:99763578-99763600 TGACTTTGTTTACATTGTGAGGG + Intergenic
994609533 5:102018923-102018945 TGGCTTTGTTTACACTGTGAGGG - Intergenic
994641969 5:102421479-102421501 CGGCTTTGTTTACACTGTGAGGG - Intronic
994991299 5:107000040-107000062 TGCCTTTGATTACACTGTGAGGG + Intergenic
995108213 5:108399135-108399157 TGGTTTTGTTTACACTGTGAGGG - Intergenic
995136560 5:108685882-108685904 TGGCTTTGTTTACACTGTGAGGG + Intergenic
995162488 5:108997917-108997939 TGGCTTTGTTTACACTGTGAGGG + Intronic
995263770 5:110135739-110135761 TGGCTTTGTTTACACTGTGAGGG + Intergenic
995326202 5:110892828-110892850 TGGCTTTGTTTACACTGTGAGGG + Intergenic
995398692 5:111716972-111716994 CAGCTTTGTTTACACTGTGAGGG + Intronic
995464427 5:112436324-112436346 CAGCTTTGTTTACACTGTGAGGG - Intergenic
995471231 5:112503950-112503972 TGGCTTTGTTTACACTGTGATGG - Intergenic
995475055 5:112539311-112539333 TGGCTTTGTTTACACTGTGAGGG - Intergenic
995480383 5:112586694-112586716 AGGCTTTGTTTACACTGTGAGGG - Intergenic
995612375 5:113923962-113923984 TGGCTTTGTTTACACTGTGAGGG - Intergenic
995620620 5:114021607-114021629 CGGCTTTTTTTACACTGTGAGGG - Intergenic
995695752 5:114876577-114876599 GGGCTTTGTTTACACTGTGATGG - Intergenic
995790644 5:115882983-115883005 TGGGTTTGTTTACACTGTGAGGG + Intronic
996129954 5:119769886-119769908 CAGCTTTGTTTACACTGTGAGGG - Intergenic
996270790 5:121602410-121602432 AAGCTTTGTTTACACTGTGAAGG - Intergenic
996804221 5:127436883-127436905 AGTCTGTGTTTTCACTGTGAAGG - Intronic
996910871 5:128655755-128655777 CGGCTTTGTTTACACTGTAAGGG + Intronic
996987481 5:129584680-129584702 TAGCTTTGTTTACACTGTGAGGG + Intronic
997171793 5:131729467-131729489 CAGCTTTGTTTACACTCAGTTGG + Intronic
997216659 5:132117118-132117140 TGGCTTTGTTTACACTGTGAGGG - Intergenic
997220346 5:132157202-132157224 CAGCTTTGTTTACACTGTGAGGG + Intergenic
997252302 5:132398484-132398506 GGGCTTTGTTTACACTGTGAGGG - Intergenic
998691608 5:144594523-144594545 CAGGTTTGTTTACACTGTGAGGG + Intergenic
998752080 5:145333553-145333575 TGGCTTTGTTTACAGTTAGAGGG + Intergenic
998768227 5:145512354-145512376 TGGATTTGTTTACACTGTGAGGG - Intronic
998972768 5:147610966-147610988 TGGCTTTGTTTACACTGTGAGGG + Intronic
999030057 5:148281066-148281088 TGGCTTTGTTTACACTGTGAGGG + Intronic
999468680 5:151831507-151831529 CAGCTTTGTTTACACTGTGAGGG - Intronic
999488709 5:152026790-152026812 TGGCTTTGTTTACACTGTGAGGG + Intergenic
999502367 5:152160090-152160112 TGGCTTTGTTTACACTGTGAGGG + Intergenic
999602603 5:153283257-153283279 TGGCTTTGTTTACACTGTGCAGG - Intergenic
999688327 5:154122513-154122535 TGGCTTTGTTTACATTGTGTGGG - Intronic
1000194757 5:158946969-158946991 TGGCTTTGTTAACACTGTGAGGG + Intronic
1000376108 5:160583811-160583833 TGGCTTTGTTTACACTGTGAGGG + Intronic
1000406494 5:160893404-160893426 TGGCTTTGTTTACACTGGGAGGG - Intergenic
1000417471 5:160998039-160998061 AGGCTTTGTTTATACTTTGAGGG + Intergenic
1000582205 5:163048423-163048445 TGGCTTTGTTTACACTGTGAGGG + Intergenic
1000590049 5:163147088-163147110 CAGCTTTGTTTACACTGTGAGGG - Intergenic
1000798368 5:165693193-165693215 TGGCTTTGTTTACCCTGTGAGGG + Intergenic
1000996090 5:167960478-167960500 TGGCTTTGTTTACACTGTGAGGG + Intronic
1001015403 5:168136527-168136549 CTGCTGTGTTTACACAGTAAAGG + Intronic
1001346372 5:170903266-170903288 TGTCTTTGTTTACACTGTGAGGG + Intronic
1001362660 5:171103383-171103405 CAGCTTTGTTTACACTGTAAGGG + Intronic
1002677178 5:180926679-180926701 TGGCTTTGTTTACACTGTGAGGG - Intronic
1002734798 5:181377353-181377375 TGGCTTTGTTTACACTGTGGGGG + Intergenic
1002749732 6:96767-96789 TGGCTTTGTTTACACAGTGGGGG - Intergenic
1002818455 6:699702-699724 AGGGTTTGGTTTCACTGTGAAGG - Intergenic
1002944818 6:1750929-1750951 TGGCTTTGTTTACACTGTGAGGG - Intronic
1002996130 6:2286883-2286905 TAGCTTTGTTTACACTGTGAGGG - Intergenic
1003416881 6:5917628-5917650 TGGCTTTGTTTACAATGTGAGGG + Intergenic
1003713496 6:8619595-8619617 CAGCTTTGTTTACACTGCAAGGG + Intergenic
1004246000 6:13976354-13976376 CAGATTTCTTTACACTGAGAAGG + Intronic
1004593234 6:17073803-17073825 TGGCTTTGTTTACACTGTGAAGG - Intergenic
1004944465 6:20596445-20596467 CAGTTTTGTTTACACTGTGAGGG + Intronic
1005208537 6:23432602-23432624 CAGCTTTGTTTACACTGTGAGGG + Intergenic
1005274199 6:24198866-24198888 TGGCTTCGTTTACACTGTGAGGG - Intronic
1006199979 6:32279574-32279596 TGGCTTCCTTAACACTGTGAGGG - Intergenic
1007195593 6:40057063-40057085 CAGCTTTGTTTACACCATGAGGG + Intergenic
1007858147 6:44879283-44879305 CAGCTTTGCTTACACTGTGAGGG - Intronic
1008407582 6:51136225-51136247 GGGCTTTGTTTACACTGTGAGGG + Intergenic
1008425213 6:51349090-51349112 CAGCTTTGTTTACACTGTGAAGG + Intergenic
1008575450 6:52856335-52856357 TGGCTTTGTTTACACTGTGAGGG + Intronic
1008785122 6:55158663-55158685 TGGCTTTGTTTACACTGTGAGGG - Intronic
1008865431 6:56204331-56204353 TGGCTTTGTTTACACTGTGAGGG - Intronic
1008896829 6:56565978-56566000 GCAGTTTGTTTACACTGTGAGGG + Intronic
1008997857 6:57679852-57679874 CAGCTTTGTTTACACTGTGAGGG - Intergenic
1009054344 6:58316832-58316854 TAGCTTTGTTTACACTGTGAGGG - Intergenic
1009186344 6:60579190-60579212 CAGCTTTGTTTACACTGTGAGGG - Intergenic
1009236792 6:61133747-61133769 TAGCTTTGTTTACACTGTGAGGG + Intergenic
1009264125 6:61532150-61532172 TGGCTTTATTTATACTGTGAGGG - Intergenic
1009305890 6:62089003-62089025 CAGCTTTGTTTACACTGTGAGGG + Intronic
1009455274 6:63849044-63849066 TGGCTTTGTTTACACTGTGAGGG - Intronic
1009458770 6:63887996-63888018 AAGCTTTGTTTACACTGTGAGGG - Intronic
1009492729 6:64312237-64312259 TGGCTTTGTTTACACTGTGAGGG - Intronic
1009536686 6:64896808-64896830 CGGCTTTGTTCACACTGTGAGGG - Intronic
1009718255 6:67428232-67428254 GGGTTTTGTTTACACGGTGAGGG + Intergenic
1009727854 6:67558125-67558147 TGGCTTTGTTCACTCTGTGAGGG + Intergenic
1009777097 6:68218737-68218759 TGGTTTTGTTTATACTGTGAGGG + Intergenic
1009795053 6:68456091-68456113 AGGCTTTGTTTACACTGTGAGGG + Intergenic
1009945347 6:70336408-70336430 TGGCTTTGTTTACTCTGTGAGGG + Intergenic
1010039134 6:71361103-71361125 AGGCTTTGTTTATACTGTGAGGG + Intergenic
1010459479 6:76097904-76097926 TGGCTTTGTTTACACTGTAAGGG - Intergenic
1010574957 6:77518873-77518895 TGGCTTTGTTTACACTGTGAGGG - Intergenic
1010681792 6:78807421-78807443 AGGCTTTGTTTACACTGTGAGGG + Intergenic
1010822675 6:80433441-80433463 GGGCTTTGTTTATACTGTAAGGG + Intergenic
1010994021 6:82512637-82512659 TGGCTTTGTTTACACTGTGAGGG - Intergenic
1011020681 6:82809275-82809297 TACCTTTGTTAACACTGTGAGGG + Intergenic
1011065508 6:83321508-83321530 TGGCTTTATTTACACTGTGAGGG - Intronic
1011086493 6:83546835-83546857 CAGCTTTGTTTACACTATGAGGG - Intergenic
1011139215 6:84134140-84134162 AGGCTTTGTTTATGCTATGAGGG + Intronic
1011302632 6:85892411-85892433 TGGCTTTGTTTACACTGTGAGGG + Intergenic
1011318681 6:86065569-86065591 AGGCTTTGTTTACATTATGAGGG + Intergenic
1011332740 6:86228148-86228170 TGGCTTTGTTTACACTGTGATGG + Intergenic
1011333669 6:86236872-86236894 TGGCTTTGTTTACACTTTGAGGG - Intergenic
1011340288 6:86306668-86306690 TGGCTTTGTTTACACTGTGAAGG + Intergenic
1011387670 6:86815415-86815437 TGGCTTTGTTTACACTGTGAGGG + Intergenic
1011578204 6:88827749-88827771 AGGCTTTGTTTACACTGGGAGGG - Intronic
1011776780 6:90739541-90739563 TGGCTTTGTTTACACAGTGAGGG + Intergenic
1011975907 6:93298263-93298285 ATGGTTTGTTTACAATGTGAAGG - Intronic
1012043424 6:94239040-94239062 CAGTTTTGTTTACACTGTGAGGG - Intergenic
1012083058 6:94785222-94785244 TTGCTTTGTTTACACTGTGAGGG + Intergenic
1012127925 6:95454031-95454053 AGGCTTTGCATACACTGTGAGGG + Intergenic
1012597104 6:101053933-101053955 AAGCTTTGTTTACACTGTGAGGG + Intergenic
1012644395 6:101661257-101661279 CGGCTTTGTTTACACTGTGAGGG + Intronic
1012778009 6:103522253-103522275 CGGCTTTGTTTACACTGTGAGGG - Intergenic
1013038004 6:106405241-106405263 CAGCTTTGTTTACACTGTGAGGG - Intergenic
1013390252 6:109679313-109679335 AGGCTTTGTTTACACTGTGAGGG - Intronic
1013453004 6:110303522-110303544 AGGCTTTGTTTACACTGTGAGGG - Intronic
1013625655 6:111934749-111934771 CGGCTTTATTTACACTGTGAGGG + Intergenic
1013672634 6:112421735-112421757 TGGCTTTCTTTACATTGTGAGGG - Intergenic
1013682608 6:112541691-112541713 CTGCTTTGTTTACTTTGTGAGGG - Intergenic
1013920135 6:115394369-115394391 TGGCTTTGTTTACACTGTGAGGG + Intergenic
1013939606 6:115645507-115645529 CGGCTTTGTTTATGCTGTGAGGG - Intergenic
1013956925 6:115852659-115852681 AGGCTTTGTTTATATTGTGAGGG - Intergenic
1013964223 6:115935705-115935727 CAGCTTTGTTTAGACTGTGAGGG - Exonic
1013972917 6:116042105-116042127 TGGCTTTGTTTACACTGTGAGGG - Intronic
1014129084 6:117810780-117810802 TGGCTTTGTTTACACTGTGAGGG + Intergenic
1014278852 6:119418300-119418322 TGGCTTTGTTTACACTGTGAGGG - Intergenic
1014352657 6:120363548-120363570 CAGCTTTGTTTACACTGTGAGGG + Intergenic
1014387057 6:120815977-120815999 TAGCTTTGTTTATACTGTGAGGG + Intergenic
1014413407 6:121153776-121153798 TGGCTTGTTTTACATTGTGAGGG + Intronic
1014466337 6:121760850-121760872 CAGCTTTGTTCAGGCTGTGAGGG - Intergenic
1014569054 6:122986548-122986570 GGGCTTTGTTTATGCTCTGAAGG - Intergenic
1014872615 6:126614828-126614850 AGGCTTTGTTTACACTGTGAGGG + Intergenic
1014902413 6:126984022-126984044 GGTGTTTGTTTACGCTGTGAGGG - Intergenic
1014922440 6:127228845-127228867 CGGCTTTGTTCACACTGTGAGGG - Intergenic
1014968147 6:127782081-127782103 TGGCTTTGTTTACATTGTTAGGG + Intronic
1015108922 6:129569337-129569359 CAGCTTTGTATACACTGTAAGGG - Intergenic
1015211328 6:130701977-130701999 TGGCTTTGTTTACACTGTGAGGG - Intergenic
1015291092 6:131538920-131538942 TAGCTTTGTTTACACTGTGAGGG - Intergenic
1015386985 6:132635483-132635505 AGGCATTGTTTACACTGTGAGGG - Intergenic
1015433205 6:133154847-133154869 CAGCTTTGTTTACACTGTGAGGG + Intergenic
1015471884 6:133614969-133614991 TGGCTTGGTTTACACTGTGAGGG - Intergenic
1015500775 6:133931044-133931066 CAGTTTTGTTTACACTGTGAGGG - Intergenic
1015623385 6:135156118-135156140 TGGCTTTGTTTACACTGTGAGGG + Intergenic
1015802088 6:137070491-137070513 CAGCTTTGTTTACACTGTGAGGG - Intergenic
1015883270 6:137891174-137891196 CGGCTTTGTTTACACTGTGAGGG + Intergenic
1016241879 6:141940454-141940476 CAGTTTTGTTTACACTGTGAAGG - Intergenic
1016483479 6:144508020-144508042 AGGCTTTGTTTACACTGTGAGGG + Intronic
1016638695 6:146324176-146324198 CAGCTTTGTTTACACTGGGAGGG + Intronic
1016856007 6:148671343-148671365 CAGCTTTGTTTACATTGTGAGGG + Intergenic
1017322639 6:153111298-153111320 CGGCTTTGTTTAGACTGTGAGGG - Intronic
1017571424 6:155748951-155748973 TAGCTTTGTTTACACTGTGAGGG - Intergenic
1018094508 6:160373790-160373812 AGGCTTTGTTTACACGGTGAGGG + Intronic
1018108732 6:160514046-160514068 GGGCATTGTTTACACTGTGAAGG - Intergenic
1018114620 6:160571657-160571679 CGGTTTTGCTTACACTGTGAGGG + Intronic
1018507820 6:164490743-164490765 CGGCTTCATTTACACTGTGAGGG + Intergenic
1019071891 6:169353637-169353659 CAGCGTTGTTTACACCATGAGGG + Intergenic
1019239056 6:170649673-170649695 TGGCTTTGTTTACACAGTGGGGG + Intergenic
1020333424 7:7042493-7042515 CGGCTTTGTTTACAATGTGAGGG - Intergenic
1020367225 7:7393735-7393757 CAACTTTCTTTACATTGTGAGGG + Intronic
1020391398 7:7662092-7662114 CATCTTTGTTTACACTGTGAGGG + Intronic
1020487656 7:8738908-8738930 CAGCTTTGTTTACACTGTGAGGG + Intronic
1020519575 7:9169155-9169177 TGGCTTCGTTTACACTGTGAGGG + Intergenic
1020629752 7:10625725-10625747 CAGCTTTCTTTACACCGTGAGGG - Intergenic
1020639908 7:10742278-10742300 AGGCTTTTTTTACACTGTGAGGG - Intergenic
1020693809 7:11391381-11391403 TGACTTTATTTACACTGTGAAGG + Intronic
1020753406 7:12170640-12170662 AAGCTTTGTTTACACTGTGAGGG + Intergenic
1020823835 7:13002746-13002768 TGGCTTTGTTTACAAGGTGAGGG + Intergenic
1020874257 7:13673802-13673824 CAGCTTTGTTTACACTGTGAGGG + Intergenic
1020935506 7:14459060-14459082 TGGCTTTGTTTACACTGTGAGGG - Intronic
1021099537 7:16572053-16572075 CGGCTTTGTTAACACTGTGAGGG - Intronic
1021166999 7:17354226-17354248 TGGCTTGCTTTACATTGTGAGGG + Intergenic
1021322326 7:19227259-19227281 TAGCTTTGATTACACTGTGAGGG - Intergenic
1021483959 7:21146900-21146922 AGGCTTTGTTTACACTGGGAGGG - Intergenic
1021502312 7:21345088-21345110 CTGCTTTATTTACACTGTGAGGG + Intergenic
1021749336 7:23779619-23779641 TGGCTTTGTTTACACTGTGAGGG + Intronic
1021782297 7:24118092-24118114 TGGCTTTGTTTGCACTGTGAGGG + Intergenic
1022058839 7:26770237-26770259 TGGCTTTGTTTACACTATGAGGG + Intronic
1022848450 7:34235418-34235440 TGGCTTTGTTTACACTGTGAGGG + Intergenic
1022869132 7:34457572-34457594 CGGCTTTGTTTACACTGTGAGGG - Intergenic
1023051741 7:36258609-36258631 CGGCTTTGTTTACATTGTGAGGG + Intronic
1023511613 7:40959450-40959472 CAGCTTTGTTTACACTGTGAGGG + Intergenic
1023697756 7:42865213-42865235 TGGCTTTGTTTACACTGTGAGGG + Intergenic
1024372905 7:48606987-48607009 GGGCTTTGTTTACACTTTGAGGG + Intronic
1024495457 7:50041015-50041037 CAGCTTTATTTACACTGTGAGGG - Intronic
1024664893 7:51536546-51536568 CAGCTTTGTTTACACTGTGAGGG + Intergenic
1024950503 7:54855809-54855831 TGGCTTTGTTTACACTATGAGGG + Intergenic
1024998513 7:55294696-55294718 TGGCTTTGTTTACACTATGAGGG + Intergenic
1025621379 7:63174780-63174802 TAGCTTTGTTTACACTGTGAGGG + Intergenic
1025909114 7:65813166-65813188 TGACTCTGTTTCCACTGTGAGGG + Intergenic
1026488149 7:70838531-70838553 GGGCTTTGTTTACACTGTGAGGG - Intergenic
1027446059 7:78274722-78274744 CAGCTTTATGTACACTGTGAGGG + Intronic
1027510349 7:79071744-79071766 TGGCTTTGTTTACACTGTGAGGG + Intronic
1027582896 7:80020480-80020502 AGGCTTTGTTTACACTGTGAGGG - Intergenic
1027637093 7:80689400-80689422 CATCTTTGTTTATACTGTAAGGG - Intergenic
1027790405 7:82633745-82633767 TGGCTTTGTTTACACTGAGAGGG - Intergenic
1027843366 7:83341982-83342004 AAGCTTTGTTTACACTGTGAGGG - Intergenic
1027864561 7:83629574-83629596 TGGCTGTGTTTATACTGTGAAGG + Intronic
1027910712 7:84246139-84246161 TGGCTTTGTTTACACTCAGTTGG + Intronic
1028142359 7:87288191-87288213 TGGCTTTGTTTACACTGTCTGGG + Intergenic
1028144308 7:87304714-87304736 CAGCTTTTTTTACACTGTGAGGG - Intergenic
1028327035 7:89540317-89540339 TGGCTTTGTTTACACTGTGATGG - Intergenic
1028429948 7:90735608-90735630 TGGCTTTGTTTACACTGTGAGGG + Intronic
1028627950 7:92898498-92898520 CAGCTTTGTCTACACTGTGTGGG + Intergenic
1028630258 7:92926465-92926487 GGGCTTTGTTTACACTGTGAGGG + Intergenic
1028648272 7:93121688-93121710 TGGCTTTGTTTACACTGTGAGGG - Intergenic
1028652834 7:93170193-93170215 CAGCTTTGTGTACCCTGTGAGGG + Intergenic
1028801389 7:94969929-94969951 TGGCTTTGTTTACACTGTGAGGG + Intronic
1028806029 7:95026866-95026888 CTGCTTTGTTTACACTGTGAGGG + Intronic
1028991267 7:97051267-97051289 CGGCTTTGTTTCCACTGTGAGGG - Intergenic
1029324741 7:99796496-99796518 CAGCTTTGTTTACACCGCGAAGG + Intergenic
1029816991 7:103106608-103106630 TGGCTTTGTTTACACTGTGAGGG - Intronic
1029845242 7:103405961-103405983 TGGCTTTGTTTACACTGTGAGGG + Intronic
1029851096 7:103462528-103462550 TGGCTTTGTTTACACTGTGAGGG + Intergenic
1029854846 7:103504935-103504957 TGGCTCTGTTTACACAGTGAAGG - Intronic
1030141026 7:106304269-106304291 TGGCTTTGTTTACACTGTGAGGG + Intergenic
1030159550 7:106493230-106493252 TGGCTTTGTTTACACTGTGAGGG - Intergenic
1030325834 7:108217702-108217724 TGGGTTTGTTTACACTGTGAAGG + Intronic
1030534041 7:110744116-110744138 TGGCTTTGTTTACACTGTGAGGG - Intronic
1030703066 7:112662344-112662366 CGTCTTTGTTTACACTGTGAGGG + Intergenic
1030705624 7:112689948-112689970 CGGCTTTGTTTACACTGTGAGGG + Intergenic
1030771098 7:113475693-113475715 CCACTTTGTTTACACTGTGAAGG + Intergenic
1030801351 7:113856627-113856649 AGGCTTTGTTTACACTGTAAGGG - Intergenic
1030958862 7:115889506-115889528 AGGCTTTGTTTACACTGTGAGGG - Intergenic
1031397728 7:121293288-121293310 CGGTTTTGTTTACACTGTGAGGG + Intronic
1031613758 7:123856968-123856990 TGGCTTTGTTTACACTTTGAGGG + Intronic
1031711014 7:125046659-125046681 CAGCTTTGTTTACACTGTGAGGG - Intergenic
1031902708 7:127428544-127428566 AGGCTCTGTTTACACTGTGAGGG + Intronic
1032312572 7:130802308-130802330 TGGCTTTGTTTACACTTTGAGGG + Intergenic
1032604048 7:133330204-133330226 TGGCATTGTTTACTCTGTGAGGG + Intronic
1032659740 7:133970127-133970149 TGGCTTTGTTTACACTGTGAGGG + Intronic
1032883454 7:136114612-136114634 TAGCTTTATTTACACTGTGAGGG + Intergenic
1032893330 7:136222838-136222860 TGGCTTTGTTTACACTGTGAGGG - Intergenic
1032957103 7:136984222-136984244 AGGCTTTGTTTGCACTGTGAGGG + Intronic
1032966459 7:137103746-137103768 CGGCTTTGTTTACACTGTGAGGG - Intergenic
1033525624 7:142210546-142210568 TGGCTTTGTTTACACTGTGAGGG - Intronic
1034097690 7:148425066-148425088 TGACTTTTTTTACACTGTGAGGG - Intergenic
1034314498 7:150117440-150117462 TGGCTTTGTTTACACTGTGAGGG - Intergenic
1034365510 7:150542989-150543011 TGGCTTTGTTCATATTGTGAGGG - Intergenic
1034715101 7:153234774-153234796 CGGCTTTGTTTACACTGTGAGGG + Intergenic
1034792398 7:153983329-153983351 TGGCTTTGTTTACACTGTGAGGG + Intronic
1035508714 8:156936-156958 TGGCTTTGTTTACACAGTGGGGG - Intergenic
1035710763 8:1712237-1712259 AGGCTTTGTTTACACGGTGAGGG - Intergenic
1035998304 8:4573905-4573927 CAGCTATGTTTACACTGTGAGGG + Intronic
1036553793 8:9839030-9839052 TGGCTTTGTTTACACTGTGAGGG - Intergenic
1036558018 8:9876946-9876968 CAGCTTTGTTTACACTGTGAGGG - Intergenic
1037258274 8:16979600-16979622 AGGCTTTGTTTACACTGTAAGGG + Intergenic
1037285462 8:17294235-17294257 AGGCTTTGTTTACACTGTGAGGG + Intronic
1037664539 8:20956647-20956669 TGGCTTTGTTTACACTGGGGGGG - Intergenic
1037719662 8:21431711-21431733 GAGCTTTGTTTACACTGTGAGGG - Intergenic
1038211589 8:25523399-25523421 CAGCTTTGTTTAAACTGTGAGGG - Intergenic
1038265502 8:26036755-26036777 AGGCTTTGTTTACACAGCAAAGG - Intronic
1038306699 8:26410062-26410084 CTGCTTTATTTACTCTGTGGAGG + Intronic
1038936437 8:32257067-32257089 GTGCTTTATTTACACTGTGAGGG + Intronic
1039133859 8:34297928-34297950 TAGCTTTGTTTACACTGTGAGGG - Intergenic
1039284571 8:36026727-36026749 CGACTTTGTTTACACTGTGAGGG - Intergenic
1039510948 8:38091391-38091413 CGGTTCTGTTTGCACTGTCAGGG + Intergenic
1039754825 8:40512221-40512243 TGGCTTTGTTTACACTGTGAGGG + Intergenic
1039932365 8:42005342-42005364 AGGCTTTATTTATACTGTTACGG - Intronic
1040355019 8:46608789-46608811 CAGCTTTGTTTACACTCTGAGGG - Intergenic
1040473851 8:47759908-47759930 TGTCTTTGTTTACACTGTGAGGG + Intergenic
1040520081 8:48169150-48169172 TGGCTTTGTTTATACTGTGAGGG + Intergenic
1040779914 8:51095328-51095350 CAGCTTTGTTTACACTGTGAGGG - Intergenic
1040943032 8:52852442-52852464 TGGCTTTGTTTACACTGTGAGGG + Intergenic
1040968795 8:53112266-53112288 CGGCTTTGTTTACACTGTGAGGG + Intergenic
1041155071 8:54977245-54977267 CAGTTTTGTTTACACTGTGAGGG - Intergenic
1041323296 8:56637099-56637121 CAGCTTTGTTTACACTGTGTGGG + Intergenic
1041423569 8:57695530-57695552 CAGCTTTGTTTACACTGTGAGGG - Intergenic
1041459732 8:58098326-58098348 CAGCTTTGTTTATGCTGTGAGGG + Intronic
1041630559 8:60082717-60082739 AGGCTTTGTTTACACTGTGAGGG + Intergenic
1041666326 8:60448425-60448447 AGGCTTTGTTTACACTGTGAGGG - Intergenic
1041836649 8:62223780-62223802 GGGCTTTGTTTACACTGTGAGGG - Intergenic
1041838323 8:62242018-62242040 GGGCTTTGTTTACACTGTGAGGG + Intergenic
1041900620 8:62978498-62978520 CAGCTTTGTTTACACTGTGAGGG + Exonic
1041944332 8:63424558-63424580 CGGCTTTGTTTACACTGGAAGGG - Intergenic
1042070797 8:64931193-64931215 CAGCTTTGTTTACACTGTGAGGG + Intergenic
1042110941 8:65380302-65380324 TGGCTTTGTTTATGCTGTGAGGG - Intergenic
1042195587 8:66228893-66228915 AGGCTTTGTTTACACTGTGAAGG - Intergenic
1042327150 8:67540786-67540808 CAGCTTTGTTTACACTGTGAAGG + Intronic
1042478819 8:69280552-69280574 TGGCTTTGTTTACACTGTGTGGG - Intergenic
1042627149 8:70770696-70770718 TGGCTTTGTTTACACTGTGAGGG + Intronic
1042812898 8:72845721-72845743 CAGCTTTGATTACACCGTGAGGG + Intronic
1042946192 8:74156862-74156884 CAGCTTTGTTTACACTGTGAGGG - Intergenic
1042969297 8:74390965-74390987 TGGCTTTGTTTACACTATGAGGG + Intronic
1043036661 8:75208107-75208129 TGGCTTCCTTAACACTGTGAGGG + Intergenic
1043366308 8:79537222-79537244 TGGCTTTGTTTACACTGTGAAGG + Intergenic
1043368258 8:79560435-79560457 GGGCTTTGTTTACACTATGAGGG + Intergenic
1043647235 8:82536149-82536171 CAGCTTTGTTTACACTGTGAGGG + Intergenic
1043703626 8:83322143-83322165 TGGCTTTGTTTACATTGTGAGGG - Intergenic
1044131110 8:88525545-88525567 AGGCTTTGCTTACACTGTGAGGG - Intergenic
1044503573 8:92991110-92991132 TGGCTTTGTTTACACTGGGAGGG - Intronic
1044509459 8:93058246-93058268 CAGCTTTGTTTACACTGTGAGGG + Intergenic
1044595244 8:93953052-93953074 CAGCTTTGTTTACATAGTGAGGG + Intergenic
1044940241 8:97334922-97334944 TGGCTTTGTTTACACTGTAAGGG + Intergenic
1044961029 8:97530534-97530556 AGGCTTTATTTACACTGTGAGGG - Intergenic
1045151771 8:99416198-99416220 TGGCTTTGTTTACACTGTGTGGG + Intronic
1045185167 8:99830382-99830404 AGGCTTTGTTTACACTGTGAGGG + Intronic
1045199678 8:99967589-99967611 CGGTTTACTTAACACTGTGAGGG - Intronic
1045390594 8:101710623-101710645 TGGCTTTGTTTACACTGTGAGGG - Intronic
1045783695 8:105897329-105897351 TGGCTTTGTTTACACTGTGAGGG - Intergenic
1045797716 8:106065443-106065465 TAGCTTTGTTTACACTGTGAAGG - Intergenic
1045839359 8:106561333-106561355 TGGCTTTGTTTATACTGTGAGGG - Intronic
1045973348 8:108104141-108104163 CGGCTTTGTTTACACTGTGAGGG - Intergenic
1045975082 8:108122808-108122830 CAGCTTTGTTTACACTATGAGGG + Intergenic
1046067968 8:109218792-109218814 CGGCTTTGTTTACACTATGAGGG + Intergenic
1046106509 8:109672889-109672911 TGGCTTTGTTTACACTGTGTGGG - Intronic
1046219941 8:111201018-111201040 TGGCTTTGTTTACACTGTGAGGG - Intergenic
1046277824 8:111985935-111985957 AGGCTTTGCTTATACTGTGAGGG - Intergenic
1046295876 8:112218483-112218505 CAGCTTTGTTTACACTGTGAGGG - Intergenic
1046947460 8:119987800-119987822 TGGCCTTGTTTACACTGTGAGGG + Intronic
1046972529 8:120238390-120238412 CAGCTTTGTTTACACTGTGAGGG + Intronic
1047133689 8:122051721-122051743 CAGTTTTATTTACACTGTGAGGG - Intergenic
1047369569 8:124245333-124245355 TGGCTTTGTTTACACTGTGAGGG + Intergenic
1047635205 8:126754274-126754296 CAGCTTTGCTTCCTCTGTGATGG + Intergenic
1048467066 8:134674456-134674478 CAGCTTTTGTTACACTGTGAGGG - Intronic
1048914105 8:139165456-139165478 CTGCTTTGTTTACACTGTGAGGG + Intergenic
1049130871 8:140839299-140839321 GGGCTTTGTTTACACTGCTGCGG - Intronic
1050141541 9:2521287-2521309 TAGCTTTATTTACACCGTGAGGG + Intergenic
1050201332 9:3148791-3148813 TGGCTTTGTTTAGACCGTGAGGG + Intergenic
1050234378 9:3562673-3562695 TGGTTTTGTTTACCCTATGAGGG + Intergenic
1050239888 9:3624118-3624140 TGGTTTTGTTTACACTATGAGGG + Intergenic
1050300496 9:4253390-4253412 TGGCTTTGTTTACACTATGAGGG + Intronic
1050369019 9:4901867-4901889 CAGCTTTGTTTACACTGTGAGGG + Intergenic
1050391960 9:5153398-5153420 TGGCTTTGTTTACACCGTGAGGG - Intronic
1050450855 9:5779852-5779874 TGGCTTTGTTTACACTGTGAGGG - Intronic
1050637420 9:7626862-7626884 CAGCTTTTTTTACACTGTGAGGG - Intergenic
1050700175 9:8329792-8329814 TGGCTTTGTTTACACTGTGAGGG + Intronic
1050750604 9:8932654-8932676 CGGCTTTGTTTACACTGTGAGGG + Intronic
1050852071 9:10300622-10300644 TGGCTTTGTTTACACTGTGAGGG - Intronic
1050943142 9:11485534-11485556 TGGCTTTCTTCACACTGTGAGGG + Intergenic
1050973905 9:11912193-11912215 TGGCTGTGTTTACACTGTGAGGG + Intergenic
1051230476 9:14950088-14950110 CGGCTTTGTTTACACTGTGAGGG - Intergenic
1051321933 9:15914429-15914451 AGGCTTTGTTTAAACTGTGAGGG + Intronic
1051548740 9:18305564-18305586 CGGCTTTGTTTACACTGTGAGGG - Intergenic
1051611637 9:18967527-18967549 TGGCTTTGTTTACACTGTAAGGG + Intronic
1051674568 9:19546469-19546491 TGGCTTTGTTTACACTGTCAGGG + Intronic
1051695802 9:19767076-19767098 TGACTTTGTTTCCACTGTGAGGG + Intronic
1051814333 9:21087580-21087602 CAGCTTTTTTTACACCGTGAGGG - Intergenic
1051940211 9:22496232-22496254 CAGCTTTGTTTACACTGTGAGGG + Intergenic
1051998481 9:23248093-23248115 GGTCTTTGTTTACACTGTGACGG - Intergenic
1052052706 9:23866386-23866408 TGACTTTGTTTACGCTGTGAGGG + Intergenic
1052061534 9:23966434-23966456 TGGCTTTGTTTACACTGTGAGGG + Intergenic
1052096573 9:24391262-24391284 TGGCTTTGTTTACACCCTGAGGG + Intergenic
1052125122 9:24765181-24765203 TGGCTTTGTTTACACTGTGAGGG + Intergenic
1052134096 9:24889136-24889158 TGGCTTTGTTTACACTGTGAGGG - Intergenic
1052146885 9:25061093-25061115 TGGCTTTGCATACGCTGTGAGGG + Intergenic
1052241387 9:26277761-26277783 TGGCTTTGTTTACACTGTCAGGG - Intergenic
1052281207 9:26735353-26735375 AGGCTTTGTTTATGCTATGAGGG + Intergenic
1052326501 9:27221128-27221150 TGACTTTTTTTACATTGTGAGGG - Intronic
1052329402 9:27251854-27251876 TGGGTTTGTTTACCCCGTGAGGG - Intergenic
1052336376 9:27324395-27324417 CTGCTTTGTTTATACTGTGAGGG + Intergenic
1052366182 9:27614716-27614738 CAGCTTTGTTTACACCGTGAGGG + Intergenic
1052382326 9:27784988-27785010 AGGCTTTGTTTATACTGTGAAGG + Intergenic
1052667999 9:31519161-31519183 GGGCTTTGTTTACACAGTAAGGG + Intergenic
1052746657 9:32448306-32448328 AGACTTTGTTTACACTGTGAGGG + Intronic
1052752756 9:32508958-32508980 TGGCTTTGTTTACACTGTGAGGG - Intronic
1053608152 9:39681171-39681193 CAGCTTTGTTTACACTGTGAGGG + Intergenic
1053865993 9:42437531-42437553 CAGCTTTGTTTACACTGTGAGGG + Intergenic
1054162174 9:61681308-61681330 TGGCATTGTTTACACTTTGCAGG - Intergenic
1054245379 9:62661238-62661260 CAGCTTTGTTTACACTGTGAGGG - Intergenic
1054559508 9:66695769-66695791 CAGCTTTGTTTACACTGTGAGGG - Intergenic
1054719868 9:68593929-68593951 CAGCTTTGTTTACACTGTGAGGG + Intergenic
1054889140 9:70232854-70232876 CGGCTTTCTTTACACTGTGAAGG - Intergenic
1054985980 9:71262298-71262320 GGGCTTTGTTTACACTGTGAGGG + Intronic
1055061438 9:72072856-72072878 CAGCTTTGTTTACACTGTGAGGG - Intergenic
1055125701 9:72716545-72716567 CAACTTTGTGTACACTGTGAGGG + Intronic
1055210328 9:73783406-73783428 TGGCTTTGTTTACACTGTGAGGG - Intergenic
1055239236 9:74163853-74163875 TGGCTTTGTTTACACAGTGTGGG - Intergenic
1055386827 9:75771724-75771746 TGGCTTTGTTTACACTATGAGGG + Intergenic
1055390934 9:75821526-75821548 TGGCTTTGTTTACACTGTGAGGG + Intergenic
1055494584 9:76841655-76841677 CAGCTTTGTTTACACTATGAGGG - Intronic
1055537867 9:77267949-77267971 CAACTTTGTTTACACTGTGAGGG + Intronic
1055571790 9:77624127-77624149 CTGCTTTGTTTACACTGTGAGGG - Intronic
1055628767 9:78201306-78201328 AGGCTTTGTTTACACTGTGAGGG - Intergenic
1056000991 9:82216250-82216272 CAGCTTTGTTTTCACTGTGAGGG - Intergenic
1056003515 9:82242783-82242805 TGGCTTTCTTTACACTGTGAGGG + Intergenic
1056123749 9:83514320-83514342 CAGCTTTGTTTACACTGTGAGGG - Intronic
1056176772 9:84043847-84043869 TGGCTTTGTTTATACTGTGAGGG + Intergenic
1056302620 9:85257931-85257953 CAGCTTTGTTCACACTGTGAGGG + Intergenic
1056320929 9:85433774-85433796 TGGCTTTGTTTACACTGTAAGGG - Intergenic
1057460334 9:95254935-95254957 CGGCTTTGTTTACGCTGTCAGGG - Intronic
1057957108 9:99419011-99419033 CAGATTTGTTTACACTGCGGAGG - Intergenic
1058029286 9:100177483-100177505 TGGCTTTGTTTACACTGTGAGGG - Intronic
1058034569 9:100237141-100237163 AGGCTTTGTTTACACTGTGAGGG + Intronic
1058072860 9:100619395-100619417 TGGCTTTCTTTACACCGTGAGGG + Intergenic
1058093268 9:100829542-100829564 CGGCTTTGTTTACACTGTGAGGG + Intergenic
1058182530 9:101815874-101815896 TGGCTTTGTTTACACTGTGAGGG - Intergenic
1058393200 9:104520531-104520553 CAGCTTTCTTTACACTATGAGGG - Intergenic
1058408478 9:104703818-104703840 TGGCTTTGTTTACACTGTGAAGG - Intergenic
1058492362 9:105516053-105516075 CAGCTTTGTTTACACTATGAGGG - Intronic
1059088864 9:111334651-111334673 CGGCTTTGTTTACACTGTGAGGG - Intergenic
1059513365 9:114870067-114870089 AGGCTTTGTTTACACTGTGAGGG - Intergenic
1060289942 9:122292645-122292667 GGGCTTTATTCTCACTGTGATGG + Intronic
1061300629 9:129702969-129702991 ATGCTGTGTTTACACTTTGAAGG - Intronic
1062297619 9:135841207-135841229 CGGCTTTGTTTACACTGTGAGGG - Intronic
1062759261 9:138329963-138329985 TGGCTTTGTTTACACAGTGGGGG + Intergenic
1203599711 Un_KI270748v1:736-758 TGGCTTTGTTTACACAGTGGGGG + Intergenic
1186181306 X:6975982-6976004 CAGCTTTGTTTACGCTGTGAGGG + Intergenic
1186354216 X:8773312-8773334 CAGCTTTGTTTACCCTGTGAGGG - Intergenic
1186370004 X:8937174-8937196 TGGCTTTGTTTACACTGTGAGGG + Intergenic
1186599791 X:11024576-11024598 TGGCTTTGTTTACACTGTGTGGG + Intergenic
1186773301 X:12839140-12839162 CAGCTTTGTTTACACTGTGAGGG + Intergenic
1186960937 X:14736017-14736039 TGACTTTGTTTACACTGTGAGGG + Intergenic
1187660865 X:21545244-21545266 AGGCTTTGTTTACACTGTGAGGG - Intronic
1187729051 X:22234548-22234570 TGGCTTTGTTTACACTGTGAGGG + Intronic
1187729546 X:22238625-22238647 TGGCTTTGTTTACACTGTGAGGG - Intronic
1187784330 X:22867038-22867060 TGGCTTTGTTTACACTGTGAGGG - Intergenic
1187839931 X:23476674-23476696 CGGCTTTGTTTACAATCTGAGGG + Intergenic
1188084144 X:25882730-25882752 ATGCCTTGTTTACACTGTGAGGG - Intergenic
1188193228 X:27197343-27197365 CGGGTTTGTTTACAGTGTGAAGG - Intergenic
1188201700 X:27299879-27299901 TGACTTTGTTTACAGTGTGAGGG - Intergenic
1188561230 X:31470932-31470954 CGGCTTTGTTTACACTGTGAGGG + Intronic
1188664649 X:32804331-32804353 CGACTTTGTTTACACTGTGAGGG - Intronic
1188893281 X:35636145-35636167 TGGCTTTGTTCACACTTTGAGGG + Intergenic
1188921910 X:35987392-35987414 AGGCTTATTTTACACTGTGAGGG + Intronic
1189189649 X:39089163-39089185 CGGCTTTGTTTACACTGTGAGGG - Intergenic
1189243362 X:39542521-39542543 TAGCTTTGTTTACACTGTGAGGG - Intergenic
1189575093 X:42343153-42343175 TGGTTTTGTTTACACTGTGAGGG + Intergenic
1189590656 X:42507388-42507410 TGGCTTTGTTTACACTGTGAGGG - Intergenic
1189754150 X:44253480-44253502 CAGCTTTGTTTACACTGTGAGGG - Intronic
1189937778 X:46087478-46087500 CAGCTTTGTTTACACTGTGAGGG - Intergenic
1190341452 X:49299793-49299815 AGGCTTTGTTCATAATGTGAGGG + Intronic
1190495071 X:51020845-51020867 TGGCTTTGTTTACACCATGAGGG + Intergenic
1190505892 X:51125582-51125604 TGGCTTTGTTTACACTGTGAGGG - Intergenic
1190959755 X:55234602-55234624 TGGCTTTGTTTACACTGTAATGG + Intronic
1191005090 X:55702781-55702803 CAGCTTTGTTTACACTGTGAGGG - Intergenic
1191024285 X:55896751-55896773 TGGCTTTGTTTATGCTGTGAGGG - Intergenic
1191072014 X:56410808-56410830 CAGCTTTGTTTACACTGGGAGGG + Intergenic
1191088705 X:56597448-56597470 CAGCTTTGTTTATACTGTGAGGG + Intergenic
1191112007 X:56811538-56811560 CAGCTTTGTTTACACTGTAAGGG + Intergenic
1191113925 X:56832367-56832389 CAGCTTTGTTTACACTGTGAGGG + Intergenic
1191119751 X:56890980-56891002 CATCTTTGTTTACACTGTGAGGG - Intergenic
1191135394 X:57058705-57058727 CACCATTGTTTACACTGTGAGGG + Intergenic
1191206723 X:57842440-57842462 ATACTTTGTTTACACTTTGATGG - Intergenic
1191601760 X:63016690-63016712 TGCCTTTGTTTACACTGTGAAGG + Intergenic
1191606262 X:63066001-63066023 TGGCTTTGTTTACACTGTGAGGG - Intergenic
1191631961 X:63331385-63331407 AGGCTTTGTTTACAGTGAGAGGG - Intergenic
1191657455 X:63613826-63613848 TGGCGTTGTTTACACTGTGGGGG - Intergenic
1191676642 X:63798134-63798156 TGGCTTTGTTTATGCTGTGAGGG - Intergenic
1191686750 X:63899805-63899827 CATCTTTGTTTACACTGTGAGGG - Intergenic
1191705132 X:64086045-64086067 CAGCTTTGTTTACACTGTGAGGG - Intergenic
1191762612 X:64661977-64661999 CTGATTTGTTTACACTGTGAAGG + Intergenic
1191788755 X:64945862-64945884 TGGCTTTGTTTACACTGTGTGGG + Intronic
1191793788 X:64999798-64999820 AGGATTTATTTACACTGTGAGGG - Intronic
1191795667 X:65018892-65018914 CAGCTTTGTTTATACTCTGAGGG - Intronic
1191799913 X:65066922-65066944 TGGCTCTGTTTACACTGTGAGGG + Intergenic
1191824857 X:65353821-65353843 TGACTTTGTTTACACTGTGAGGG - Intergenic
1191848588 X:65569103-65569125 GGGCTTTGTTTACACTGTGAGGG + Intergenic
1191872929 X:65765162-65765184 TGGCTTTGTTTACACTGTGAGGG + Intergenic
1191931347 X:66376426-66376448 TTGCTTTGTTTACACTGTGAGGG + Intergenic
1191947765 X:66554150-66554172 CAGCTGTGTTTACACTGTAAGGG - Intergenic
1191969682 X:66799389-66799411 CGACTTTGTTTACAGTGTGAGGG - Intergenic
1191984851 X:66968837-66968859 TGACTTTATTTACACTGTGATGG - Intergenic
1192009267 X:67250555-67250577 TAGCTCTGTTTACACTGTGAGGG - Intergenic
1192020600 X:67386744-67386766 CAGCTTAGTTTACACTGTGAGGG - Intergenic
1192064266 X:67864520-67864542 AGGCTTTGTTTACACTGTGAGGG + Intergenic
1192128965 X:68530248-68530270 TGGCTTTCTTTACACTGTGAGGG + Intronic
1192228474 X:69246266-69246288 TGGCTTTGTTTGCACTATGAGGG - Intergenic
1192524559 X:71830323-71830345 GGGCTTTATTTACACTGTTAGGG - Intergenic
1192637174 X:72830901-72830923 AGGCTTTGTTTACACAGTGAGGG + Intronic
1192644540 X:72889913-72889935 AGGCTTTGTTTACACAGTGAGGG - Intronic
1192712599 X:73607264-73607286 CAGGTTTGTTTACGCTGTGAGGG + Intronic
1192741038 X:73892889-73892911 TGGCTTTGTTTACACCGTGAGGG - Intergenic
1192884259 X:75320335-75320357 CAGCTTCGTTTACACTGTGAGGG + Intergenic
1192922738 X:75724380-75724402 GGGCTTTGCTTACACTGTGAGGG + Intergenic
1192938006 X:75881431-75881453 AAGCTTTGTTTATACTGTGAGGG + Intergenic
1192958162 X:76095628-76095650 CAGCTTTGTTTACACTGTGAGGG + Intergenic
1192964180 X:76159669-76159691 CGGCTTTGTTTACACTGTGAGGG - Intergenic
1192966535 X:76183062-76183084 AGGCTTTGTTTACACTGTGAGGG + Intergenic
1192974964 X:76273473-76273495 TGGCTTCATTTACACTGTGAGGG + Intergenic
1192977652 X:76303203-76303225 TAGCTTTGTATACACTGTGAGGG + Intergenic
1192984297 X:76380063-76380085 AGGGTTTGTTTACACCGTGAGGG - Intergenic
1192992135 X:76471593-76471615 TAGCTTTGTTTACACTTTGAGGG - Intergenic
1192999610 X:76550227-76550249 CAGCTTTGTTTACACTGTGAGGG + Intergenic
1193003638 X:76591205-76591227 CAGTTTTGTTTACATTGTGAGGG + Intergenic
1193010651 X:76671391-76671413 TGGCTTTGTTTATATTGTGAGGG - Intergenic
1193034489 X:76934584-76934606 TGGCTTTGTGTACACTGTGAGGG - Intergenic
1193060145 X:77197240-77197262 CAGCTTTGTTTACACTGTGAAGG + Intergenic
1193068602 X:77283186-77283208 CAGCTTTCTTTACACCGTAAGGG - Intergenic
1193075200 X:77347843-77347865 TGTCTTTGTTTACACTGTGAGGG - Intergenic
1193079357 X:77390562-77390584 GGGCTTTGTTTACACTGCGAGGG - Intergenic
1193254016 X:79325446-79325468 CGGCTTTGTTTACACTGTGAAGG + Intergenic
1193266859 X:79482371-79482393 GGGCTTTGTTTACACTGTAAGGG - Intergenic
1193350854 X:80462840-80462862 CAGCTTTGTTTATGCTGTGAGGG - Intergenic
1193352030 X:80474936-80474958 CAGCTTTGTTTACACTGTGAGGG + Intergenic
1193355978 X:80520978-80521000 CCGCTTTGTTTACATTGTGAGGG + Intergenic
1193389182 X:80906462-80906484 CAGCTTTGTTTACACTGCGAGGG - Intergenic
1193394483 X:80967961-80967983 GGGGCTCGTTTACACTGTGAGGG - Intergenic
1193409339 X:81143856-81143878 TGGCTTTGTTTACATGGTGAGGG - Intronic
1193525277 X:82581117-82581139 TGGCTTTGTTTACACTGTGAGGG + Intergenic
1193547951 X:82852569-82852591 TGGCTTTGTTTACACTATGATGG + Intergenic
1193562675 X:83038148-83038170 CGGCTTTGTTTATTCTGTGTGGG - Intergenic
1193646784 X:84079683-84079705 TGGCTTTGTTTACGCTGTCAGGG - Intronic
1193685443 X:84571839-84571861 CGGCTTTGTTTACACTGTGAGGG - Intergenic
1193774221 X:85622802-85622824 TGGCTTTGTTTACACTGTGGCGG - Intergenic
1193830017 X:86278900-86278922 AGGCTTTGTTTACACTGTGAGGG - Intronic
1193878743 X:86896211-86896233 TGGCTTTGTTTAAACTGTGAGGG - Intergenic
1193897284 X:87128963-87128985 TGCCTTTGTTTACACTATGAGGG - Intergenic
1193906738 X:87253702-87253724 AAGCTTTATTTACACTGTGAGGG + Intergenic
1193949343 X:87778770-87778792 TGGCTTTGTTTACACTGTGAGGG - Intergenic
1194021267 X:88694872-88694894 AGACTTTGTTTACAGTGTGAAGG - Intergenic
1194139871 X:90196317-90196339 CAGCTTTGTTTACACTGTGAAGG - Intergenic
1194158554 X:90422781-90422803 CAGCTTTGTTTACACTGTGAGGG - Intergenic
1194175720 X:90645863-90645885 TGGGTTTGTGTACACTTTGATGG + Intergenic
1194203530 X:90983666-90983688 TGGCTTTGGTTACATTGTGAGGG - Intergenic
1194203566 X:90983888-90983910 AGGCTTTGTTTACACTGTGAGGG - Intergenic
1194208491 X:91039955-91039977 CAGCTTTGTTTACACTGTGAGGG + Intergenic
1194242579 X:91470145-91470167 TGGCTTTGTTTACACTGTGAAGG - Intergenic
1194254689 X:91622106-91622128 AGGCTTTTTTTACACTTTTAGGG + Intergenic
1194355794 X:92882330-92882352 TGGCTTTGTTTACACTGTGAGGG - Intergenic
1194391177 X:93319792-93319814 TGGCTTTGTTAACACTGTGAGGG - Intergenic
1194419940 X:93661066-93661088 TGGCTTTGTTTACCCTGTGGGGG - Intergenic
1194472924 X:94319736-94319758 CGGCTATTTTCACACTGTGGGGG - Intergenic
1194515319 X:94844974-94844996 CAGCTTTGTTTACACTGTGAGGG + Intergenic
1194559560 X:95403757-95403779 TAGCTTTGTTTACACTGTGAGGG - Intergenic
1194576341 X:95618702-95618724 TGGCTTTGTTTACACTGTGAGGG + Intergenic
1194652626 X:96533623-96533645 TGGCTTTGTTTACACTGTGAGGG - Intergenic
1194771814 X:97915617-97915639 CGGCTCTGTTTACACTACGAGGG - Intergenic
1194783119 X:98049139-98049161 TAGCTTTGTTCACACTGTGAGGG + Intergenic
1194798381 X:98240621-98240643 CGGCTTTGTTTACACTGTGAGGG + Intergenic
1194837459 X:98698894-98698916 TGACTTTGTATACGCTGTGAGGG + Intergenic
1194954400 X:100162357-100162379 CAGCTTCCTTAACACTGTGAGGG + Intergenic
1194959057 X:100214555-100214577 TGGCTTTGTTTACACTGTGAGGG + Intergenic
1194961028 X:100236246-100236268 AGGCTTTGTTTACATTGTGAGGG + Intergenic
1194996503 X:100596824-100596846 CAGCTTTTTTTATATTGTGAAGG - Intronic
1195102316 X:101567219-101567241 CGGCTTTGTATACACTGTGAGGG - Intergenic
1195344942 X:103940439-103940461 AGGCTTTGTTTACACTGTGAGGG + Intronic
1195434680 X:104828911-104828933 CGGCTTTGTTTACCCTGTTAGGG + Intronic
1195519234 X:105812230-105812252 TGGCTTTGTTTACACTGTGAGGG + Intergenic
1195580273 X:106493604-106493626 CGGTTTTGTTTACTCTGTGAGGG + Intergenic
1195774811 X:108391468-108391490 TGGCTTTGTTTACACTGTGAGGG + Intronic
1195810622 X:108824999-108825021 TGGCTTTGTTTACACTGTGAAGG + Intergenic
1195832743 X:109077681-109077703 TGACTTTGTTTACACTCTGAGGG + Intergenic
1195833719 X:109089042-109089064 TGGCTTTGTCTACACTGTGAGGG + Intergenic
1195948199 X:110238405-110238427 CGGCTTTGTTTACACTGTGAGGG - Intronic
1195985585 X:110626674-110626696 TGGCTTTGTGTACACTGTGAGGG - Intergenic
1196269793 X:113697693-113697715 CAGCTTTCTTTACACTGTGAGGG + Intergenic
1196273152 X:113735783-113735805 CCCCTTTGTTTACACTGTGAGGG + Intergenic
1196281165 X:113825298-113825320 GGGCTTTGTTTACACTATGAGGG + Intergenic
1196312392 X:114183840-114183862 TGGCTTTGTTTACACTGTGAGGG - Intergenic
1196367799 X:114942995-114943017 TGGCTTTGTTTATACTGTGAGGG + Intergenic
1196467064 X:115983343-115983365 GGGCTTTGTTTACACTGTGAAGG - Intergenic
1196545712 X:116962359-116962381 CTGCTTTGTTTACACTGTGAGGG + Intergenic
1196571290 X:117268706-117268728 TGGCTTTGTTTACACTGTGAGGG - Intergenic
1196602934 X:117622869-117622891 AAGCTTTATTTACACTGTGAGGG + Intergenic
1196946580 X:120832844-120832866 CGGCTTTGTTTACACTGTGCGGG + Intergenic
1196960204 X:120992834-120992856 CAGCTTTGTTTACACTGTGAGGG + Intergenic
1197004076 X:121474661-121474683 TGGCTTTTTTTACACTGTGCAGG + Intergenic
1197142208 X:123130002-123130024 CGACTTTGTTTACACTGTGAGGG - Intergenic
1197157237 X:123283603-123283625 TGGCTTTGTTTACACTGTGAGGG - Intronic
1197191107 X:123648672-123648694 CAGCTTTGTTTACACTGTGAGGG - Intronic
1197350119 X:125372532-125372554 TGGTTTTGTTTACACTGTGAGGG + Intergenic
1197614292 X:128674806-128674828 TGGCTCTGTTTACACTGTGAGGG + Intergenic
1197847059 X:130814101-130814123 TGGCTTTGTTTACAGTGTGAGGG - Intronic
1197880743 X:131164193-131164215 TGGCTTTGTTTACACTGTGAGGG + Intergenic
1197906263 X:131428622-131428644 TGGCTTTTTTTACACTGTGAGGG - Intergenic
1197926948 X:131656591-131656613 TGCCTTTGTTTACACTGTGATGG - Intergenic
1197929646 X:131680951-131680973 GAGTTTTGTGTACACTGTGAGGG + Intergenic
1197945817 X:131839446-131839468 GAGTTTTGTGTACACTGTGAGGG - Intergenic
1198085636 X:133279289-133279311 AGGCTTTGTTTACACTGTGAGGG - Intergenic
1198519008 X:137433738-137433760 TAGCTTTGTTTACGCTGTGAGGG - Intergenic
1198555829 X:137792392-137792414 TGGCTTTGTTTGCACTGTGAGGG - Intergenic
1198678766 X:139158468-139158490 CAGCTTTCTTTACACTGTGAGGG - Intronic
1199012169 X:142770557-142770579 TGGCTTTGTTTACACTGTGAGGG + Intergenic
1199094483 X:143723833-143723855 CAGCTTTGTTGACACTGTGAGGG - Intergenic
1199436615 X:147819732-147819754 GGGCTTTGTTTACACTGTGAGGG - Intergenic
1199469805 X:148181824-148181846 CAGCTTTGTTTACACTGTGAGGG + Intergenic
1199477350 X:148260185-148260207 TGGCTTTGTTTACACTGTGAGGG + Intergenic
1200333236 X:155319917-155319939 TGGCTTTGTTTACACTGTGAGGG - Intronic
1200388483 X:155918090-155918112 CCACTCTGTTTACACAGTGAGGG + Intronic
1200485618 Y:3765286-3765308 CAGCTTGGTTTACACTGTGAAGG - Intergenic
1200504870 Y:3999749-3999771 CAGCTTTGTTTACACTGTGAGGG - Intergenic
1200522361 Y:4226821-4226843 TGGGTTTGTGTACACTTTGATGG + Intergenic
1200549360 Y:4559105-4559127 CGGCTTTGGTTACATTGTGAGGG - Intergenic
1200549396 Y:4559327-4559349 AGGCTTTGCTTACACTGTGAGGG - Intergenic
1200573475 Y:4861709-4861731 AGGCTTTTTTTACACTGTTAGGG + Intergenic
1200664141 Y:5999311-5999333 TGGCTTTGTTTACACTGTGAGGG - Intergenic
1201312831 Y:12612382-12612404 CAGCTTCCTTAACACTGTGAGGG - Intergenic
1201371463 Y:13269289-13269311 AGGCTTTGTTTACGCTGTGAGGG + Intronic
1201394751 Y:13536614-13536636 TGACTTTGTTTACACTGTGAGGG + Intergenic
1201406150 Y:13652326-13652348 CAGCTTTGTTTATACTGTGAGGG + Intergenic
1201462277 Y:14239655-14239677 TGGCTTTGTTTATACTGTGAGGG - Intergenic
1201511559 Y:14769907-14769929 AGGCTTTGTTTACACTGTGAGGG - Intronic
1201519630 Y:14859344-14859366 AGGCTTTGTTTACACTGTGAGGG - Intergenic
1201563584 Y:15343647-15343669 TGGCTTTGTTTACATTGTGAGGG + Intergenic
1201611883 Y:15852075-15852097 AGGCTTTGTTTACACTGTGAAGG - Intergenic
1201689988 Y:16752799-16752821 CAGCTTTGTTTACACTGTGAGGG + Intergenic
1201707154 Y:16949951-16949973 CAGCTTTGTTTACATTGTGAGGG - Intergenic
1201850915 Y:18478780-18478802 TGGCTTTGTTTATACTGTAAAGG + Intergenic
1201854070 Y:18521355-18521377 CAGCTTTCTTAACACTGTGAGGG - Intergenic
1201879251 Y:18799029-18799051 CAGCTTTCTTAACACTGTGAGGG + Intronic
1201882404 Y:18841598-18841620 TGGCTTTGTTTATACTGTAAAGG - Intergenic
1201922201 Y:19245665-19245687 TGGCTTAATTTACACTGTGATGG - Intergenic
1201961914 Y:19690263-19690285 TGGCTTTGTTTACACTGTGAGGG + Intergenic
1201979342 Y:19890735-19890757 CAACTGTGTTTACCCTGTGAGGG + Intergenic
1202057294 Y:20848323-20848345 CGGCTTTGTTTACACTGTGAGGG + Intergenic
1202330628 Y:23748934-23748956 TGGCTTTGTTTACACTCTGAAGG - Intergenic
1202335193 Y:23801367-23801389 CAGCTTTGTTTACACTATGAGGG - Intergenic
1202347927 Y:23954641-23954663 TGGCTTTGTTTACACTGTGAAGG - Intergenic
1202522847 Y:25715463-25715485 TGGCTTTGTTTACACTGTGAAGG + Intergenic
1202535574 Y:25868692-25868714 CAGCTTTGTTTACACTATGAGGG + Intergenic
1202540141 Y:25921127-25921149 TGGCTTTGTTTACACTCTGAAGG + Intergenic