ID: 1062297621

View in Genome Browser
Species Human (GRCh38)
Location 9:135841212-135841234
Sequence ACAGTGTAAACAAAGCCGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1917
Summary {0: 32, 1: 408, 2: 637, 3: 476, 4: 364}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062297614_1062297621 16 Left 1062297614 9:135841173-135841195 CCACCATTACTGAGGCTTGAGTA 0: 377
1: 1425
2: 1153
3: 673
4: 763
Right 1062297621 9:135841212-135841234 ACAGTGTAAACAAAGCCGCCAGG 0: 32
1: 408
2: 637
3: 476
4: 364
1062297616_1062297621 13 Left 1062297616 9:135841176-135841198 CCATTACTGAGGCTTGAGTAGGT 0: 224
1: 1946
2: 1882
3: 1130
4: 1039
Right 1062297621 9:135841212-135841234 ACAGTGTAAACAAAGCCGCCAGG 0: 32
1: 408
2: 637
3: 476
4: 364

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062297621 Original CRISPR ACAGTGTAAACAAAGCCGCC AGG Intronic
902141568 1:14361211-14361233 ACAGTGTAAACAAAGCTGCCAGG - Intergenic
902163455 1:14550977-14550999 AAAGTGTGAACAAAGTAGCCGGG - Intergenic
903566897 1:24274528-24274550 ACAGTGTAAACAACGCCTCTGGG - Intergenic
904301496 1:29557451-29557473 ACAGTGTGAGCAAAGGCACCTGG + Intergenic
906557873 1:46728704-46728726 ACAGTGTAAACAAAGCCTCAGGG + Intergenic
906586768 1:46985070-46985092 ACAGTGTAAACTAAGCAGCAGGG + Intergenic
906753219 1:48285206-48285228 ACAGTGTAAACAAAGCTGCCGGG - Intergenic
906835023 1:49074013-49074035 ACAGTGTAAACACAGCCACCGGG - Intronic
906843079 1:49160828-49160850 GCAGTGTAAATAAAGCCACCTGG - Intronic
906890647 1:49709335-49709357 ACAGTATAAACACAGCCTCCGGG - Intronic
906901112 1:49837334-49837356 ACAGTATAAACAAAGCTGCCAGG - Intronic
907015200 1:51005585-51005607 ACAGTGTAAACAAAGCCACTTGG + Intergenic
907565650 1:55430926-55430948 ACAGTGTAAACAAAGACACTGGG + Intergenic
907953557 1:59206846-59206868 ACAGTGTAAACAAAGCCACCAGG + Intergenic
908584606 1:65554490-65554512 ACAGTGTAAACAAGGTCTCTGGG - Intronic
908592887 1:65652345-65652367 ACAGCATAAACAAAGCCACCAGG + Intergenic
909260605 1:73484664-73484686 ACTGTGTAAAGAAAGCCTACTGG + Intergenic
909301141 1:74014762-74014784 ACAGTGTAAACAAAGCCACAGGG + Intergenic
909457087 1:75861938-75861960 ACAGTGTAAACAAAGTGGCAGGG - Intronic
909491636 1:76232880-76232902 ACTGTGTAAAGACAGCCTCCTGG - Intronic
909536407 1:76741415-76741437 ACAGTGTAAACACAGCTGCCGGG - Intergenic
909672420 1:78203769-78203791 ACAGTGTAAACAAAGCAGCCAGG + Intergenic
909707829 1:78608146-78608168 ACAGTGTAAACAAAGAGGCCAGG + Intergenic
910177217 1:84443432-84443454 ACAGTGTAAACAAAGCCACCAGG + Intergenic
910331017 1:86072372-86072394 ACAGTGTAAACAAAGCTGCCAGG + Intronic
910392768 1:86761754-86761776 AGAGTGTAGTCAAAGCCCCCAGG + Intergenic
910805717 1:91188418-91188440 ACAGTGTAAGCAAAGCTGCTGGG - Intergenic
910915126 1:92279936-92279958 ACAGTGTAAACAAAGAGGCCTGG + Intronic
910924993 1:92388863-92388885 ACAGTGTAAACAAAGCAGCAGGG + Exonic
911120628 1:94293129-94293151 ACAGTGTAAACAAAGCGGCAGGG - Intergenic
911217983 1:95216473-95216495 ACAGTGTAAACAGAGCTGCCAGG - Intronic
911270670 1:95797576-95797598 ACAGTGTAAACAAAGCCACGTGG + Intergenic
911541343 1:99161989-99162011 ACAGTGTAAACAAAGTAGCCAGG - Intergenic
911596106 1:99800560-99800582 ACAGTGTAAACAAAGTGGCAGGG - Intergenic
911632673 1:100200269-100200291 ACAGTGTAAATAAAGCCACAGGG + Intronic
911689825 1:100820425-100820447 GCAGCGTAAACAAAGCTGCAGGG + Intergenic
911692028 1:100845419-100845441 GCAGTGTAAATAAAGCCACAGGG - Intergenic
911813409 1:102312468-102312490 ACTAGGTAAACAAAGCAGCCAGG - Intergenic
911941880 1:104057437-104057459 ACAGTGTAAACAAAGCCACCAGG + Intergenic
911982765 1:104586738-104586760 ACAGTGTAAACAAAGCCATAGGG + Intergenic
912076711 1:105884465-105884487 ACAGTATAAATAAAGCTGCCAGG - Intergenic
912150535 1:106853613-106853635 ACAGTGTAAACAAAGCCACTGGG + Intergenic
912235352 1:107844666-107844688 ACAGTATAAACAAAGCCTCCAGG + Intronic
912271024 1:108209223-108209245 ACAGTGTAAACAGAGCCCCCAGG - Intergenic
912301380 1:108520517-108520539 ACAGTGTAAATAAAGCCGCTGGG - Intergenic
912323849 1:108739334-108739356 AAAGTGTAAATAAAGTAGCCAGG + Intronic
912493034 1:110072509-110072531 ACAATTTAAACAAGGCAGCCTGG + Intronic
912675814 1:111679767-111679789 ACAATGTAAACAAAGCCTCCGGG + Intronic
912894856 1:113575968-113575990 ACAGTGTTAAGGAAGCCGCCAGG - Intronic
912966261 1:114239939-114239961 ACAGTGAAAACAAAGCCACATGG + Intergenic
913036280 1:114969417-114969439 ACAGTGTAAACAAAGCCACAGGG - Intronic
913108642 1:115639250-115639272 ACAGTGTAAAGAAAGCCACTGGG - Intergenic
913430087 1:118781056-118781078 ACAGTGTAAACAAAGCCACCAGG - Intergenic
913507043 1:119526656-119526678 ACAGTGTAAACAAAGCCACTGGG - Intergenic
913512502 1:119574330-119574352 ACAGTGTAAAGAAAGAGGCTGGG + Intergenic
913607412 1:120478631-120478653 ACAGTGTAAACAAAGTGGTAGGG + Intergenic
913720363 1:121586931-121586953 ACAGTGTAAACAAAGCCACCAGG - Intergenic
913987929 1:143582946-143582968 ACAGTGTAAACAAAGTGGTAGGG - Intergenic
914458070 1:147855210-147855232 ACAGTGTAAACAAAGCCGCTGGG + Intergenic
914583782 1:149043203-149043225 ACAGTGTAAACAAAGTGGTAGGG - Intronic
914967114 1:152269927-152269949 ACAGTATAAACAAAGCTGCCAGG - Intergenic
914969253 1:152292190-152292212 ACAGTATAAACAAAGCTGCCAGG + Intergenic
915077339 1:153320049-153320071 ATAGTGTAAATAAAGCTGCCGGG - Intergenic
915649096 1:157294588-157294610 ACAGTGCAAACAAAGCTGTTGGG + Intergenic
915651576 1:157315726-157315748 ACTGTGTAAACAAAGCCACAGGG + Intergenic
915654473 1:157348048-157348070 ACAATGTAAACAAAGCTGCTGGG - Intergenic
915807020 1:158864777-158864799 ACAGTGTTAACAAAGAAGCCAGG + Intergenic
915992249 1:160529727-160529749 ACAGTGTAAACAAAGCTGCCAGG - Intergenic
916359570 1:163952917-163952939 ACAGTGTAAACAAAGCTGTGGGG + Intergenic
916362887 1:163990645-163990667 ACAGTGTAAACAAAGCCTCCTGG + Intergenic
916379682 1:164195797-164195819 ACAGTGTAAACAAAGACTCTGGG + Intergenic
916406295 1:164500841-164500863 ACAGTGTAAACAAAGCCAACAGG + Intergenic
916460775 1:165022079-165022101 ACTAGGTAAACAAAGCAGCCTGG - Intergenic
916469499 1:165109215-165109237 ACAGTGCAAACAAAGCAGCAGGG - Intergenic
916534503 1:165690838-165690860 ACTAGGTAAACAAAGCAGCCAGG + Intronic
916545683 1:165801757-165801779 ACAGTGTAAACAAAGCCACTGGG + Intronic
916625583 1:166552197-166552219 ACAGTGTAAACAAAGCCACCAGG - Intergenic
916645884 1:166784808-166784830 ACAGTGTAAACAAAGCAGCAGGG - Intergenic
916878706 1:168998349-168998371 ACAGTGTAAACAACGCCTCTGGG - Intergenic
916938566 1:169656627-169656649 ACAGTGTAAACAAAGTTGCCGGG + Intergenic
917009753 1:170457839-170457861 ACAGTGTAAACAAAGCTGCCTGG - Intergenic
917019392 1:170569538-170569560 ACAGTGTAAACAAAGCCACCAGG + Intergenic
917023356 1:170614307-170614329 ATAGTGTAAACAAAGCCACCAGG - Intergenic
917091749 1:171359898-171359920 AGAGTGTAAATAAAGCCACCAGG + Intergenic
917157960 1:172025164-172025186 ACAGTGTAAACAAAGCCACTGGG + Intronic
917357772 1:174144232-174144254 ACAGTATAAACAAAACTGCCGGG + Intergenic
917401357 1:174653075-174653097 ACAGTGTAAACAAAGCCTCTGGG - Intronic
917405981 1:174709034-174709056 ACAGTGTAAACAAAGCCTCCAGG + Intronic
917464321 1:175261903-175261925 ACAGTGTAAACAAAGCGGCAGGG - Intergenic
917579824 1:176364575-176364597 CCAGTGGAAAGAAAGCTGCCAGG - Intergenic
917584964 1:176416947-176416969 AAAGTGTAAACAAGGCTGCCAGG - Intergenic
917915231 1:179694712-179694734 ACAGTGTAAACAAAGCCACCAGG + Intergenic
918167226 1:181961704-181961726 ACAGTGTAAACAAAGCCGCTTGG - Intergenic
918360384 1:183751340-183751362 GCAGTGTAAACAAAGCCATTGGG - Intronic
918501484 1:185201028-185201050 ACAGTGTAAACAAAGCCCCCAGG - Intronic
918612823 1:186512194-186512216 ACAGTGTAAACAAACCCATGGGG - Intergenic
918684416 1:187397177-187397199 ACAGTGTAAATAAACCCGCCAGG + Intergenic
918906786 1:190506159-190506181 GCGGTGTAAACAAAGCCACTGGG - Intergenic
919063908 1:192668610-192668632 ACAGTGTAAACAAAGCAGCAGGG - Intergenic
919146762 1:193645173-193645195 ACAGTGTAAACAAAGCCTCCAGG - Intergenic
919461649 1:197884296-197884318 ACAGTGTAAACAAAGCTGCCTGG - Intergenic
920302948 1:205000570-205000592 ACAGTGTAAGGAAAGGGGCCAGG - Intronic
920428680 1:205899800-205899822 ACAGCATAAACAAAGCTGCCAGG + Intergenic
920631841 1:207659996-207660018 ACAGTGTAAACAAAGCGCCAGGG + Intronic
920643359 1:207776033-207776055 ACAGTGTAAACAAAGAGAACTGG - Intronic
920985606 1:210885756-210885778 ACAGTATAAAAAAAGCTGCAGGG + Intronic
921296836 1:213712292-213712314 ACAGTGTAAACAAAGCTGCCAGG - Intergenic
921401367 1:214727427-214727449 ACAGTGTAAACAAAGCCACAGGG - Intergenic
921461537 1:215432910-215432932 ACAGTGTAAACAAAGCCACCAGG - Intergenic
921484841 1:215703590-215703612 ACAGTGTGAACAAAGCCACCAGG - Intronic
921626199 1:217380028-217380050 ACAGTGTAAACAAAGCCGCTGGG + Intergenic
921631362 1:217437596-217437618 ACAGTGTAAACAAAGCTGCTGGG + Intronic
921943123 1:220863884-220863906 ACAGTGTAAACAAAGACGCAAGG - Intergenic
921962253 1:221047798-221047820 ACAGTGTAAACAAAACTGTCAGG + Intergenic
921976347 1:221207262-221207284 ATAGTGTAAACAAAGCCGCCAGG + Intergenic
922186402 1:223278544-223278566 AGAAGGTAAACAAAGCAGCCTGG + Intronic
922380013 1:225013732-225013754 ACAGTGTAAACAAAGCCCCTGGG - Intronic
922397511 1:225217563-225217585 AAAAGGTAAACAAAGCGGCCTGG - Intronic
922666557 1:227474260-227474282 ACAGTGTAAACAAAGCCGCAGGG + Intergenic
922675947 1:227550095-227550117 ACAGTGTAAACAAAGTCACCAGG + Intergenic
922691928 1:227699991-227700013 ACAGTGTAAACAAAGCCTCCAGG + Intergenic
922716026 1:227872550-227872572 ACAGTGTAAACAAAGCCTCCGGG + Intergenic
923061229 1:230476406-230476428 ACTGTGTAAACGCAGCTGCCAGG - Intergenic
923066949 1:230527044-230527066 ACAGTGTAAACAAAGCGGCCAGG - Intergenic
923421746 1:233822650-233822672 ACAGTGTAAACAAAGCCACTGGG + Intergenic
923690893 1:236192099-236192121 ACAGTGTAAACAAAGCCGCTGGG - Intronic
923853448 1:237820885-237820907 ACAATGTAAACAAAGCCACTGGG + Intronic
923947145 1:238900615-238900637 ACAGTGTAAACAAAGCAGCAGGG + Intergenic
924179964 1:241430727-241430749 ACAGTGTAAACAAAGCTGCCAGG - Intergenic
924254599 1:242169795-242169817 ACGGTGTAAACAAAGCAGCCAGG + Intronic
924296035 1:242587312-242587334 ACAGTGTAAACAAAGCTGCCAGG + Intergenic
924493986 1:244568620-244568642 ACAGTGGAAATAAAGCTGCCAGG - Intronic
924823095 1:247513287-247513309 ACTGTGTTAACAAAGCCACCGGG - Intronic
924828995 1:247572948-247572970 ACAGTGTAAACAAAGCCGCAGGG - Intronic
1063030273 10:2227700-2227722 AAAGTGTAAACTGAGCTGCCGGG + Intergenic
1064492864 10:15878190-15878212 ACAGTGTAAACAAGGAGGCCAGG - Intergenic
1064564953 10:16630627-16630649 ATGGTGTGAACAAAGCTGCCAGG - Intronic
1065074282 10:22061179-22061201 AGTATGTAAACAAAGCAGCCAGG + Intergenic
1065075986 10:22080062-22080084 ACAGTGTAAACAAAGCCACTGGG - Intergenic
1065119377 10:22513993-22514015 ACAGTGTAAACAAAGCTGCAGGG - Intergenic
1065427435 10:25619874-25619896 ACAGTGTGAACAAAGCCTCCAGG + Intergenic
1065621622 10:27587682-27587704 ACAGTATAAACAAAGGCACCAGG + Intergenic
1065651753 10:27899676-27899698 ACAGTGTAAACAAAGCCTCCAGG + Intronic
1066140799 10:32502006-32502028 ACAGTGTAAACAAAGCCGCCAGG - Intronic
1066149311 10:32598166-32598188 AATAGGTAAACAAAGCCGCCAGG - Intronic
1066159677 10:32714758-32714780 ACAGTGTAAACAAAGCTGCTGGG + Intronic
1066257625 10:33696062-33696084 ACAGTGTAACCAAAACCACTAGG - Intergenic
1066297561 10:34067947-34067969 ACAGTGTAAACAAAGCTGCAGGG + Intergenic
1066468028 10:35670482-35670504 ACAGTGTACACAAAGCCCAGAGG + Intergenic
1066993475 10:42539484-42539506 ACAGTGTAAACAAAGCTGCCTGG - Intergenic
1067209676 10:44249692-44249714 ACAGTGTAAACAGAGCTTCCAGG - Intergenic
1067231104 10:44411371-44411393 ACAGTGTAAACAAAGCAGCCGGG - Intergenic
1067236362 10:44453974-44453996 ACAGTGTAAACAACACTGCCAGG - Intergenic
1067325916 10:45266253-45266275 ACAGTGTAAACAAAGGGGCCAGG + Intergenic
1067332254 10:45333402-45333424 ACAGTGTAAACAAAACTGCAAGG - Intergenic
1067579544 10:47433593-47433615 ACAGTGTAAACAAAGCCACTGGG - Intergenic
1068086080 10:52375005-52375027 ACAGTGTAAACAAAGCCACTGGG - Intergenic
1068357091 10:55923288-55923310 ACAGTGTAAACAAAGCCCCTGGG - Intergenic
1068469943 10:57448256-57448278 ACAGTATAAACAAAACCACTGGG - Intergenic
1068495364 10:57779304-57779326 ACAGTGTAAACAAAGAGGCCGGG + Intergenic
1068567611 10:58593108-58593130 ACAGTGTAAAAAAAGCCACTGGG + Intronic
1068622973 10:59207477-59207499 ACAGTGTAAACAAAGCCACCAGG + Intronic
1068646211 10:59470785-59470807 ACAGGGTAAACAAAGCTGCTGGG + Intergenic
1068789140 10:61008552-61008574 AGAGTGTAAACAAAGTGGCAGGG - Intergenic
1068951586 10:62782669-62782691 ATAGTGTAAACAAAGCCCCTGGG + Intergenic
1069066800 10:63950306-63950328 AGTATGTAAACAAAGCAGCCAGG - Intergenic
1069093459 10:64229726-64229748 ACAGTGTAAACAAAGCTGCTGGG - Intergenic
1069139913 10:64810212-64810234 ACAGTGTAAACAAAGCCGCCAGG - Intergenic
1069264278 10:66438476-66438498 ACAGTGTAAACAAAGCCACCTGG - Intronic
1070349273 10:75576231-75576253 ACAGTGTAAACAAAGCCACCAGG + Intronic
1071190068 10:83089555-83089577 ACAATGTAAACAAAGCCACCCGG + Intergenic
1071272431 10:84020269-84020291 ACAGTGTAAACAAAGCCACCAGG + Intergenic
1071401771 10:85280162-85280184 ACAGTGTAAACAAAGCCACCAGG - Intergenic
1071844335 10:89505946-89505968 ACAGTGTAAACAAAGCCACTTGG + Intronic
1071975841 10:90955079-90955101 ACAGTGTAAACAAAGCTGTCTGG - Intergenic
1072044906 10:91644525-91644547 ACAGTGTAAACAAAGCTACTGGG + Intergenic
1072046356 10:91660081-91660103 TCAATGTAAACAAAGCTCCCAGG + Intergenic
1072365342 10:94703511-94703533 ACAGTGTAAACAAAACCTCTGGG - Intronic
1072375672 10:94813559-94813581 ACAGTGTAAACAAAGCCTCCAGG - Intronic
1072389542 10:94969206-94969228 ACAGTGTAAACAAAGCCTCCAGG - Intronic
1072394306 10:95023148-95023170 ACAGCATAAACAAAGCGGCAGGG - Intergenic
1072394680 10:95026558-95026580 ACAGTGTAAACAAAGCCACCAGG - Intergenic
1072404420 10:95136545-95136567 ACAGTGTAAAGAAAGCCACTGGG + Intergenic
1072493680 10:95934157-95934179 ACAGTGTAAACAAAGCCACGGGG - Intronic
1072876196 10:99175483-99175505 ACAGTGTAAACAAAGCAGCTAGG + Intronic
1073044975 10:100631711-100631733 AGAGAGAAAACAAAGCCGGCAGG + Intergenic
1073745892 10:106467700-106467722 ACAGTGTAAACAAAGCAGCAGGG + Intergenic
1073884202 10:108019558-108019580 ACAGTGTAAACAAAGCTGCTCGG + Intergenic
1074016744 10:109542344-109542366 ACAGTGTAAACAAAGACACCAGG - Intergenic
1074631446 10:115259288-115259310 ACTAGGTAAACAAAGCGGCCAGG - Intronic
1074648499 10:115491524-115491546 ACAGTGTAAACAAAGCCACTGGG - Intronic
1074668473 10:115758793-115758815 ATAGTGCAAACAAAACCACCAGG - Intronic
1074795492 10:116938943-116938965 ACAGTGTAAACAAAGCCACCAGG - Intronic
1074985156 10:118652052-118652074 ACAGTGTGAACAGAGCTGCCAGG - Intergenic
1075727775 10:124619304-124619326 ACTGTGTAAATAAAGCTTCCTGG - Exonic
1075983902 10:126766823-126766845 ACAGTGTAAACAAAGCTGCCAGG - Intergenic
1076106595 10:127828190-127828212 AGAGTGGAAACAAAGCAGCTGGG - Intergenic
1076389819 10:130090780-130090802 ACAGTGTAAACAAAGCCTCCAGG + Intergenic
1076397786 10:130153961-130153983 ACAGTGTAAACAAAGTGGCAGGG - Intronic
1077562031 11:3270191-3270213 ACAGTGTAAACAAAGCCCAGGGG - Intergenic
1077567925 11:3316011-3316033 ACAGTGTAAACAAAGCCCAGGGG - Intergenic
1077655660 11:4016719-4016741 ACAGTGTAAATAAAGTGGCAAGG - Intronic
1077696452 11:4397233-4397255 ACAGTGTAAACAAAACTGCTGGG + Intergenic
1077697352 11:4406453-4406475 AGTAGGTAAACAAAGCCGCCAGG - Intergenic
1077771265 11:5221641-5221663 AGCAGGTAAACAAAGCCGCCTGG - Intergenic
1078331469 11:10425866-10425888 ATAGTGTAAACAAAGCCACAGGG - Intronic
1078336369 11:10466403-10466425 ACAGTGTAAACAAAGCCACCAGG + Intronic
1078560426 11:12366419-12366441 ACAGTGTAAACAAAGAGGCCAGG + Intergenic
1078697774 11:13651718-13651740 ACAGTGTAAACAAAGCAGCAGGG + Intergenic
1078732885 11:13992333-13992355 ACAGTGTAAACAAAGCCACTGGG - Intronic
1078778049 11:14411721-14411743 TCATTGGAAACAAAGCCTCCAGG + Intergenic
1078965905 11:16341785-16341807 AAAGTGTAAACAAAGAAGTCAGG - Intronic
1079262528 11:18897384-18897406 ACAGTGTAAACAAAGCCACCTGG - Intergenic
1079510559 11:21205390-21205412 ACGGTGTAAACAAAGCCGCAGGG - Intronic
1079517883 11:21289855-21289877 ACAGTGTAAACAAAGCTGCCAGG + Intronic
1079577835 11:22025412-22025434 ACAGTGTAAACAATGTGGCAAGG + Intergenic
1079714917 11:23732261-23732283 ACAGTATAAACAAAGCTGAAGGG + Intergenic
1079799770 11:24854399-24854421 ATAGTGTAAACAAAGCTGCTGGG - Intronic
1080033593 11:27688186-27688208 ACAATGTAAACAAAGCCACTGGG - Intronic
1080201463 11:29676120-29676142 ACAGTCTAAACAAGACAGCCAGG + Intergenic
1080489461 11:32747599-32747621 ACCGTTTAAACAAAGCAGCAAGG - Intronic
1080736659 11:35022435-35022457 ACAGTGTAAACAAAGCAGCTGGG + Intergenic
1080977168 11:37356934-37356956 ACAGTGTAAACAAAGCAGTGTGG + Intergenic
1081080192 11:38731870-38731892 ACAGTGTAAACAAAGCAGCTGGG - Intergenic
1081094941 11:38921094-38921116 ACAGTGTAAACAAAGCTACTGGG - Intergenic
1081198811 11:40192815-40192837 ACAGTGTAAACAAAGCCACTGGG + Intronic
1081252334 11:40850906-40850928 ATAGTGTAAACAAAGCCACTGGG - Intronic
1081317717 11:41650867-41650889 ACAGTGTAAACAAGGCTACTGGG - Intergenic
1081363304 11:42205711-42205733 ACTGTGTAAACAAAGCTGCCAGG + Intergenic
1082117842 11:48346444-48346466 ATTATGTAAACAAAGCAGCCAGG + Intergenic
1082127821 11:48453585-48453607 TCAGCGTAAACAAAGCTGCCAGG - Intergenic
1082174476 11:49045852-49045874 AGTATGTAAACAAAGCGGCCTGG - Intergenic
1082249602 11:49963836-49963858 TCAGTGTAAACAAAGCTGCTGGG + Intergenic
1082561373 11:54624514-54624536 TCAGTGTAAACAAAGATGCCAGG - Intergenic
1082670717 11:56033488-56033510 ATAGTGTAAACAAAGCTGCCAGG + Intergenic
1082754741 11:57063218-57063240 ACTAGGTAAACAAAGCAGCCAGG + Intergenic
1082903595 11:58283089-58283111 ACAGTGCAAAAAAAGCCACCAGG - Intergenic
1083503435 11:63132974-63132996 ACAGTGTAAACAAAGTGGCTGGG - Intronic
1083510234 11:63202515-63202537 ACAGTGTAAACAAAGACACAAGG + Intronic
1083531593 11:63428255-63428277 ACAGTCTAAACAAAGCAACAGGG + Intergenic
1085003391 11:73061676-73061698 ACAGTATAAACAAAGCCTCTGGG + Intronic
1085433873 11:76481609-76481631 AGAGTATAAAGAAAGCCACCAGG + Intronic
1085683782 11:78603212-78603234 ACAGTGTAAACAAAGCCGCCAGG - Intergenic
1085827666 11:79865077-79865099 ACAGTGTAAACAAAGCCACCAGG + Intergenic
1085884464 11:80505938-80505960 ACAGTGTAAACAAAGCCGCAGGG + Intergenic
1086067904 11:82765696-82765718 ACAGTGTAAACGAAGCTACCAGG - Intergenic
1086086022 11:82956160-82956182 ACAGTGTAAACAAAGCCTCCAGG - Intronic
1086129216 11:83383331-83383353 ACAGTGTAAACAAAGCCACTGGG + Intergenic
1086298238 11:85395738-85395760 ACAGTGTAAACAAAGAGGCCAGG + Intronic
1086300322 11:85420709-85420731 ACAGTGTAAACAAAGCTGTCAGG - Intronic
1086312290 11:85548767-85548789 ACAGTATAAACAAAGACACTGGG - Intronic
1086348887 11:85924973-85924995 ACAGTGTAAACAAAGCCACTGGG + Intergenic
1086410727 11:86541509-86541531 ACAGTGTAAACAAAGCTGCTGGG + Intronic
1086421929 11:86645425-86645447 ACAGTGTAAACAAAGCCACCAGG + Intronic
1086442093 11:86838446-86838468 ACAGTGTAAACAAAGCTGCCAGG + Intronic
1086456848 11:86967742-86967764 ACAGTGTAAACAAAGCAGCAGGG - Intergenic
1086505313 11:87498057-87498079 ACAGTGTAAACAAAGTCACCGGG + Intergenic
1086532350 11:87800962-87800984 ACAGTATAAACAAAGCCACTGGG - Intergenic
1086608462 11:88725247-88725269 ACAGTGTAAACAAAGCCACCAGG + Intronic
1086645008 11:89209433-89209455 ACAGTGTAAACAAAGCAGCAGGG + Intronic
1086723444 11:90149908-90149930 TCAGTGTATACAAAGCCACAGGG - Intronic
1086732812 11:90270840-90270862 ACAGTATAAACAAACGCACCTGG - Intergenic
1086735646 11:90302421-90302443 TCAGTGTAAATAAAGCCACCAGG - Intergenic
1087003440 11:93444721-93444743 ACAGTGTAAACAAAGAGGCTGGG - Intergenic
1087305773 11:96487506-96487528 ACAGTGTAAACAAAGCCTCCGGG + Intronic
1087427789 11:98012749-98012771 ACAGTGTAAAGAAAGCCACTGGG + Intergenic
1087482395 11:98718126-98718148 AGAGTGTAAACAAAGCAGCAGGG - Intergenic
1087484881 11:98748377-98748399 ACAGTGTAAACAAAGCTGCTGGG + Intergenic
1087596135 11:100257148-100257170 ATAGTGTAAACAAAGCCACCTGG + Intronic
1087667802 11:101070687-101070709 ACAGTGTAAGCAAAACCACCTGG + Intronic
1087695281 11:101369584-101369606 ACAGTGTAAACAAAGCCACTGGG - Intergenic
1087703771 11:101466480-101466502 ACAGTGTAAACAAAACGGCCAGG - Intronic
1087712224 11:101567230-101567252 ACAGTATAAACAAAGCCCTGGGG + Intronic
1087830960 11:102819667-102819689 ATAGTGTAAACAAAGCCACCAGG - Intergenic
1087916778 11:103820468-103820490 AGTAGGTAAACAAAGCCGCCGGG - Intergenic
1087925159 11:103910946-103910968 AAAGTGTAAACAAAGCTACTGGG + Intronic
1088078293 11:105878693-105878715 ACATTGTAAACAAAGTCTCCAGG - Intronic
1088702560 11:112426420-112426442 ACAGTGTAAACAAAGTTACTGGG + Intergenic
1089285458 11:117404931-117404953 ACAGTGTAAACAAAGTCACCAGG - Intronic
1089766010 11:120766230-120766252 ACAGTGTAAACAAAGCCGCTGGG - Intronic
1090312709 11:125756276-125756298 AGAGTGTAAACAAAGTCTCCAGG + Intergenic
1090688884 11:129156454-129156476 ACAATGTAAACAAAGCCCCTGGG + Intronic
1090723000 11:129493946-129493968 ACAGTGTAGACAAAGGGGCCAGG + Intergenic
1090896098 11:130976866-130976888 ACAGTGTAAACAAAGCTACTGGG - Intergenic
1091090014 11:132762591-132762613 ACAGTGTAAACAAAGCCACCAGG - Intronic
1091213504 11:133885018-133885040 ACAGTGTAAACAAAGCCACTGGG - Intergenic
1091712175 12:2749836-2749858 ACAGTGTAAACAAAGCTTCCGGG - Intergenic
1091958767 12:4672592-4672614 TCACAGTAAACAAAGCCACCAGG + Intronic
1092304382 12:7283916-7283938 ACAGCATAAACAAAGCCACGGGG + Intergenic
1092327075 12:7544086-7544108 ACAGTGTAAACAAAGAGGCCAGG + Intergenic
1092332167 12:7594575-7594597 ATAGTGTAAACAAAGCTGCTGGG + Intergenic
1092398778 12:8153659-8153681 ACAATGTAAACAAAGCCACCAGG - Intronic
1092440410 12:8496268-8496290 ATAGTGTAAACAAAGCCCCCTGG + Intergenic
1092567682 12:9685632-9685654 ACAGTGTAAACAAAGCCCTGGGG - Intronic
1092581667 12:9849367-9849389 ACGGTGTAAACAATGCCACCGGG - Intergenic
1092638901 12:10482028-10482050 ACAGTGTAAACAAAGCCACCAGG + Intergenic
1092690916 12:11109031-11109053 ACGGTGTAAACAAAGCCACCAGG + Intronic
1092703265 12:11256708-11256730 ACAGCATAAATAAAGCCACCGGG + Intergenic
1093004434 12:14036139-14036161 ACAGTGTAAACAAAGCCACTGGG + Intergenic
1093336032 12:17905832-17905854 TCAGTGTAAACAAAGCCACTGGG - Intergenic
1093402314 12:18761312-18761334 ACAGTGTAAATAAAGCCTCCAGG + Intergenic
1093545031 12:20336388-20336410 ACATTGTAAACAAAGCCGCCAGG - Intergenic
1093610543 12:21150063-21150085 ACAATGCAAACAAAGCCACTAGG + Intronic
1093677655 12:21962672-21962694 ACAGTGTAAACAAAGCAGCAGGG + Intergenic
1093694772 12:22146845-22146867 ACAGTGTAAACAAAGCTGTGGGG + Intronic
1094140016 12:27171652-27171674 ACAGTGTAAATAAAGCCACTGGG - Intergenic
1094453318 12:30604525-30604547 ACACTGTAAACAAAGAAGCCAGG + Intergenic
1094579245 12:31718840-31718862 ACAGTGTAAACAAAGTGGCAAGG - Intronic
1094733103 12:33200643-33200665 ACAGTGTAAACAAAGCAGCCAGG - Intergenic
1094757871 12:33492932-33492954 ACAGTGTAAACAAAATTGTCAGG + Intergenic
1095128331 12:38508373-38508395 ACAGTGTAAACAAAGCTGCTGGG + Intergenic
1095209392 12:39475313-39475335 ACTAGGTAAACAAAGCGGCCTGG - Intergenic
1095247854 12:39943532-39943554 ACAGTGTAAACAAAGCTGCAGGG - Intronic
1095356438 12:41280575-41280597 ACAGTGTAAACAAAGCTACCAGG + Intronic
1095442763 12:42254557-42254579 CAAGTGTAAACAAAGAGGCCTGG - Intronic
1095488503 12:42708555-42708577 ACAGTGTAAACAAAGCTGCAGGG + Intergenic
1095547348 12:43387808-43387830 ACAGTGTAAACAAAGCCACAGGG - Intronic
1095694880 12:45132911-45132933 ACAGTGTAAAGAAAGCCACCAGG + Intergenic
1095778887 12:46037243-46037265 ACACTGTAAACAAAGCCACAGGG + Intergenic
1095793792 12:46195612-46195634 ACAGTGTAAGCAAAGAGGCCCGG - Intronic
1095830942 12:46585994-46586016 ACAATGTAAACAAAGAGGCCTGG - Intergenic
1095832326 12:46601362-46601384 ACAGTGTAAACACAGCCACTGGG - Intergenic
1096030529 12:48410097-48410119 ACAGTGTAAACAAAGAGGCCAGG - Intergenic
1096941860 12:55355590-55355612 ACAGTGTAAACAAAGCCACTGGG + Intergenic
1097301356 12:58022800-58022822 ACAGTGTAAACAAAGTGGCAAGG - Intergenic
1097339925 12:58426227-58426249 TGAGTGTAAACAAAGCTGCCAGG + Intergenic
1097375801 12:58841153-58841175 ACAGTGTAAACAAAGCTGCAGGG - Intergenic
1097488454 12:60235036-60235058 ACAGTGTAAACAAAGGCACTGGG + Intergenic
1097517189 12:60620130-60620152 ACAGTGTAAACAAAGCCTCCAGG + Intergenic
1097619527 12:61922958-61922980 ACAGCGTAAACAAAGCCACCAGG + Intronic
1097635180 12:62113770-62113792 ACATTGTAAACAAAGCCGCCAGG - Intronic
1097737398 12:63196884-63196906 ACAGTGTAAACAAAGCTGCCAGG + Intergenic
1097749603 12:63337343-63337365 ACAGTGTAAATAAAGCAGCTGGG + Intergenic
1097898786 12:64853267-64853289 ACAGTGTAAAGAAAGCTGCCAGG - Intronic
1098052948 12:66473189-66473211 ACAGTGTAAACAAAGCCACTGGG + Intronic
1098151856 12:67555487-67555509 ACAGTGTAAACAAAGCCTCCAGG - Intergenic
1098183171 12:67869651-67869673 ACAGTGTAAACAAAGCCACCAGG - Intergenic
1098438771 12:70496983-70497005 ACAGTGTAAACAAAGCCACCGGG - Intergenic
1098635638 12:72780563-72780585 ACAGTGTAAACAAAGCCATCAGG + Intergenic
1098697077 12:73572758-73572780 ACAGTGTAAACACAGCCACCAGG + Intergenic
1098699451 12:73606171-73606193 AGTATGTAAACAAAGCTGCCTGG + Intergenic
1098780177 12:74676746-74676768 ACAGTGTAAGCAAAGCCACCAGG + Intergenic
1099030847 12:77524151-77524173 ACAGGGTAAACAAAGCTGCTGGG + Intergenic
1099071351 12:78048996-78049018 ACAATGTAAACAAACCCGCTGGG - Intronic
1099216669 12:79861797-79861819 ACAGTGTAAACAAAGTGGCAGGG + Intronic
1099236089 12:80084051-80084073 ACGATGTAAACAAAGCCACCAGG - Intergenic
1099238914 12:80115828-80115850 ACAGTGTAAACAAAGCCACCAGG - Intergenic
1099240124 12:80128701-80128723 ACTAGGTAAACAAAGCAGCCAGG - Intergenic
1099435252 12:82634933-82634955 ACAGTGTAAACAAAGCCACCAGG - Intergenic
1099486233 12:83232588-83232610 ATAGTGTAAACAAAGCCACCGGG - Intergenic
1099554789 12:84097787-84097809 ACAGTGTAAACAAAGCCACCAGG + Intergenic
1099699133 12:86061736-86061758 ACAGTGTAAACAAAGTCATCAGG + Intronic
1099744962 12:86690092-86690114 ATAGTGTAAACAAAGCCACTGGG - Intronic
1099878448 12:88437335-88437357 AAAGTGTAGACAAAGCCACCAGG + Intergenic
1099897561 12:88667818-88667840 ACAGTGTAAACAAAGCCGTCTGG + Intergenic
1100073917 12:90755252-90755274 ACAGTGTAAACAAAGCCTCCGGG - Intergenic
1100136289 12:91557144-91557166 ACAGTGTAAACAAAGCTCCTGGG + Intergenic
1100375118 12:94007983-94008005 ACAGTGTAAACAAAGTGGCAAGG - Intergenic
1100652363 12:96604626-96604648 ACAGTGTAAACAAAGTGGCAGGG - Intronic
1100740061 12:97581751-97581773 ACAGTGTAAACAAAGCCACTGGG + Intergenic
1100768719 12:97898084-97898106 ACAGTGTAAACAAAGCCACTGGG - Intergenic
1100798011 12:98202348-98202370 ACAGTATAAACAAAGCCACCAGG + Intergenic
1100900813 12:99238381-99238403 ACAGTGTGAACAAAGCAGCCGGG + Intronic
1101069848 12:101062662-101062684 ACAGTGTAAACAAAGCCGCCAGG - Intronic
1101296099 12:103425048-103425070 ACAGTGTAAACAAAGCCACTGGG + Intronic
1101296238 12:103425880-103425902 ACAGTGTAAACAAAGCCACTGGG - Intronic
1101472654 12:105013257-105013279 ACAGTGTAAATAAAGCCACAGGG - Intronic
1101487984 12:105185034-105185056 AGAGTGTAAAGAAAGCCATCAGG - Intronic
1101601227 12:106212164-106212186 ACAGTGTAAACAAAGCCGCTGGG - Intergenic
1101628594 12:106471113-106471135 ACAGTGTAAACAAAGCGGCAGGG - Intronic
1102345561 12:112158967-112158989 ACAGTGTAAACAAAGCTGCCAGG - Intergenic
1104115586 12:125746322-125746344 ACAGTGGAAACAAAGCCACTGGG - Intergenic
1105355122 13:19652794-19652816 ATAGTGTAAGCAAAGCCTCCGGG + Intronic
1105552462 13:21410637-21410659 ACAGTGTAAACAAAGCCGCCAGG - Intronic
1105769420 13:23594466-23594488 ACAGTGTAAACAAAGCCACCTGG + Intronic
1106025820 13:25954219-25954241 ACAGTGTAAACAAAGCCACCAGG + Intronic
1106042154 13:26103616-26103638 ACAGTGTACACGAAGCCCTCGGG + Intergenic
1106326330 13:28693827-28693849 ACAGTGTAAACAAAGCCGCCAGG - Intergenic
1106335065 13:28776661-28776683 ACAATGTAAACAAAGCTGCCAGG - Intergenic
1106336005 13:28783953-28783975 ACAGTGTAAACAAAGCCATTGGG - Intergenic
1106377424 13:29203289-29203311 ACAGTGTAAACAAAGCTGCTGGG - Intronic
1106391144 13:29336920-29336942 ACAGTGTAAACAAAGCTGCTGGG - Intronic
1106426573 13:29636436-29636458 ACAGTGTAAAGAAAGCCACTGGG - Intergenic
1106429437 13:29665935-29665957 ACAGTGTAAGCAAAGCTGCCAGG + Intergenic
1106575674 13:30972254-30972276 ACAGTGTAAACAAAATCACGAGG + Intronic
1106608073 13:31250574-31250596 ACAGTGTAAACAAAGCCACCAGG + Intronic
1106874219 13:34054547-34054569 ACAGTGTAAACAAAGCCACTGGG - Intergenic
1106980216 13:35270821-35270843 ACAGTGTAAACAAAGCAGCAGGG + Intronic
1106983846 13:35321874-35321896 ATAGTGTAAACAAAGCCACCGGG - Intronic
1107289811 13:38839733-38839755 ACAGAGTAAAAAAAGCCTCCAGG - Intronic
1107473449 13:40712645-40712667 ACAGTGTAAACAAAGCCACTGGG - Intergenic
1107551458 13:41480078-41480100 ACAGTGTAAACAAAGCCACTGGG - Intergenic
1107641947 13:42452947-42452969 ACAGTGTAAATAAAACCACCTGG - Intergenic
1107648182 13:42516649-42516671 ATAGTGTAAACAAAGCCACTGGG + Intergenic
1107674067 13:42776729-42776751 ACAGTGTAAACAAAGCTGCCTGG - Intergenic
1107970839 13:45640957-45640979 ATAGTGTACACAAAGCCACCGGG - Intergenic
1108030068 13:46220384-46220406 ACAGTGTATACAAAGCCACCAGG - Intronic
1108048798 13:46408870-46408892 ACAGTATAAACAAAGCCACCAGG - Intronic
1108188099 13:47908430-47908452 ACACTGTAAACAAAGAGGCCAGG + Intergenic
1108235064 13:48394608-48394630 ACAGTGTAAACAAAGCCACCAGG + Intronic
1108236849 13:48416798-48416820 ACAGTGTAAGCAAAGCCACCGGG + Intronic
1108262783 13:48675418-48675440 ACAGTGTAAACAAAGCTGACAGG - Intronic
1108304614 13:49118717-49118739 GCAGTGTAAACAAAGCCACCAGG + Intronic
1108383817 13:49879738-49879760 ACAGTGTAAACAAAGCCTCCAGG + Intergenic
1108549254 13:51526848-51526870 ACCGTGTAAACAAAGAGGCAGGG + Intergenic
1108599880 13:51983277-51983299 ATAGTGTAAACAAAGCCACAGGG + Intronic
1108674029 13:52721077-52721099 ACAGTGTAAACAAAGCCGCCAGG - Intronic
1108797041 13:54044297-54044319 ACAGTGTAAACAAAGTGGCCAGG + Intergenic
1108858249 13:54822167-54822189 ACAGTGTAAACAAAGCTGCCAGG + Intergenic
1108988778 13:56629143-56629165 ACTAGGTAAACAAAGCAGCCAGG + Intergenic
1108998323 13:56763506-56763528 ACAGTGTAAACAAAGCCACCTGG + Intergenic
1109033865 13:57230307-57230329 ACAGTGTAAACAAAGCAGACAGG + Intergenic
1109187912 13:59292061-59292083 ACAGTGTAAACAAAGCTGCTGGG + Intergenic
1109293750 13:60505302-60505324 ACAGTGTAAACAAAGCCACCAGG + Intronic
1109366611 13:61364576-61364598 ACAGTGTAAACAAAGCCGCCTGG + Intergenic
1109457487 13:62611525-62611547 ACAGTATAAACAAAGCCACTGGG - Intergenic
1109541328 13:63782215-63782237 ACAGTGTAAACAAAGCCACCAGG - Intergenic
1109615433 13:64828378-64828400 ACGGTGTAAACAAAGCTGCCGGG + Intergenic
1109626620 13:64982797-64982819 ACATTGTAAACAAAGCCTCTGGG - Intergenic
1109661616 13:65467378-65467400 ACAGTGTAAACAAAGCCACAGGG - Intergenic
1109731570 13:66420035-66420057 AAAGTGGAAACAAAGCCACAGGG + Intronic
1109902784 13:68795654-68795676 ACAGTGTAAACAAAGCCTCTGGG - Intergenic
1110135536 13:72062783-72062805 ACAATGTAAACAAAGCTGGCAGG + Intergenic
1110824702 13:79958484-79958506 ACAGTGTAAACAAAGCCACTGGG + Intergenic
1110826329 13:79975424-79975446 ACAGTGTAAACAAAGCTGCTGGG + Intergenic
1110890299 13:80689956-80689978 ACAGTGTAAACAAAGTTACTGGG + Intergenic
1110942045 13:81362910-81362932 ACAGTGTAAACAAAGCCACCAGG + Intergenic
1111627962 13:90813556-90813578 ACAGTATAAACAAAGCAGCCAGG + Intergenic
1111635090 13:90893035-90893057 ACGGTGTAAACAAAGCCTCCGGG + Intergenic
1111932638 13:94527103-94527125 ACAGTGTAAACAAAGAGGCCAGG + Intergenic
1112165860 13:96919079-96919101 ACAGTGTAAACAAAGCCAACTGG + Intergenic
1112663810 13:101544715-101544737 AGAAGGTAAACAAAGCGGCCAGG - Intronic
1112861008 13:103829790-103829812 ACAGTGTAAACAAAGCCACTGGG - Intergenic
1113131502 13:107042395-107042417 ACAGAGTAAACAAAGGTGCTGGG - Intergenic
1114133548 14:19820707-19820729 ACAGTGTAAATAAAGCCACCAGG - Intronic
1114341955 14:21754439-21754461 ACAGTGTAAAGAAAGCCACTGGG + Intergenic
1114342589 14:21760524-21760546 ACAGTGTAAACCAAGCTGCCGGG + Intergenic
1114433806 14:22686383-22686405 ACAGTATAAAGAAAGCCACTGGG + Intergenic
1114502875 14:23184192-23184214 ACAGAGGAAACAAAATCGCCAGG + Intergenic
1114602933 14:23970443-23970465 ACAGTGTAAACAAAGCTGCAGGG + Intronic
1114607295 14:24007569-24007591 ACAGTGTAAACAAAGCTGCAGGG + Intergenic
1114744997 14:25137084-25137106 ACAGTTTAAACAAAGCCGCCTGG + Intergenic
1114784942 14:25585821-25585843 ACAGTGTAAACAAAACTGCAGGG - Intergenic
1114817683 14:25979523-25979545 ACAGTGTGAACAAAGCCACCCGG + Intergenic
1114870103 14:26645574-26645596 ATACTGTAAACAAAGCCGCCAGG - Intergenic
1115008167 14:28511547-28511569 ACAGCATAAACAAAGCCACTGGG - Intergenic
1115043119 14:28955643-28955665 ACAGTGTAAACAAAGCTGCAGGG + Intergenic
1115048687 14:29029154-29029176 ACAATGTAAACAAAGCCTCCAGG - Intergenic
1115162327 14:30410227-30410249 ACCTTGTAGACAAAGCTGCCTGG - Intergenic
1115277053 14:31621060-31621082 ACAGTGTAAACAAAGCCGCCAGG - Intronic
1115359799 14:32488306-32488328 ACAGTGTAAACAAAGCCACCAGG - Intronic
1115511291 14:34140002-34140024 ACAGTGTAAACAAAGCCTCCGGG + Intronic
1115538064 14:34391881-34391903 ACAGTAGAAACAAAGCCTCCAGG + Intronic
1115691015 14:35843964-35843986 ACAGTGTAAACAAAGCCACCAGG - Intronic
1115818462 14:37188229-37188251 ACAGTGTAAACAAAGCGGCAGGG + Intergenic
1115842728 14:37490229-37490251 ACAGTGTAAACAAAGCCACAGGG - Intronic
1115856247 14:37632887-37632909 ACTGTGTAAACAAAGCCGCCTGG - Intronic
1115912142 14:38268733-38268755 ACAGTGTAATCAAAGCCACAGGG - Intergenic
1115940320 14:38601594-38601616 ACAGTTTAAAAAAAGCTGCCAGG - Intergenic
1115974390 14:38980969-38980991 ACAGTGTAAACAAAGTCACCAGG - Intergenic
1116165549 14:41330042-41330064 ACAGTGTAAATAAAGAGGCCTGG - Intergenic
1116227529 14:42171265-42171287 ACGGTGTAAACAAAGCTTCCTGG + Intergenic
1116236469 14:42285294-42285316 ACAGTGTAAACAAAGTGGCAGGG - Intergenic
1116572429 14:46534885-46534907 ACATTGTAAATAAAGCTGCAGGG - Intergenic
1116705031 14:48285367-48285389 AGTATGTAAACAAAGCCGCCAGG - Intergenic
1116743875 14:48792828-48792850 ACAGTGTAAACAAAGCTACCAGG + Intergenic
1116771452 14:49131550-49131572 ACAGTGTAAACAAAGCCACCAGG - Intergenic
1117121080 14:52568656-52568678 AGGGTGTAAACAAAGCCACCTGG + Intronic
1117172800 14:53117628-53117650 ACAGTGTAAACAAAGAGGCCAGG + Intronic
1117237986 14:53798576-53798598 ACAGTGTAAACAAAGCCACAGGG + Intergenic
1117299239 14:54407624-54407646 ACAGTGTAAACAAAGCCAGTCGG - Intronic
1117624241 14:57618903-57618925 ACAGTGTAAACAAAGATGCTGGG + Intronic
1117655485 14:57951647-57951669 ACAGTGTAAACAAAGCCTCAGGG + Intronic
1117710712 14:58525922-58525944 TCAGTGTAAACAAAGCCGCCAGG + Intronic
1117807905 14:59513646-59513668 ACTAGGTAAACAAAGCAGCCTGG + Intronic
1117930525 14:60836999-60837021 ACAGTGTAAACAAAGCATCAGGG - Intronic
1118450070 14:65892508-65892530 ACAGTGTAAACAAAGAGGCCTGG + Intergenic
1118733844 14:68688518-68688540 ACAAAGTTAACAAAGCTGCCAGG + Intronic
1118938492 14:70310737-70310759 ACTAGGTAAACAAAGCGGCCGGG - Intergenic
1119018467 14:71084624-71084646 ACAGTGTAAGCAAAGCTGCCAGG - Intronic
1120201348 14:81541040-81541062 ACAGTGTAAACAAAGCCACAGGG + Intergenic
1120271766 14:82321867-82321889 ACAGTGTAAACAAAGCTGCGAGG - Intergenic
1120450026 14:84655347-84655369 ACAGTGTAAACAAAGTCGCCAGG - Intergenic
1120478901 14:85024015-85024037 ACTAGGTAAACAAAGCGGCCAGG - Intergenic
1120565311 14:86048114-86048136 ACAGTATAAACAAAGCCACTAGG - Intergenic
1120670802 14:87360383-87360405 AGTAGGTAAACAAAGCCGCCAGG - Intergenic
1120770131 14:88370232-88370254 ACAGTGTAAACAAAGCTGCCAGG + Intergenic
1120773831 14:88411149-88411171 ACAGTGTAAACAAAGCCGCCAGG - Intronic
1120843144 14:89104601-89104623 ACAGTGTAAACAAAGCCACTGGG - Intergenic
1121899009 14:97674992-97675014 ACAGTGTAAAAAAAGCCACAGGG + Intergenic
1123480841 15:20629452-20629474 ACAGTGTAAACAGAGTCACCTGG + Intergenic
1123576617 15:21676276-21676298 ACAGTGTAAATAAAACCACCAGG - Intergenic
1123613239 15:22118744-22118766 ACAGTGTAAATAAAACCACCAGG - Intergenic
1123637171 15:22370913-22370935 ACAGTGTAAACAGAGTCACCTGG - Intergenic
1124084219 15:26531720-26531742 ACAGTGTAAACAAAGCCGCTGGG + Intergenic
1124666721 15:31598869-31598891 ACAGTGTAAACAAAGCCGCAGGG + Intronic
1124893963 15:33758505-33758527 ACAGTATAAACAAAGCTGCCAGG + Intronic
1125219873 15:37320418-37320440 ACAGTGTAAAAAAAGCAGCTGGG + Intergenic
1125288529 15:38120085-38120107 ACAGTGTAAACAAAGCCACCAGG + Intergenic
1125329991 15:38573345-38573367 ACAGTGTAAATGAAGCCGCTAGG - Intergenic
1125354531 15:38803249-38803271 ACAGTGTAAAGAAAGCTGCTGGG - Intergenic
1125784310 15:42301716-42301738 ACAGTCTAAACAGAGGCACCTGG + Intronic
1126050843 15:44683452-44683474 ACAGTGTAAACAAAGCCACCAGG + Intronic
1126072537 15:44877604-44877626 ACAGAGAAAACAAAGCCCCTTGG - Intergenic
1126085657 15:45009047-45009069 ACAGAGAAAACAAAGCCCCTTGG + Intergenic
1126286615 15:47019910-47019932 AAAGAGTAAACAAAGCTGCCAGG + Intergenic
1126298239 15:47165996-47166018 ATTGGGTAAACAAAGCAGCCGGG + Intergenic
1126476346 15:49069020-49069042 ACAGTGTAAACAAAGTGGCAGGG + Intergenic
1126500530 15:49339895-49339917 ACAGTGTAAACAAAGCCTCCAGG - Intronic
1126720102 15:51569302-51569324 ACAGTGTAAACAAAGCTGCTGGG + Intronic
1126742094 15:51787325-51787347 ACAGTGTAAACAAAGCGGCATGG + Intronic
1126862732 15:52902758-52902780 ACAGTGTAAATAAAGCTGCCGGG + Intergenic
1126952184 15:53893627-53893649 AGAGTGTAAACAAAGCTGCCAGG - Intergenic
1127030037 15:54851399-54851421 ACAGTGTAAACAAAGCCATGGGG + Intergenic
1127158070 15:56150091-56150113 ACAGGATAAACAAAGCTGCTGGG + Intronic
1127317864 15:57814864-57814886 ACAGCATAAACAAAGCCACCAGG - Intergenic
1127373745 15:58363263-58363285 ACAGTGTAAAAAAAGCCGCCAGG + Intronic
1127452574 15:59131316-59131338 ACAGTGTAAACAAAGCTGCCCGG - Intergenic
1127570628 15:60237627-60237649 ACAGTATAAACAAAGAGGCCTGG + Intergenic
1128883688 15:71265820-71265842 ACAATGTAAACAAAGCCGCCAGG + Intronic
1129126785 15:73448361-73448383 ACAGTGTAAACAAAGCCACCAGG + Intronic
1129159948 15:73741657-73741679 ACAATGAAAACAAAGCAGCGAGG + Intronic
1129495572 15:75977107-75977129 ATAGTGTAAACAAAACTGCTGGG - Intronic
1129499139 15:76019109-76019131 ACAGTGTAAACAAAGCCGCCTGG - Intronic
1129507941 15:76098853-76098875 ACAGTGTAAACAAAGCTGCTGGG - Intronic
1129563221 15:76593184-76593206 ACAGGGTAAACAAAGCCACTGGG + Intronic
1130441937 15:83963370-83963392 ACAGTGTAAACAAAGCCTCTGGG + Intronic
1130728661 15:86467250-86467272 ACAGTGTAAACAAAGCCATCAGG - Intronic
1131376535 15:91928837-91928859 GAAGTGTAAACAAAACCGTCTGG - Intronic
1132096432 15:98988353-98988375 ACAGTGTAAACAAAGCCACCGGG + Intronic
1132218315 15:100084322-100084344 AGTAGGTAAACAAAGCCGCCGGG + Intronic
1202985485 15_KI270727v1_random:410521-410543 ACAGTGTAAATAAAACCACCAGG - Intergenic
1133956972 16:10452861-10452883 ACAGTGCAAACAAAGCCACTGGG - Intronic
1134767605 16:16774519-16774541 ACAGTGTAAACAAAGCTGCTGGG - Intergenic
1135807569 16:25556503-25556525 ACAGTGTAAACAAAGCCGCGTGG + Intergenic
1137296335 16:47097385-47097407 ACAGTGTAAACAAAGCCACAGGG + Intronic
1137324972 16:47425105-47425127 ACAGTGTAAACAAAGCGGCCTGG - Intronic
1137336462 16:47554294-47554316 ACAGTGTAAACAAAGTCATGGGG - Intronic
1137356862 16:47774871-47774893 ACAGTGTAAACAAAGAGGCCTGG - Intergenic
1137583072 16:49646125-49646147 AAAGTGGACACAAAGCAGCCCGG + Intronic
1137828112 16:51517137-51517159 ACAGTGTAAACGAAGCCTCTGGG + Intergenic
1137969974 16:52975345-52975367 ACAGTGTAAACAAAGCCCCTGGG - Intergenic
1138151561 16:54662025-54662047 ACAGTATAAACAAAGCCTCTGGG + Intergenic
1138477925 16:57283226-57283248 AAATTTTAAACAAACCCGCCAGG + Intronic
1138886927 16:61091132-61091154 ACGGTGCAAACAAAGCCACTGGG + Intergenic
1139984165 16:70883943-70883965 AAAGTGTAAAGAATGCCGGCAGG + Exonic
1141246099 16:82309190-82309212 ACAATGTAAACAAAGCCGCTGGG - Intergenic
1143427129 17:6848970-6848992 ACAGTGTAAACAAAGCCACCAGG - Intergenic
1144294042 17:13855940-13855962 AGTATGTAAACAAAGCAGCCAGG + Intergenic
1144363932 17:14523864-14523886 ACAGTGAATAAAAAGCCTCCAGG - Intergenic
1144434108 17:15223879-15223901 ACAGTCTAAAGAAAGCTGCTGGG - Intergenic
1145861232 17:28212028-28212050 ACAGTGTAAACAAAGGAGCAGGG + Intergenic
1146742854 17:35301512-35301534 ACAGTGTAAACAAAGCCTCTGGG + Intergenic
1146746314 17:35333705-35333727 ACAGCGTAAACAAAGCTGCCTGG - Intergenic
1146825922 17:36023316-36023338 ACAGTGTAAACAAAGCCACCTGG - Intergenic
1147525277 17:41216529-41216551 ACAGTGTAAACAAAGTTGCCGGG + Intronic
1149083100 17:52681700-52681722 ATAGAGCAAACAAAGCCACCTGG + Intergenic
1149093852 17:52817170-52817192 ACAGTGTAAACAAAGCAGCTGGG - Intergenic
1149192982 17:54086101-54086123 ACAGTGTAAACAAAGAGGCCTGG + Intergenic
1149212226 17:54316827-54316849 ACGGTGTAAACAAAGAGGCCAGG + Intergenic
1149222899 17:54436211-54436233 ACAGTGTAAACAATGCTGCCTGG + Intergenic
1149281259 17:55108186-55108208 AGAGTGTAAACAAAGCTGCCAGG - Intronic
1150884637 17:69070953-69070975 ACAGTGTAAACAAAGCTGTCAGG + Intergenic
1151064177 17:71131771-71131793 ACAGTGTAAACAAAGCCACTAGG - Intergenic
1153059363 18:979872-979894 ATAGTGTAAACAAAGCCATGGGG - Intergenic
1153064914 18:1034957-1034979 ACATTGTAAACAAAGCAGCAGGG - Intergenic
1153313397 18:3699901-3699923 ACAGTGTAAACAAAGCCATGGGG - Intronic
1153441294 18:5122456-5122478 ACAGTGTAAACAAAGCAGCTAGG + Intergenic
1153562228 18:6383088-6383110 ACAGTGTAAACAAAGCTGCTAGG - Intronic
1154101533 18:11479209-11479231 ACAGTGTAAACAAAGCCACCTGG - Intergenic
1154382218 18:13863013-13863035 ACAGTGTAAACAAAGCCACTGGG - Intergenic
1155080540 18:22406191-22406213 ACAGAGAAAACAAAGCTGCCAGG + Intergenic
1155384953 18:25267139-25267161 ACAGTGTAAACAAAGCTGCCAGG + Intronic
1155395338 18:25380449-25380471 ACCGTGTAAATAAAGCTGCTGGG + Intergenic
1155931688 18:31715384-31715406 AAAGTTTAAACAAATCAGCCAGG - Intergenic
1156188368 18:34689922-34689944 ACAGTGTAAACAAAGCCACTGGG - Intronic
1156415124 18:36879807-36879829 AGAGTGTAAACAAAGCCAGTGGG - Intronic
1156979268 18:43265586-43265608 GCAGTGTAAACAAAGCCTCAGGG - Intergenic
1157058229 18:44255933-44255955 ACAGTGTAAACAAAGCGGCAGGG - Intergenic
1157066540 18:44356957-44356979 ACAGTGTAAACAAAGCCACTGGG - Intergenic
1157067281 18:44366724-44366746 ACAGTGTAAACAAAGCTGCTGGG - Intergenic
1157071762 18:44416582-44416604 ACAGTGTAAACAGAGCCACCAGG + Intergenic
1157178858 18:45477761-45477783 ACAGTATAAACAACGCCACCAGG - Intronic
1157695094 18:49716236-49716258 ACAGTGTAAACAAAGCCACCAGG - Intergenic
1159570918 18:70110926-70110948 ACAGTGTAAACTAAGCCACTGGG + Intronic
1159581341 18:70237080-70237102 ACAGTGTAAACAAAGCCTCCTGG + Intergenic
1159645787 18:70916534-70916556 ACAGTGTAAACAAAGCCACTGGG - Intergenic
1159661218 18:71097902-71097924 ACAGTGTAAACAAAGCCAATAGG - Intergenic
1159690584 18:71482787-71482809 ACAGTGTAAACAAAACCACCAGG - Intergenic
1159901778 18:74053614-74053636 ACAGTGTAAACAAAGCCACCTGG + Intergenic
1160466639 18:79083183-79083205 ACAGTGTAAACAAAGCCGCTGGG - Intronic
1164093056 19:21977944-21977966 AGAGTATAAACAAAGCCACCCGG + Intronic
1164152361 19:22566099-22566121 ACAGTATAAACAAAGCTGCAGGG - Intergenic
1164236047 19:23335486-23335508 ACTAGGTAAACAAAGCAGCCGGG - Intronic
1164320054 19:24136459-24136481 AAAATATAAACAAAGCCTCCAGG - Intergenic
1164416654 19:28051221-28051243 ACAGTGTAAACAAAGCTGCCGGG + Intergenic
1164431339 19:28191531-28191553 ACAATGTAAATGAAGCCTCCAGG - Intergenic
1165003739 19:32787592-32787614 ACAGTGTAAACAAAGCAGCGGGG - Intronic
1165970381 19:39624066-39624088 ACAGGGTAAACAAAGCCACCGGG - Intergenic
1166263202 19:41657399-41657421 ACAGTGTAAACAAAGCCTCCAGG + Intronic
1168170529 19:54585453-54585475 ACAGTGTAAACAAAGATGCCTGG - Intronic
1168457716 19:56526716-56526738 ACAGCGTAAACAAAGCCATGGGG + Exonic
925252440 2:2451470-2451492 ACAGTGTAAACAAAGCCACCAGG - Intergenic
925484498 2:4313121-4313143 ACAGCATTAACAAAGCCACCTGG - Intergenic
925566362 2:5258469-5258491 ACAGTGTAAACAAAGCCGCTGGG - Intergenic
925692361 2:6538040-6538062 ACAGTGTAAACAAAGCCACTGGG + Intergenic
925729144 2:6904932-6904954 ACAGTTCAAACAAAGCTGCTGGG - Intergenic
926366573 2:12139131-12139153 ACAGCGTAAACAAAGCAGCAGGG - Intergenic
926533562 2:14082481-14082503 ACAGTGCAAACAAAGCCACCAGG + Intergenic
926943963 2:18167970-18167992 ACAGTGTAAACACAGCTGCCAGG - Intronic
927021308 2:19020255-19020277 ATAGTGTAAACAAAGACAACTGG - Intergenic
927117172 2:19916601-19916623 ACAGTGTAAACAAAGCCGCTGGG + Intronic
927182802 2:20458968-20458990 ACAGTGTAAACAAAGCCACCAGG + Intergenic
927283900 2:21336403-21336425 AGTAGGTAAACAAAGCCGCCTGG + Intergenic
928462664 2:31489544-31489566 ACAGTGTAAACAAAGCATCCTGG + Intergenic
928481009 2:31683692-31683714 ACAGTGTAAACAAAGAGGCTGGG - Intergenic
928750664 2:34466874-34466896 ACAGTATAAACAAAGCTGCCAGG + Intergenic
929062889 2:37941672-37941694 ACGGTGTAAACAAAGCCACCAGG - Intronic
929256126 2:39813453-39813475 ACGGTGTAAACAAAGCCACCAGG - Intergenic
929333529 2:40712711-40712733 ACAGTGTAAACAAAGCCTCCAGG - Intergenic
930216992 2:48707661-48707683 ACTGTGTAAACAAAGCTGCCAGG - Intronic
930223320 2:48767517-48767539 ACAGTGTAAACAAAGCCACAGGG - Intronic
930264719 2:49186260-49186282 ACAGTGTAAACAAAGCTGCCAGG - Intergenic
930323354 2:49882553-49882575 ACAGTGTAAACAAGGCCACTGGG + Intergenic
930476636 2:51891163-51891185 ACACTGTAAACAAAGCCGCTGGG - Intergenic
930516117 2:52409920-52409942 ACAGTGTAAACATAGCCCCCAGG - Intergenic
930551048 2:52835197-52835219 AAAGTATAAAGAAATCCGCCAGG - Intergenic
930908902 2:56606486-56606508 ACAGTGTAAACAAAGTGGCCTGG - Intergenic
931004108 2:57828317-57828339 ACAGTGTAAACAAAGCCACCAGG + Intergenic
931030412 2:58168811-58168833 ACAGTGTATACAATGCCACGAGG + Intronic
931212077 2:60207109-60207131 ACAGTGTAAACAAAGCTGCCAGG - Intergenic
931480402 2:62633648-62633670 ACAGTGGAAACAAAGCTGCAGGG + Intergenic
931530684 2:63210935-63210957 ACTAGGTAAACAAAGCAGCCAGG + Intronic
931538680 2:63304958-63304980 ACGTTGTAAACAAAGCTGCCAGG + Intronic
931566452 2:63620385-63620407 ACAGTGTAAACAAAGCCTTTCGG + Intronic
931594526 2:63926980-63927002 AGAGTGTAAACAAAGCAGCAGGG + Intronic
931814845 2:65890315-65890337 ACAGTGTAAACAAAGCCGCCAGG + Intergenic
931886688 2:66625759-66625781 ACAGTGTAAACAAAGCCACTGGG - Intergenic
932051557 2:68403495-68403517 ACAGTGTAAACAAAGCCTCTGGG - Intergenic
932377543 2:71251083-71251105 ACATTGTAAACAAAGAGGCCAGG - Intergenic
932511793 2:72300300-72300322 ACAGTGTAAACAAAGCTGCCAGG - Intronic
932646775 2:73510964-73510986 ACAGTGTAAACAAAGCCGCTGGG - Intronic
932868694 2:75374562-75374584 ACAGTATAAACAAAGAGGCCTGG - Intergenic
932899519 2:75681807-75681829 ACAGTGTAAACAAAGCCACCGGG + Intronic
932913900 2:75834353-75834375 ACAGTGTGAACAAAGCTGCCAGG + Intergenic
933355661 2:81206437-81206459 ACAGTGTAAACAAAGCCGGTGGG + Intergenic
933413190 2:81950982-81951004 ACAGTGTAAACAAAGCTGCCTGG - Intergenic
933488268 2:82950323-82950345 ACAGTGTAAACAAAGCCTCTGGG - Intergenic
933603191 2:84354308-84354330 ACAGTGTAAACAAAGCCCCTGGG + Intergenic
933684105 2:85129605-85129627 AAAATGTAAAAAAAGCGGCCGGG + Intergenic
935325852 2:101936031-101936053 ACAGTGTAAACAATGCCGCAGGG + Intergenic
935368996 2:102324831-102324853 AGTGGGTAAACAAAGCAGCCGGG + Intronic
935567939 2:104629478-104629500 ACAGTGTAAACAAAGCCACCAGG - Intergenic
935982835 2:108643879-108643901 ACAGTGTAAACAAAGCCACTGGG + Intronic
936448301 2:112614665-112614687 ACAGTGTAAGCAAAGCTGCTGGG - Intergenic
936640260 2:114304077-114304099 ACAGTGTAAATAAAGCCACCGGG - Intergenic
936649855 2:114413663-114413685 ACAGTATAAACAAAGAGGCTGGG - Intergenic
936999960 2:118457059-118457081 ACAGTGTAAACAAAGCCGCTGGG - Intergenic
937188447 2:120068569-120068591 ACAGTATAAACAAAGCCGCCAGG + Intronic
937306575 2:120875276-120875298 ACAGTGTGGACAAAGGAGCCTGG + Intronic
937573531 2:123392037-123392059 ACAGTGTAAACAAAGCTGCCAGG + Intergenic
937807292 2:126161135-126161157 GCAATGTAAACAAAGCCACCAGG + Intergenic
937893316 2:126956960-126956982 ACAGTGTAAACAAAGCCCCCAGG + Intergenic
938144754 2:128824051-128824073 ACAGTGGAAACAGAGCTGCCGGG + Intergenic
938801334 2:134766137-134766159 ACAGTGTAAATTATGCCACCTGG - Intergenic
938807660 2:134821830-134821852 ACAATTTAAACAAAGCCTCAAGG - Intergenic
938874409 2:135518036-135518058 ACGGTGTAAACAAAGCTGCTGGG - Intronic
938952306 2:136266530-136266552 ACAGTGTAAACAAAGCCCCTGGG - Intergenic
939033285 2:137101752-137101774 ACAGTGTAAACAAAGCTGCTGGG + Intronic
939116893 2:138071118-138071140 ACAGCGTAAACAAAGCCACCAGG - Intergenic
939382028 2:141448193-141448215 ACAGTGTAAACAAAGTCCCTGGG - Intronic
939594253 2:144104587-144104609 ACAAGGTAAACAAAGCAGCCAGG + Intronic
939640833 2:144638449-144638471 ACAGTGTAAACAAAGCCGACGGG - Intergenic
939652823 2:144785640-144785662 ACAGTGTAAACAAAGCTGCTGGG + Intergenic
939687134 2:145213602-145213624 ACAGTGGAAACAAAGCTGCCAGG - Intergenic
939840624 2:147182871-147182893 ACAGTGTAAACAAAGCTGCTGGG + Intergenic
939937755 2:148313430-148313452 ACAGTGTAAACAAAGCTGCCTGG - Intronic
939942016 2:148362348-148362370 ACAGTGTAAACAAGGCCATCAGG + Intronic
939946935 2:148421794-148421816 ACAGTGTAAACAAAGCTGCCAGG + Intronic
940030545 2:149257427-149257449 ACAGTGTAAACAAAGCCTCCTGG - Intergenic
940114425 2:150192539-150192561 ACAGTGTAAACAAAGTGCCTGGG + Intergenic
940408075 2:153328583-153328605 ACAATGTAAACAAAGCCACCGGG - Intergenic
940417811 2:153442824-153442846 ACAGTGCAAACAAAGCCACTCGG - Intergenic
940593996 2:155766855-155766877 ACAGTGTAAACAAAGCTGCAAGG - Intergenic
940602615 2:155880571-155880593 ACAGTGTAAACAAAGCCGCTGGG + Intergenic
940644429 2:156375923-156375945 AGTAGGTAAACAAAGCCGCCAGG - Intergenic
940757955 2:157704845-157704867 ACAGTGTAAACAAAGCCACTGGG + Intergenic
940821415 2:158360038-158360060 ACAGTGTAAACAAAACCACAGGG + Intronic
940925187 2:159356352-159356374 ACAGTGTAAATAAAGCTGCCAGG + Intronic
940946513 2:159624057-159624079 ACAGTGTAAACAAAGCTGCTGGG + Intergenic
940964540 2:159822401-159822423 CCAGTGTAAACAAAGCTGCTGGG + Intronic
940999033 2:160181350-160181372 ACAGTGTAAACAAAGCCACCAGG + Intronic
941041439 2:160628233-160628255 ACAGTGTAAACAAAGCAGCAGGG - Intergenic
941076400 2:161010664-161010686 ACAGTGTAAACAAAGCCACCAGG + Intergenic
941114999 2:161462178-161462200 ACAGTGTAAACAAAGCTGCAGGG - Intronic
941119604 2:161513550-161513572 ACCGTGTAAACAAAGCCCCTGGG + Intronic
941565339 2:167099283-167099305 ACAGAGTAAACAAAGCCACTGGG - Intronic
941571496 2:167175895-167175917 ACAGGGTAAACAAAGCCGCTGGG - Intronic
941679750 2:168384537-168384559 AAAGTATAAACAAAGCCTCCAGG + Intergenic
941682319 2:168412820-168412842 ACAGTGTAAACAAAGCCACTGGG - Intergenic
941845304 2:170126266-170126288 ACAGTGTAAACAAAGCCACCAGG + Intergenic
942010850 2:171761312-171761334 AAAGTGTAAACAAAGCCACCTGG - Intergenic
942199915 2:173560277-173560299 ACATTGTAAACAAAGCTGCCAGG + Intergenic
942407237 2:175668686-175668708 ACAGTATAAACGAAGCCTCTGGG + Intergenic
942411053 2:175709481-175709503 ACAGTGTAAACAAAGCCACCAGG + Intergenic
942431282 2:175914078-175914100 ACAGTGTAAACAAAGCCACCAGG - Intergenic
942576970 2:177373974-177373996 TAAGTGTAAACAAAGTCACCAGG - Intronic
942722244 2:178965984-178966006 ACAGTGTAAACAAAGCCACTGGG + Intronic
942732604 2:179076266-179076288 ACAGTGTAAACAGACCTGCTGGG + Intergenic
942898764 2:181089582-181089604 ACAGTGTAAACAAAGCTCCCTGG + Intergenic
942953671 2:181750316-181750338 ACAGTGTAAACAAAGCCACTGGG - Intergenic
943084983 2:183300581-183300603 ACAGTGTAAACAAAGCCACCAGG - Intergenic
943105721 2:183543907-183543929 ACAGTGTAAACAAAGCAGCAGGG + Intergenic
943112333 2:183621733-183621755 ACAGTGCAAACAAAGCCACAGGG - Intergenic
943220307 2:185095198-185095220 ACAGTGGCAGCAAAGCCTCCAGG + Intergenic
943350727 2:186793366-186793388 ACGGTGTACACAAAGCCTCTGGG + Intergenic
943408750 2:187519925-187519947 ACAGTGTAAACAAAGCCCCAGGG - Intronic
943409810 2:187532942-187532964 ACAGTGTAAACAAAGCCCCAGGG + Intronic
943512323 2:188840982-188841004 ACAGTGTAAACAAACCCACCAGG + Intergenic
943552470 2:189357493-189357515 ACAGTGTAAACAAAGCCACTGGG - Intergenic
943599129 2:189893011-189893033 ACAGTGTAAACAAAGCCACCAGG - Intronic
943660496 2:190554518-190554540 ACAGTGTAAACAAAGCCACCAGG + Intergenic
943836834 2:192524836-192524858 ACAGTGTAAACAAAGCCTCCAGG + Intergenic
944094794 2:195953718-195953740 ACAGTGTAAACAAAGCCGCTGGG - Intronic
944267916 2:197748597-197748619 ACAGTGTAAATAAAGCCACTGGG + Intronic
944292049 2:198018593-198018615 ACAGTGTAAACAAAGCCGCCTGG + Intronic
944607941 2:201369979-201370001 ACAGTGTAAACAAAGCTGCTGGG + Intergenic
945161848 2:206899880-206899902 ACAGTGTAAACAAAGCAGCAGGG - Intergenic
945329715 2:208525306-208525328 ACAGTGTAAACAAAGCCACCAGG - Intronic
945409189 2:209488650-209488672 ACAGTGTAAACAAAGCTGCCAGG + Intronic
945424982 2:209690107-209690129 ACATTTTAAATAAAGCAGCCGGG + Intronic
945467056 2:210181678-210181700 ACAGTGTAAACAAAGCCACCTGG + Intergenic
945486881 2:210406972-210406994 ACAGTGTAAACAAAGCCATGGGG - Intergenic
945533756 2:210986973-210986995 TCAGTGTAAACAAAGCTGCCAGG - Intergenic
945628235 2:212237855-212237877 ACAGTGTAAACAAAGCCACTTGG - Intronic
945927421 2:215819687-215819709 ACAGGGTAAACAAAGCTGCTGGG + Intergenic
945945212 2:215988756-215988778 ACAGTGTACACAAAGCCGCTGGG + Intronic
946065300 2:216982482-216982504 ACAGTGTAAACAAAGTCACTGGG - Intergenic
946294454 2:218772920-218772942 AGTGGGTAAACAAAGCGGCCAGG - Intergenic
946913011 2:224485485-224485507 ACAGTGTAAACAAGGCCTCCAGG + Intronic
947086060 2:226454305-226454327 ACAGTGTAAACAAAGCCACTGGG + Intergenic
947225833 2:227839465-227839487 ACAGTGAAAACAAAGCTTCTGGG - Intergenic
947275818 2:228390904-228390926 ACAGTGTAAACAAAGCAGCAGGG - Intergenic
947364697 2:229381640-229381662 ACAGTGTAAACAAAGCCGCCAGG + Intronic
947440579 2:230117778-230117800 ACAGTGTAAACAAAGTGTCTGGG - Intergenic
947492135 2:230604004-230604026 ACAGTGTAAACAAAGCCACTGGG + Intergenic
947494007 2:230619717-230619739 ACAGTATAAACAAAGAGGCCTGG + Intergenic
947681408 2:232037314-232037336 ACAGTGTAAACAAAGCCACCAGG - Intronic
1169073869 20:2749952-2749974 CCTGTGTAGACAAAGCGGCCGGG - Exonic
1169320033 20:4625101-4625123 ACAGTGTAAACAAAGCCACTGGG - Intergenic
1169397034 20:5241497-5241519 ACAGTGTAAATAAAGCCGCTTGG - Intergenic
1169495805 20:6113718-6113740 ACAGTGTAGACACAGCCTCAGGG - Intronic
1169861702 20:10159519-10159541 ACAGTGTAAACAAAGAGCCCAGG + Intergenic
1169960329 20:11152538-11152560 ACAGTGTAAACAAAGCTGCCTGG - Intergenic
1170133924 20:13052754-13052776 ACAGTGTAAACAAAGCAGTGGGG + Intronic
1170167881 20:13380854-13380876 ACAGTGTAAACAAAGCCACCAGG - Intergenic
1170266369 20:14470701-14470723 ACAGTGTAAACAAAGCCACCGGG - Intronic
1170294253 20:14806803-14806825 ACACTGTAAACAAAGCTGCTGGG + Intronic
1170454614 20:16520391-16520413 ACAGTGTAAACAAAGCCGCCAGG + Intronic
1170720431 20:18873178-18873200 ATAGTGTTAACAAAGCTGCAGGG - Intergenic
1170727322 20:18941629-18941651 ATAGTGTAAACTAAGACGCTGGG - Intergenic
1171000863 20:21414197-21414219 ACAGTGTAAACAAAGCCATCAGG + Intergenic
1171441405 20:25166299-25166321 ACAGTGTAAACAAAGCCACCAGG + Intergenic
1172466846 20:35161638-35161660 ACAGTGTAAACAAAGCTGCAGGG + Intergenic
1173511007 20:43628393-43628415 ACAGCGTAAACAAAGCTGCTGGG - Intronic
1173751148 20:45477938-45477960 ACAGAGTAAACAAAGCCACCAGG - Intronic
1174175859 20:48644576-48644598 ACAGTGTAGACAAAACCCCTGGG + Intronic
1174280984 20:49439065-49439087 ACAGTGCATACAAAGATGCCTGG - Intronic
1174990133 20:55500331-55500353 ACAGTGTAAATAAAGCCACCAGG - Intergenic
1175242426 20:57559740-57559762 ACAGTGTGACCCAAGCCCCCAGG + Intergenic
1176891800 21:14327528-14327550 ACAGTGTAAACAAAGCTGTGGGG + Intergenic
1177050290 21:16224965-16224987 ACAGTGTAAACAAAGCCACAGGG + Intergenic
1177129680 21:17240833-17240855 ACAGTGTAAACAAAGCTGCCAGG + Intergenic
1177136390 21:17308979-17309001 ACAGTGTAAACAAACCCACTGGG + Intergenic
1177313249 21:19424526-19424548 ACAATGTAAACAAAGCTGCTGGG + Intergenic
1177425903 21:20922464-20922486 ACAGTGTAAACAAAACCACTGGG + Intergenic
1177541008 21:22493859-22493881 ACAGTATAAACAAAGCCACTAGG + Intergenic
1178007117 21:28234405-28234427 ACGGTGTAAACAAAGCCACTGGG + Intergenic
1178393579 21:32219838-32219860 ACAGTGTAAACAAAGCCTTAGGG + Intergenic
1178864433 21:36316452-36316474 ACAGTGTAAACAAAACTGCAGGG - Intergenic
1180596250 22:16975372-16975394 ATAGTGTAAACAAACCCTCCAGG + Intronic
1180601777 22:17024561-17024583 ACTAGGTAAACAAAGCCACCAGG + Intergenic
1180993608 22:19953587-19953609 GTACTGTAAACAAAGCCGGCTGG - Intronic
1181326944 22:22057260-22057282 ACAGTGTAAACAAAGAGGCAGGG - Intergenic
1182204501 22:28609950-28609972 ACAGTGTAAACAAAGCCACCAGG + Intronic
1182952475 22:34390588-34390610 ACAATGTAAACAAAGCAGCACGG - Intergenic
949155027 3:816863-816885 ACAGAGTGAACAAAGCTGCAGGG + Intergenic
949173864 3:1034900-1034922 ACAGTGTAAACAAAGCAACCAGG - Intergenic
949377670 3:3407932-3407954 ACAGTGTAAACAAAGCCGCCTGG + Intergenic
949423515 3:3891400-3891422 ACAGTGTAAACAAAGCTGCCTGG - Intronic
949440161 3:4071667-4071689 ACAGTGTAAACAAAGCTGCCAGG + Intronic
949453327 3:4211797-4211819 ATAGTGTAAACAAAGCAGCCAGG + Intronic
949456612 3:4245911-4245933 TCAGTGTAAACAAAGTGGCAGGG - Intronic
949532101 3:4966202-4966224 ACTATGTAAACAAAGCTGCCAGG + Intergenic
949579848 3:5376989-5377011 ACAGTGTAAACAAAGTGGCCAGG + Intergenic
949580591 3:5384053-5384075 ACAGTGTAAACAAAGCCACTGGG - Intergenic
949583380 3:5412883-5412905 ACATTGTAAACAAAGCTGCCGGG + Intergenic
949594574 3:5530751-5530773 AGAGCATAAACAAAGCCGCTGGG - Intergenic
949641026 3:6036165-6036187 ACAGTGTAAACAAAGCAGCCAGG - Intergenic
949683399 3:6541267-6541289 ACAGTGTAAACAAAGCTGCCAGG - Intergenic
949801180 3:7906112-7906134 ACAGTGTAAACAAAGCCCCCAGG - Intergenic
949846106 3:8372267-8372289 ACAGTGTAAATAAAGCTGCAGGG + Intergenic
950561966 3:13736153-13736175 ACAGTGTAAACAAAGCCGCTGGG - Intergenic
951254482 3:20432903-20432925 ACAGTGTAAACAAAGCCTCTGGG - Intergenic
951310925 3:21125219-21125241 ACAGTATAAACAAAGCCATGGGG + Intergenic
951347217 3:21560924-21560946 ACAGTGTAAACAAAGCCACCAGG - Intronic
951653697 3:24981440-24981462 ACAGTGTAAACAAAGAGGCAGGG - Intergenic
951687584 3:25362266-25362288 ACAGTGTAAAGAAAGCTGCCAGG - Intronic
951741689 3:25931832-25931854 ACAGCATAAACAAAGCTGCAGGG + Intergenic
951777234 3:26323850-26323872 ACAGTGTAAACAAAGCCACTGGG - Intergenic
951826687 3:26876200-26876222 ACAGGGTAAACAAAGCTGCCGGG + Intergenic
952612331 3:35226280-35226302 ATTATGTAAACAAAGCAGCCTGG + Intergenic
952813972 3:37431031-37431053 ACAGTGTAACCAAAGAGGCCAGG - Intronic
952864024 3:37839280-37839302 ACAGTGTAAACAAAGTGGCAGGG + Intergenic
953047254 3:39304893-39304915 ACAGTGTAAACGAAGCCTCCAGG + Intergenic
953074073 3:39551557-39551579 ACAGTGTAAATAAAGCCACTGGG + Intergenic
953102336 3:39842237-39842259 ACAGTATAAACGAAGCCACCTGG - Intronic
953264296 3:41371007-41371029 ACAGTGTAAACAAAGCTGCCTGG + Intronic
953315883 3:41925766-41925788 ACAGCATAAACAAAGCCACATGG + Intronic
953433364 3:42857885-42857907 GCAGTGTAAACAAAGCCACTGGG + Intronic
953555768 3:43945837-43945859 ACAGTGTAAACAAAGCCACTGGG - Intergenic
954490609 3:50901251-50901273 ACAGTGTAAACAAAGCCATCAGG - Intronic
954507657 3:51092379-51092401 ACGGTGTAAACAAAGCCGCTGGG + Intronic
954508183 3:51097383-51097405 ACAATGTAAACAAAGCCACCTGG - Intronic
954510486 3:51120743-51120765 ACAGTGTAAACCAAGTCACCAGG - Intronic
954531092 3:51320688-51320710 ACAGTGGAAACAGAGCCACCAGG + Intronic
954950546 3:54468791-54468813 ACAGTGTAAACAAAGCTGCTGGG + Intronic
954978676 3:54723167-54723189 ACAGTGTAAACAAAGCCACTGGG - Intronic
955021668 3:55127725-55127747 ACAATGGAAACCATGCCGCCAGG + Intergenic
955175091 3:56606049-56606071 ATAGTGTAAACAAAGCGGCCTGG - Intronic
955439770 3:58942937-58942959 ACAGTGAAAACAAAGCCACCAGG + Intronic
955447821 3:59032560-59032582 ACAGTGAAAACAAAGCCACCTGG + Intronic
956005829 3:64777150-64777172 AAAGTATAAACAAAGCTGCCAGG + Intergenic
956207707 3:66771600-66771622 ACAGTGTAAACAAAGCCATTGGG - Intergenic
956220104 3:66893389-66893411 ACAGTGTAAACAAAGCCACTGGG + Intergenic
956236323 3:67075773-67075795 ACAATGTAAAGAAAACCACCCGG + Intergenic
956243424 3:67154635-67154657 ACAGTGTAAACAAAGCCGCCAGG + Intergenic
956301890 3:67781370-67781392 ACAGTGTAAACAAAGCCACCAGG - Intergenic
956316920 3:67948269-67948291 ACAGTATAAACAAAGAGGCCAGG + Intergenic
956355736 3:68390217-68390239 ACAGTGTAAACAAAGCCTCTGGG + Intronic
956383053 3:68686232-68686254 ACAGTGTAAACAAACTGGCCTGG - Intergenic
956398106 3:68847295-68847317 ACAGTGTAAACAAAGTGGCCTGG - Intronic
956786503 3:72647256-72647278 ACAGTGTAAACAAAATAGCCAGG + Intergenic
957011219 3:75008346-75008368 ACAGTGTAAACAAAGCAACCAGG - Intergenic
957249681 3:77757107-77757129 ACAGTGTAAACAAAGCCTCTGGG + Intergenic
957474857 3:80709794-80709816 ACAGTGTAAACAAAGCCACTGGG + Intergenic
957679288 3:83411304-83411326 ACAGTGATAACAAAGAAGCCTGG - Intergenic
957695731 3:83636076-83636098 ACAGTTTTAACAAAGCCACCAGG + Intergenic
957731495 3:84144135-84144157 ACAAAGTAAACAAAGTGGCCAGG + Intergenic
957747666 3:84366043-84366065 ACAGTGTAAACAACACCACTGGG - Intergenic
957776510 3:84761373-84761395 CCAGTGTGAATAAAGCTGCCAGG + Intergenic
957780796 3:84815426-84815448 AGAGGGTAAACAAAGCAGCCAGG - Intergenic
957811578 3:85229086-85229108 ACAGTGTAAATAAAGCTGCCAGG - Intronic
957850431 3:85800163-85800185 ACAATGTAAACAAAGCCTCCAGG - Intronic
957930936 3:86876946-86876968 TCAGTGTAAACAAAGCCACCTGG - Intergenic
957993241 3:87653650-87653672 ACAGTGTAAACAAAGCCACCAGG - Intergenic
958257447 3:91341166-91341188 ACAATGTAAACAAAGCTGCTGGG - Intergenic
958434509 3:94080681-94080703 ACAGTGTAAACAAAGCCATCAGG - Intronic
958520898 3:95184530-95184552 ACAGTGTAAACAAGGACACCGGG - Intergenic
958586259 3:96091554-96091576 ACAGTGTAAACAAAGCCTATGGG + Intergenic
958622204 3:96576041-96576063 ACAGTGTAAACAAAGTCTCTGGG - Intergenic
958694553 3:97510966-97510988 ACAGTGTAAACAAAGCTGCTGGG - Intronic
958742887 3:98096083-98096105 ACAATGTAAACAAAGTGGCCGGG - Intergenic
958793598 3:98682234-98682256 ACAGTGTAAACAAAGCCACCGGG + Intergenic
959025662 3:101237079-101237101 ACAGTGTAAATAAAGCCGCCCGG + Intronic
959091801 3:101911232-101911254 ACAGTGTAGACAAAACCACCAGG - Intergenic
959291903 3:104485311-104485333 ACAGTGTAAACAAAGCTGCTGGG + Intergenic
959534623 3:107470724-107470746 ACAGTGTAAACAAAGCCACCAGG + Intergenic
959734993 3:109648262-109648284 ACAGTGTAAACAAAGCTGCCTGG + Intergenic
959801010 3:110495380-110495402 ACAGTGTAAACAAAGCCACCAGG + Intergenic
959815823 3:110671930-110671952 ACAGTGTAAACAAAGCTGCCGGG + Intergenic
959848088 3:111057021-111057043 ACAGTGTAAACAAAGCCCCCAGG + Intergenic
959881185 3:111446884-111446906 ACAGTATAAACAAAGCCACTGGG - Intronic
960075981 3:113485444-113485466 ACAGTGTAAACAAAGCCACCAGG + Intronic
960177298 3:114532350-114532372 ACAGTGAAAACAAAGCCACCAGG + Intronic
960226899 3:115179392-115179414 ACTGTGTAAACAAAACTGCCGGG - Intergenic
960655954 3:120004240-120004262 ACAGTGTAAACAAAGCAGCAGGG + Intronic
960760083 3:121063769-121063791 ACAGTGTAAACAAAGCCGCCAGG - Intronic
960763300 3:121097107-121097129 ACAGAGTAAACAAAGCAGCCAGG - Intronic
960773141 3:121216960-121216982 ACAGTATAAACAAAGCCACCAGG - Intronic
961310604 3:125996944-125996966 ACAGTGTAAACAAAGCCACTGGG + Intergenic
961977533 3:131042474-131042496 ACAGTATAAACAAAGCTGCCAGG + Intronic
961998234 3:131269045-131269067 ATAGTGTAAACAAAGCTGCTGGG - Intronic
962064397 3:131963603-131963625 ACAGTGTTAAGCAAGCTGCCGGG + Intronic
962113682 3:132477911-132477933 ACAGTGAAAACAAATGCGACAGG - Intronic
962156876 3:132957083-132957105 ACTGTGTAGACAAAGCCACCTGG + Intergenic
962181092 3:133207081-133207103 ACATTGTAAACAAAGCCACTGGG - Intronic
962634764 3:137319364-137319386 ACAGTGTAAACAAAGCCGATAGG - Intergenic
962642346 3:137400600-137400622 ATAGCATAAACAAAGCCACCAGG - Intergenic
962668408 3:137679707-137679729 TCAGTGTAAACGAAGCCACAGGG + Intergenic
963013949 3:140803063-140803085 ACAGTGTAAACAAAGCTGCTGGG - Intergenic
963048476 3:141122592-141122614 ACAGTGTAAACAAAGAGGCTGGG - Intronic
963629280 3:147712938-147712960 ACAGTGTAAACAAAACTGCCAGG - Intergenic
963898677 3:150712505-150712527 ACAGTGTAAACAAAGCCACCAGG + Intergenic
963976333 3:151484162-151484184 ACAGTATAAACAAAGCCGCTTGG + Intergenic
963980257 3:151529065-151529087 ACAGTGTAAACAAAGCTGCCGGG + Intergenic
964010383 3:151885504-151885526 ACAGTGTAAACAAAGCTGCCAGG + Intergenic
964049467 3:152373076-152373098 ACAGTATAAACAAAGCTTCTGGG - Intronic
964053112 3:152419968-152419990 ACGATGTAAACCAAGCTGCCAGG + Intronic
964214376 3:154263045-154263067 ACTAGGTAAACAAAGCGGCCAGG + Intergenic
964264173 3:154875344-154875366 GCAGTGTAAACAAAGCTGCCAGG + Intergenic
964371350 3:156003865-156003887 ACAGTGTAAACAAGGCCACTGGG - Intergenic
964378015 3:156068939-156068961 ACAGTGTAAACAAAGCTGCCAGG - Intronic
964632774 3:158830775-158830797 ACAGTGTGGACAAAGCCGCTGGG - Intergenic
964649077 3:158991335-158991357 ACAATGTAAACAAAGCCACCTGG - Intronic
964904850 3:161707447-161707469 ACTGTGTAAACAAAGCCACCAGG + Intergenic
965025514 3:163297129-163297151 ACACTGTAAACAAAGCCACTGGG + Intergenic
965091054 3:164163202-164163224 ACATTGTAAACAAAGCCTCCAGG - Intergenic
965293170 3:166909671-166909693 ACAGTGTAAGCAAAACCACTAGG - Intergenic
965324776 3:167289948-167289970 ACAGTGTAAACAAAGCTGCTGGG + Intronic
965497279 3:169413749-169413771 ACAGTGTAAACAAAGCCACCAGG + Intronic
965511124 3:169568581-169568603 ACAGTGTAAACAAAGCCACCAGG + Intronic
965618716 3:170621432-170621454 ACAGTGTAAACAAAGCCACCAGG - Intronic
965655031 3:170975052-170975074 ACAGTGTAAGCAAAGCCACCTGG - Intergenic
965880468 3:173382514-173382536 CCAGTGTAAACAAAGCTGGTTGG + Intergenic
966255094 3:177908456-177908478 ACAGTGTAAACAAAACTGCTTGG - Intergenic
966255151 3:177908834-177908856 ACAGTGTAAACAAAACTGCTAGG + Intergenic
966309425 3:178576705-178576727 ACAGTGTAAACAAAGCCACCCGG + Intronic
966493738 3:180556654-180556676 ACAGTGTAAACAAAGCCGCTGGG + Intergenic
966561438 3:181325015-181325037 ACAGTGTAAACAAAGCCCCCAGG - Intergenic
966637899 3:182156484-182156506 ACAGTGTAAACAAAGCCACTGGG - Intergenic
967181484 3:186909314-186909336 ACAGTGTAAACAAAACCGCCAGG - Intergenic
967343522 3:188427689-188427711 ACAGTGTAAACAAAGCCCCCAGG - Intronic
967419555 3:189258781-189258803 ACAGTGTAAACAAAGCCACTGGG - Intronic
967562650 3:190934789-190934811 ACAGTGTAAACAAAGCTGCCTGG - Intergenic
968004187 3:195228246-195228268 ACAGTGTAAACAGGGCAGTCAGG - Intronic
968388838 4:171505-171527 AGGGGGTAAACAAAGCGGCCAGG - Intergenic
968829087 4:2922915-2922937 ACAGTGTAAACAAAGCTGCCAGG - Intronic
968860631 4:3166588-3166610 ACAGTGTAAACAAAGCAGCAGGG - Intronic
970304729 4:14719304-14719326 ACAGTGTAAACAAAGCCTCCAGG + Intergenic
970496294 4:16629098-16629120 ACAGTGTAAACAAAGTGGCAGGG + Intronic
970685261 4:18559780-18559802 AGAGTGTAAACAAAGCTGCTGGG + Intergenic
970727190 4:19060503-19060525 ACAGTGTAAGCAAAGCCTCCAGG + Intergenic
970775453 4:19669070-19669092 ATAGGGTAAACAAAGACGCCAGG + Intergenic
971004508 4:22357910-22357932 ACAGTGCAAACAAAGCTGCCCGG + Intronic
971126284 4:23758847-23758869 CAAGTGTAAACCAAGCCCCCTGG + Intronic
971438660 4:26655533-26655555 ACTAGGTAAACAAAGCAGCCAGG - Intronic
971647696 4:29229977-29229999 ACAGTTTAAACAAAGCTGCCTGG + Intergenic
971943181 4:33241350-33241372 ACAGTGTAAGCAAAGCTACTGGG - Intergenic
972178755 4:36439776-36439798 ACAGTGTAAACAAAGAGGCTTGG - Intergenic
972219336 4:36935979-36936001 ACAGTGTAAACAAAGCCACTGGG + Intergenic
972685624 4:41349909-41349931 AGTAGGTAAACAAAGCCGCCGGG + Intergenic
972743259 4:41909286-41909308 ATAGTGTAAACAAAGCTGCTGGG - Intergenic
972755581 4:42042435-42042457 ACAGTGTAAACAAAGCCATCAGG + Intronic
973081840 4:46003052-46003074 ACAGTATAAACAAGGCCACAGGG - Intergenic
973111723 4:46405137-46405159 AAAGTGTAAACAAAGCAGCCAGG + Intronic
973237631 4:47922704-47922726 ACAGTGTAAACAAAGTGGCAGGG - Intronic
973273019 4:48280276-48280298 ACAGTGTAAACAAAGCCACCGGG + Intergenic
973312967 4:48729210-48729232 ACAGTGTAAACAAAGTGGCAAGG + Intronic
973556797 4:52091981-52092003 ACAGTGTAAACAAAGCTGCTAGG - Intronic
973660921 4:53105549-53105571 ACAGTGTAAACAAAGCCACAGGG + Intronic
973715207 4:53669595-53669617 AAAGTGTAAACAAAGCCACCAGG - Intronic
973799127 4:54459244-54459266 ACAGTGTAAACAAAGCCGCAGGG + Intergenic
973837506 4:54825062-54825084 ACAGTGTAAACAAAGACGCCAGG + Intergenic
973871333 4:55169778-55169800 ACAGCGTAAACAAAGAGGCTGGG - Intergenic
974106229 4:57472647-57472669 ACAGTATAAACAAAGCAGCCAGG - Intergenic
974191496 4:58509858-58509880 ACATTGGTAACAAAGCAGCCAGG - Intergenic
974196762 4:58585235-58585257 ACAGTGTAAACAAAGCCACCTGG - Intergenic
974251764 4:59394284-59394306 ACAGTGTGAAAAAAGCCTCTGGG - Intergenic
974263964 4:59560383-59560405 ACAGTGTAAACAAAGCTGCCTGG - Intergenic
974265733 4:59584009-59584031 ACAGCGTAAACAAAGCCACTGGG - Intergenic
974280035 4:59780500-59780522 TCAGTGTAAACAAAGCAGCCAGG + Intergenic
974307082 4:60156136-60156158 ACAGTGTAAACAAAGCTGCCAGG - Intergenic
974326286 4:60419138-60419160 ACAGTGTAAACAAAGCTGCTGGG - Intergenic
974453295 4:62094123-62094145 ACAGTGTAAACAAAGCCGCCAGG - Intergenic
974719897 4:65725144-65725166 ACAGTGTAAACAAAGTGGCAGGG + Intergenic
974813969 4:66982104-66982126 TCAGTGTAAAAAAACCCACCAGG + Intergenic
974837985 4:67273857-67273879 ACAGTGTAAACAAAGAAGGTGGG - Intergenic
974851769 4:67412496-67412518 ACAGTGTAAACAAAGCCACCAGG - Intergenic
975064297 4:70041569-70041591 ACAGTGTAAACAAAGAGGCCAGG - Intergenic
975094090 4:70437371-70437393 ACAATGTAAACAAAGAGGCAGGG - Intronic
975104130 4:70548960-70548982 ATAGTATAAATAAAGCCGCCAGG + Intergenic
975149394 4:71004736-71004758 ACAGTGTAAACAAAACCACCTGG - Intronic
975245882 4:72120142-72120164 CCAGTGTAAACAAAGCCTCCAGG + Intronic
975305681 4:72846625-72846647 ACAGTGTAAACAAAGCAATGAGG + Intergenic
975424961 4:74214973-74214995 ACAGTGTAAACAAAGCCACCAGG - Intronic
975449322 4:74505782-74505804 ACAGTGTAAACAAAGAGGCCAGG + Intergenic
975524266 4:75331663-75331685 ACAGTGTAAACAAAGCCACTAGG + Intergenic
975638804 4:76478340-76478362 ACAGTGTAAACAAAGCCACTGGG + Intronic
975764702 4:77655108-77655130 ACAGTGTAAACGAAGCCGCCAGG + Intergenic
975807266 4:78126050-78126072 ACAGTGTAAACAAAGCAGCAGGG - Intronic
976006810 4:80439914-80439936 ACAGTGTAAACAAAGCTGCCAGG + Intronic
976023924 4:80664507-80664529 ACAGTGTAAACAAAGCTGCCAGG - Intronic
976061243 4:81130761-81130783 ACAGTGTAAACAAAGCCGCGGGG - Intronic
976065568 4:81183856-81183878 ATAGTGAAAACAAAGCTGCAGGG + Intronic
976092727 4:81474042-81474064 ACAGTGTAAACAAAGCCTCTGGG + Intronic
976114865 4:81715601-81715623 ACATTGTAAACAAAGCCGCCAGG + Intronic
976159592 4:82184578-82184600 ACAGTGTAAACAAAGTGGCAGGG + Intergenic
976167621 4:82272137-82272159 ACAGTGTAAACAAAGCTGCTGGG + Intergenic
976363073 4:84202975-84202997 ATAGTGTAAACATAGCTGCTGGG + Intergenic
976370824 4:84286295-84286317 AAAGTGTAAACAAAGCCGCCAGG + Intergenic
976438309 4:85044008-85044030 ACAGTGTAAACAAAGCTGCTGGG + Intergenic
976439293 4:85055130-85055152 ACAGTGTACACAAAACCACTGGG + Intergenic
976445964 4:85129893-85129915 ACAGTGTAAACAAAGCCTCCAGG - Intergenic
976449118 4:85166457-85166479 ACAGTGTAAACAAAGCCACTGGG - Intergenic
976552565 4:86413577-86413599 ACAGTGTAAACAAAGCAGCCGGG - Intronic
976585390 4:86791325-86791347 ACAGTGTAAACAAAGCGGCCGGG + Intronic
976655909 4:87488866-87488888 ACAGTGTAAACAAAGCTGCTAGG - Intronic
976669519 4:87636537-87636559 ACAGTGTAAACAAAGCCGCTAGG + Intergenic
976715955 4:88122525-88122547 ACAGTGTAAACAAAGCCTCTGGG + Intronic
976785060 4:88809981-88810003 AAACTATAAACAAAGCTGCCTGG - Intronic
976903506 4:90208280-90208302 ACAGCATAAACAAAGCTGCTGGG - Intronic
977046920 4:92079348-92079370 ACAGTGTAAACAAAGTCACAGGG + Intergenic
977154488 4:93555471-93555493 ACAGTGTAAACAAAGCTTCCTGG + Intronic
977185640 4:93932581-93932603 ACAGTGTAAACAAAGCCACCAGG - Intergenic
977326459 4:95580459-95580481 ACAGTGTAAACAAAGAGGCCAGG - Intergenic
977467745 4:97403135-97403157 ACAGTGTAAACAAAGCCCCCAGG - Intronic
977561324 4:98536771-98536793 ACAGTTTAAACAAAGGCACTGGG - Intronic
977630681 4:99239278-99239300 AGGGGGTAAACAAAGCAGCCTGG - Intergenic
977631460 4:99247976-99247998 ACATTGTAAACAAAGCTGCCAGG - Intergenic
977632967 4:99263593-99263615 ACAGTGTAAACAAAGCTGCCAGG - Intergenic
977671406 4:99699433-99699455 ACAGTGTAAACAAAGGCACCAGG + Intergenic
977774441 4:100900808-100900830 ACAGTGGAAACAAAGCCGCCTGG + Intergenic
977887899 4:102273308-102273330 ATAATGTAAACAAAGCCTCCAGG + Intronic
977986192 4:103385758-103385780 ACAGTGTAAACAAAGCCACCAGG + Intergenic
977994471 4:103485124-103485146 ACAGTGTAAACACAGCCGCTGGG + Intergenic
978108284 4:104930922-104930944 ACAGTGTAAACAAAGCGGCCAGG + Intergenic
978150323 4:105426678-105426700 ACAGTGTAAACAAAGCCGCAGGG + Intronic
978179521 4:105776122-105776144 GCAGTATAAACAAAGCCACCAGG - Intronic
978186042 4:105858187-105858209 ACAATGTAAACAAAGCCGCAGGG - Intronic
978205297 4:106073783-106073805 AGTGGGTAAACAAAGCAGCCAGG - Intronic
978236903 4:106471337-106471359 ACAGTGTAAACAAAGCCACTGGG - Intergenic
978278314 4:106978518-106978540 CCAGTGCAAACAAAGCCTCCAGG - Intronic
978313293 4:107409653-107409675 ACAGTATAAACAAAGCTGCCAGG + Intergenic
978464554 4:108994438-108994460 ACAGTGTAAACAAAGTGGCTGGG + Intronic
978552147 4:109939190-109939212 ACAGTGTAAACAAAGAGGCAGGG - Intronic
978601401 4:110431943-110431965 ACAGTGTAAACAAAGCCACTAGG - Intronic
978906620 4:114012940-114012962 ACAGTGTAAACAAAGCCTCAGGG - Intergenic
979022856 4:115525062-115525084 ACAGTGTTAAGGAAGCCGCTGGG - Intergenic
979043694 4:115834621-115834643 ACAGTGTAAACAAAGCCACAGGG + Intergenic
979315363 4:119255397-119255419 ACGGTGTAAACAAAGCAGCAGGG - Intronic
979417470 4:120461018-120461040 ACAGTGTAGACAAAGCCAAGAGG + Intergenic
979421407 4:120509475-120509497 ACAGCATAAACAAAGCCACCAGG + Intergenic
979461597 4:120990473-120990495 ACAGTGTAAACAAAGCCACCAGG - Intergenic
979581375 4:122365198-122365220 ACAGTGTAAACAAAGCCTCCAGG + Intergenic
979588246 4:122446082-122446104 ACAGTGTAAACAAAGCCACCGGG - Intergenic
979653093 4:123159319-123159341 ACAGTTTTAATAAAGCAGCCTGG + Intronic
979668262 4:123336462-123336484 ATAGTGTAAACAAAGCTGCTGGG - Intergenic
979819365 4:125151630-125151652 ACAGTGTTAAGGAAGCCTCCAGG - Intergenic
979965961 4:127077116-127077138 ACAGTGTAAACAAAGCTGCTGGG - Intergenic
979998695 4:127463929-127463951 ACAGTGTAAACAAAGTCACTGGG - Intergenic
980037797 4:127905152-127905174 ACAGTGTAAACTAAGTGGCAGGG - Intergenic
980100303 4:128535641-128535663 ACAGTGTAAACAAAGCAGCCAGG - Intergenic
980157618 4:129126299-129126321 ACAGAGTAAACAAAGCCACTGGG - Intergenic
980223293 4:129947743-129947765 ACAGTGTAAAGAAAGCCGCCAGG - Intergenic
980260568 4:130442545-130442567 AGGGTGTAAACAAAGAGGCCTGG - Intergenic
980330371 4:131403362-131403384 ACAGTGTAAACAAAGTCTCCAGG - Intergenic
980477289 4:133334119-133334141 ACAGTGTAAACAAAGCTGCAGGG - Intergenic
980494156 4:133570078-133570100 ACAGTTTAAACAAAGCTGCAGGG - Intergenic
980583627 4:134786383-134786405 ACAGTGTAAACAAAGGCGCCAGG - Intergenic
980584063 4:134789717-134789739 ACAGTGCAAACAAAGCAGCAGGG + Intergenic
980633910 4:135473728-135473750 ACAGTGTACACAAAGCCCCAGGG - Intergenic
980733224 4:136848755-136848777 ACAGTGTAGACAAAGCCTCCTGG - Intergenic
980769342 4:137351241-137351263 ACAGTGTAAACAAAGCCCCTGGG + Intergenic
980803581 4:137784129-137784151 ACAGTGTAAACAAAGTGGCAGGG + Intergenic
981131595 4:141163165-141163187 ACAGTGTAAACAAAGCCACCGGG + Intronic
981199699 4:141966174-141966196 ACAGTTTAAACAAAGCAACAGGG + Intergenic
981296675 4:143140725-143140747 ACAGTGTAAACAAAGCCACGGGG + Intergenic
981411268 4:144435291-144435313 ACAGTGTAAACAAAGCCACCTGG + Intergenic
981481458 4:145243273-145243295 ACAGTATAAACAAAGCCACTGGG - Intergenic
981629711 4:146804597-146804619 ACAGTGTAAAGAAAGCCTCTGGG + Intronic
981662531 4:147184245-147184267 ACAGTGTAAACAAAGGTGCCAGG + Intergenic
981671555 4:147292822-147292844 ACAGTGTAAACAAAGCCATCAGG + Intergenic
981749878 4:148082939-148082961 CCAGTGTAAACAGAGCCACCGGG + Intronic
981787972 4:148502677-148502699 ACAGTGTAAACAAAGATGCCGGG - Intergenic
981789616 4:148521684-148521706 ATAGTGTAAACAAAGCTGCAGGG - Intergenic
981846531 4:149176215-149176237 ACAGTGTAAACAAAGCCACCAGG + Intergenic
981850994 4:149229872-149229894 ACAGTGTAAACAAAGCAGCAGGG + Intergenic
981859837 4:149341313-149341335 ACAGTGTAAACAAAGCCACCAGG - Intergenic
981918929 4:150066044-150066066 AGATTGTAAACAAAACCTCCAGG + Intergenic
981939981 4:150271721-150271743 ACGGTGTAAACAAAGCCTCTGGG + Intronic
982060261 4:151597807-151597829 ACAGTATAAACAAAGTCACCTGG - Intronic
982298945 4:153859509-153859531 ACAGTGTGAACAAAACTACCAGG - Intergenic
982323890 4:154109144-154109166 ACAGTGTAAACAAAGTCGCCTGG + Intergenic
982725592 4:158902764-158902786 ACAGTGTAAACAAAGCTGCCTGG - Intronic
982733432 4:158980067-158980089 ACAGTGTAAACAAAGCTTCTGGG + Intronic
982793041 4:159615073-159615095 AGTAGGTAAACAAAGCCGCCAGG - Intergenic
982794526 4:159629504-159629526 ACAGTGTAAACAAAGCCACCAGG - Intergenic
982825745 4:160002016-160002038 ACAGTGTAAACAAAGCTGCAGGG + Intergenic
982852945 4:160342252-160342274 ACAATGTAAACAAAGCCACCTGG - Intergenic
982909207 4:161118025-161118047 ACAGTGTAACCAAAGCCTCCAGG - Intergenic
983044505 4:162969640-162969662 ACAGTGCAAACAAAGCCACCAGG - Intergenic
983047464 4:163004497-163004519 ACAGTGTAAACAAAGCTGCCAGG - Intergenic
983167689 4:164497494-164497516 ACAGTGTAAACAAAGCCACTAGG - Intergenic
983179461 4:164630804-164630826 ATAGTGTAAACAAAGCCACCAGG + Intergenic
983331372 4:166333518-166333540 ACAGTGTAAACAAAGCCGCCAGG - Intergenic
983362411 4:166743933-166743955 ACTAGGTAAACAAAGCAGCCAGG + Intronic
983556872 4:169066983-169067005 ACAGCGAGAACAAAGCAGCCAGG + Intergenic
983602728 4:169548746-169548768 ATGGTGTAAACAAAGCCACTGGG - Intronic
983788085 4:171759493-171759515 ACAGTGTAAACAAGGGTGCTGGG + Intergenic
983840873 4:172455570-172455592 ACAGTGTAAACAAAGCCACCGGG + Intronic
983896209 4:173084591-173084613 ACAGTGTAAACAAAGCTGCTGGG - Intergenic
983949443 4:173622331-173622353 ATGGTGTAAACAAAGCCACCAGG - Intergenic
983958793 4:173727725-173727747 ACAGTGTAAAAAAAGCCACCGGG - Intergenic
984493694 4:180468788-180468810 ACAGTGTAAACAAAGCCGCTGGG + Intergenic
984618657 4:181927385-181927407 ACAGTGTAAATAAAGCCGCCAGG + Intergenic
985194001 4:187408209-187408231 ACAGTGAAATCAAAGCCACCAGG - Intergenic
985367345 4:189245671-189245693 ACAGTGTGAACAAAGCGGCAGGG - Intergenic
986110368 5:4710002-4710024 ACCATGTAAACAAAGCCACCAGG + Intergenic
986149592 5:5115338-5115360 ACAGTGTAAACAAAGCAGCAGGG - Intergenic
986378819 5:7162581-7162603 ACGGTGTAAACAAAGCCACCAGG - Intergenic
986581671 5:9272231-9272253 ACAGTGTAAACAAAGCCACTGGG + Intronic
986656354 5:10016694-10016716 ACAGTGTAAACAAAGAGGCCAGG - Intergenic
986675200 5:10178021-10178043 ACAGCATAAACAAAGCCACCAGG + Intergenic
986838823 5:11672550-11672572 ACAGTGTAAACAAGCCTGCCAGG - Intronic
986879601 5:12153863-12153885 ACAGTGTAAACAAAGCCACCTGG + Intergenic
987234188 5:15927188-15927210 AGAGTGTAAACAAAGGAGCGTGG - Intronic
987445007 5:18006482-18006504 ACAGTGTAAACAAAGCAGCAGGG + Intergenic
987656545 5:20814992-20815014 TCAGTGTAAACAAAACCACTGGG + Intergenic
987687602 5:21225619-21225641 ACAGAGTAAACAAAGCTGCAGGG + Intergenic
987704605 5:21446795-21446817 TCAGTGTAAACAAAGCCCCCTGG - Intergenic
987720555 5:21627682-21627704 ACAGGGTAAACAAAGCCTTTGGG - Intergenic
987924068 5:24317745-24317767 ACAGTGTAAACAAAGCTGCCAGG - Intergenic
988023657 5:25655517-25655539 AGTAGGTAAACAAAGCCGCCAGG - Intergenic
988289822 5:29270699-29270721 ACAGTGTAAACAAAGCCACAGGG + Intergenic
988402116 5:30775798-30775820 ACAATACAAACAAAGCCCCCAGG + Intergenic
988618231 5:32795371-32795393 ACAGTGTAAACAAAGCCACCTGG + Intergenic
988628007 5:32898644-32898666 ACAGTGTAAACAAAGCTGCAAGG - Intergenic
988719226 5:33859371-33859393 ACAGTGTAAACAAAGCTGCCAGG + Intronic
988767011 5:34388953-34388975 TCAGTGTAAACAAAACCACTGGG - Intergenic
988772571 5:34447564-34447586 ACAGTGTAAACAAAGCTGCTGGG - Intergenic
988840161 5:35075517-35075539 AGATTGTAAACAAAGTGGCCAGG + Intronic
988917751 5:35912190-35912212 AGACGGTAAACAAAGCAGCCAGG + Intronic
989084064 5:37656724-37656746 ACAGTTTTAACAAAGCCACTGGG - Intronic
989194182 5:38699997-38700019 ACAGTGTAAACAAAGCTGCTGGG + Intergenic
989253653 5:39343504-39343526 AATATGTAAACAAAGCAGCCAGG + Intronic
989320701 5:40130829-40130851 ACAGTGTAAACAAAGTCACTGGG - Intergenic
989358055 5:40567047-40567069 ACAGTGTAAATAAAGAGGCTTGG - Intergenic
989516824 5:42353633-42353655 ACAGTGTAAACAAAGAGGCCAGG + Intergenic
989569513 5:42932196-42932218 AGTAGGTAAACAAAGCCGCCGGG + Intergenic
989619030 5:43366924-43366946 ACAGTTTAAACAAAGCCACTGGG - Intergenic
989671130 5:43918097-43918119 ACTAGGTAAACAAAGCAGCCAGG - Intergenic
989675229 5:43965719-43965741 ACAGTGTAAACAAAGTTGCAGGG - Intergenic
989687612 5:44108311-44108333 ACAGTGTAAACAAAGCCACCAGG - Intergenic
989825349 5:45848146-45848168 ACAGTGTAAACAAAGCAGCCAGG + Intergenic
989845108 5:46131365-46131387 AGTGGGTAAACAAAGCGGCCTGG + Intergenic
990098868 5:52157005-52157027 ACAGTGTAAGCAAAACCTCCAGG + Intergenic
990164323 5:52977689-52977711 ACAGTGTAAACAAAGTTACCAGG - Intergenic
990183756 5:53191112-53191134 ACAGTGTAAACAAAGCCACCAGG - Intergenic
990224273 5:53631653-53631675 ACAGTGTAAACAATGCTGCTGGG - Intronic
990226932 5:53665487-53665509 ACTAGGTAAACAAAGCAGCCAGG - Intronic
990368931 5:55097025-55097047 ACAGTGTAAACAAAGAGGCCAGG + Intergenic
990739500 5:58897805-58897827 CCAGAGTAAAGAAAGCTGCCAGG + Intergenic
990745838 5:58958865-58958887 ACAGTGTAAACAAAGCCAAGGGG - Intergenic
990803520 5:59632105-59632127 ACAGTGTAAACAAAGCTGCCAGG + Intronic
990837815 5:60042169-60042191 ACAGTGTAAACAAAGCCACCAGG + Intronic
990897580 5:60715693-60715715 ACAGTGTAAACAAAGCCGCCGGG - Intergenic
990898942 5:60729313-60729335 ACAGTCTAAACAAAGTGGCAGGG + Intergenic
991026656 5:62037420-62037442 ACAGTATGAACAAAGCAGTCAGG - Intergenic
991128145 5:63090668-63090690 ACAGTGTAAACAAAGCTGCTGGG + Intergenic
991151485 5:63376173-63376195 ATGGTGTAAACAAAGCCACAGGG + Intergenic
991161388 5:63507624-63507646 ACAATGTAAACAAAGTCGCTGGG + Intergenic
991223586 5:64243447-64243469 ATAATGTAAACAAAGACGCCTGG + Intronic
991236723 5:64407338-64407360 ACAGTGTAAACAAAGCCACTAGG + Intergenic
991242345 5:64474413-64474435 AAGGTGTAAACAAAGCCTCTGGG + Intergenic
991364279 5:65852583-65852605 ACAGTATAAACAAAGTGGCAGGG - Intronic
991417212 5:66405304-66405326 ACAGTGTAAACAAAACCAATGGG - Intergenic
991602894 5:68371141-68371163 ACAGTGTATACAGAGCCCCCAGG - Intergenic
991634638 5:68692062-68692084 ACTAGGTAAACAAAGCTGCCTGG + Intergenic
991652086 5:68865630-68865652 ACAGTGTAAACAAAACCACTGGG + Intergenic
992038863 5:72808807-72808829 ACAGTGTAAACAAAGCCTCCGGG - Intergenic
992077879 5:73207432-73207454 ACAGTGTAAACAAACCCGCCGGG + Intergenic
992254865 5:74911544-74911566 ACAGTGTAAACAAAGCCACTGGG - Intergenic
992292422 5:75293021-75293043 ACAGTGTAAAGAAAGCCGCTGGG - Intergenic
992316957 5:75566143-75566165 ACAGTGTAAACAAACCCAGTGGG - Intronic
992338484 5:75798289-75798311 AGCAGGTAAACAAAGCCGCCAGG - Intergenic
992506064 5:77388849-77388871 ATAGTGTAAACAAAGCCACCAGG - Intronic
992740603 5:79770080-79770102 ACGGTGTCAACAAAGCCTCCAGG - Intronic
992854495 5:80846575-80846597 ACAGTGTAAACAAAGTGGCCTGG - Intronic
992908723 5:81373731-81373753 ACAGTGTAAACAAAGCCACCAGG + Intronic
992976890 5:82130121-82130143 ACAGTGTAAAGAAAGCCGCCTGG - Intronic
992977686 5:82138003-82138025 ACAGTATAAACAAAGCCTCTGGG - Intronic
993119142 5:83753824-83753846 ACAGTGTAAACAAAGCTGCTGGG + Intergenic
993142378 5:84050793-84050815 AGAAGGTAAACAAAGCAGCCAGG + Intronic
993265496 5:85721685-85721707 ACAGCATAAACAAAGCTGCCAGG + Intergenic
993345560 5:86778089-86778111 ACAGTGTAAACAAAGCTGCCAGG - Intergenic
993381840 5:87217645-87217667 ACAGTGTAAACAAAGCTGCTGGG - Intergenic
993410463 5:87567304-87567326 ACAGTGTAAAAAAAGGCCACTGG - Intergenic
993438287 5:87924638-87924660 ACAGTGTAAACAAAGTGACTGGG - Intergenic
993460149 5:88172905-88172927 ACAATGTAAACAAAGCCTCCAGG - Intergenic
993541644 5:89159542-89159564 ACAGTGTAAACAAAGCCACCTGG + Intergenic
993609025 5:90031872-90031894 ACAGTGTAAACAAATCCGCTTGG + Intergenic
993757609 5:91750990-91751012 ACGATGTAAACAAAGCCTCTGGG - Intergenic
993891702 5:93482814-93482836 ACAGTGTAAACAAAGCCTCTGGG + Intergenic
993895001 5:93523211-93523233 ACAGTGTAAACAAAGCCTCTGGG + Intergenic
993928418 5:93902436-93902458 AAAGGGTAAATAAAGCAGCCAGG + Intronic
993960948 5:94296183-94296205 ACAGTGTAAACAAAGCCACCTGG - Intronic
994005153 5:94828732-94828754 ACAGTGTAAACAAAGCTGCCAGG - Intronic
994039687 5:95244662-95244684 ACAGTGTAAACCAAGCTGCTGGG + Intronic
994142843 5:96361108-96361130 AGAGTGTAAACAAAGCTGCCAGG - Intergenic
994160346 5:96549880-96549902 ACAATGTAAACAAAGCTGCAGGG + Intronic
994233521 5:97336167-97336189 ATAGTATAAACAAAGCTGCTAGG - Intergenic
994378087 5:99037966-99037988 ACAGTGTAAACAAAGCATCCAGG + Intergenic
994438050 5:99763573-99763595 ACAATGTAAACAAAGTCATCAGG - Intergenic
994609535 5:102018928-102018950 ACAGTGTAAACAAAGCCACCAGG + Intergenic
994622456 5:102179287-102179309 ACAGTGTAAACAAAGCCTCTGGG - Intergenic
994624136 5:102196597-102196619 ACAGTGTAAACAAAGAGGTCTGG - Intergenic
994641972 5:102421484-102421506 ACAGTGTAAACAAAGCCGATGGG + Intronic
994918030 5:106004649-106004671 ACAGTATAAATGAAGCCACCAGG - Intergenic
995108216 5:108399140-108399162 ACAGTGTAAACAAAACCAAAGGG + Intergenic
995136556 5:108685877-108685899 ACAGTGTAAACAAAGCCACGGGG - Intergenic
995162485 5:108997912-108997934 ACAGTGTAAACAAAGCCACAGGG - Intronic
995263767 5:110135734-110135756 ACAGTGTAAACAAAGCCACTGGG - Intergenic
995326200 5:110892823-110892845 ACAGTGTAAACAAAGCCACCAGG - Intergenic
995398689 5:111716967-111716989 ACAGTGTAAACAAAGCTGCTGGG - Intronic
995464429 5:112436329-112436351 ACAGTGTAAACAAAGCTGCCAGG + Intergenic
995471232 5:112503955-112503977 ACAGTGTAAACAAAGCCACCAGG + Intergenic
995475058 5:112539316-112539338 ACAGTGTAAACAAAGCCACTGGG + Intergenic
995480386 5:112586699-112586721 ACAGTGTAAACAAAGCCTATGGG + Intergenic
995612378 5:113923967-113923989 ACAGTGTAAACAAAGCCACTGGG + Intergenic
995620622 5:114021612-114021634 ACAGTGTAAAAAAAGCCGCCAGG + Intergenic
995642955 5:114278519-114278541 ACAATGTAAACAAAGCAGCAGGG - Intergenic
995695753 5:114876582-114876604 ACAGTGTAAACAAAGCCCCCAGG + Intergenic
995790642 5:115882978-115883000 ACAGTGTAAACAAACCCACCTGG - Intronic
995808574 5:116080539-116080561 TCATTGTAAACAAAGCCGCTGGG + Intergenic
996129957 5:119769891-119769913 ACAGTGTAAACAAAGCTGCCGGG + Intergenic
996324047 5:122252488-122252510 ACAGTGTAAACAAAGCCACTGGG - Intergenic
996420701 5:123258905-123258927 ACAGTGTAAACAAAACTTCTGGG - Intergenic
996520804 5:124423598-124423620 ACTAGGTAAACAAAGCAGCCAGG + Intergenic
996859110 5:128044380-128044402 ACAGGGTAAACAAAGTGGCCAGG + Intergenic
996910868 5:128655750-128655772 ACAGTGTAAACAAAGCCGCTGGG - Intronic
996987479 5:129584675-129584697 ACAGTGTAAACAAAGCTACCAGG - Intronic
997004815 5:129804887-129804909 ACGGTGTAACCAAAGTCACCAGG - Intergenic
997112203 5:131087620-131087642 AGTATGTAAACAAAGCAGCCTGG + Intergenic
997115582 5:131122824-131122846 ACAGTATAAACAAAGCGGCAGGG - Intergenic
997171791 5:131729462-131729484 TGAGTGTAAACAAAGCTGCTGGG - Intronic
997216661 5:132117123-132117145 ACAGTGTAAACAAAGCCACCTGG + Intergenic
997220344 5:132157197-132157219 ACAGTGTAAACAAAGCTGCCTGG - Intergenic
997252304 5:132398489-132398511 ACAGTGTAAACAAAGCCCCCAGG + Intergenic
997452682 5:133996176-133996198 CCAGTGGGAACAAAGCCCCCAGG - Intronic
997497009 5:134336999-134337021 ACAGTGTAAACAAAGCAGCAGGG - Intronic
997800245 5:136853532-136853554 ACAGTGTAAACAAAGCTGGTGGG - Intergenic
998691605 5:144594518-144594540 ACAGTGTAAACAAACCTGCTGGG - Intergenic
998768229 5:145512359-145512381 ACAGTGTAAACAAATCCACCTGG + Intronic
998934210 5:147216731-147216753 ACAGTGTAAACAAGGCTGCCAGG + Intergenic
999030054 5:148281061-148281083 ACAGTGTAAACAAAGCCACTGGG - Intronic
999468682 5:151831512-151831534 ACAGTGTAAACAAAGCTGCCAGG + Intronic
999488707 5:152026785-152026807 ACAGTGTAAACAAAGCCACCAGG - Intergenic
999489822 5:152039071-152039093 ACAGTGTAAACAAAGCAGCCAGG - Intergenic
999502365 5:152160085-152160107 ACAGTGTAAACAAAGCCACCAGG - Intergenic
999602605 5:153283262-153283284 ACAGTGTAAACAAAGCCACCGGG + Intergenic
999688330 5:154122518-154122540 ACAATGTAAACAAAGCCACTGGG + Intronic
999983941 5:156984806-156984828 ACAGTGTAAACAAAGCTGCAGGG + Intergenic
1000194754 5:158946964-158946986 ACAGTGTTAACAAAGCCACTGGG - Intronic
1000376106 5:160583806-160583828 ACAGTGTAAACAAAGCCACCAGG - Intronic
1000406499 5:160893409-160893431 CCAGTGTAAACAAAGCCACAGGG + Intergenic
1000417469 5:160998034-160998056 AAAGTATAAACAAAGCCTCCTGG - Intergenic
1000590051 5:163147093-163147115 ACAGTGTAAACAAAGCTGCCAGG + Intergenic
1000798366 5:165693188-165693210 ACAGGGTAAACAAAGCCACTAGG - Intergenic
1000996087 5:167960473-167960495 ACAGTGTAAACAAAGCCACTGGG - Intronic
1001341306 5:170848348-170848370 ACAGTGTAAGCAAAGCAGCAAGG + Intergenic
1001346370 5:170903261-170903283 ACAGTGTAAACAAAGACACTTGG - Intronic
1001362658 5:171103378-171103400 ACAGTGTAAACAAAGCTGCCAGG - Intronic
1002673090 5:180886079-180886101 ACTGTGTAAACAAAGCAGCCAGG - Intergenic
1002673544 5:180890060-180890082 TCAGTGTAAACAAAGCCACCAGG + Intergenic
1002677180 5:180926684-180926706 ACAGTGTAAACAAAGCCACCAGG + Intronic
1002944820 6:1750934-1750956 ACAGTGTAAACAAAGCCATCAGG + Intronic
1002996132 6:2286888-2286910 ACAGTGTAAACAAAGCTATCAGG + Intergenic
1003228657 6:4229379-4229401 ACAGTGTAAAGAAAGCCTCCGGG + Intergenic
1003416879 6:5917623-5917645 ACATTGTAAACAAAGCCACCAGG - Intergenic
1003434389 6:6072392-6072414 ACAGTGTAAACAAAGTGGCAGGG - Intergenic
1003713494 6:8619590-8619612 GCAGTGTAAACAAAGCTGCCAGG - Intergenic
1003971024 6:11299328-11299350 ACAGTGAAAACAAAGAGGCCAGG + Intronic
1004028003 6:11837550-11837572 ACAGTGTGAACAAAGCTGCTGGG + Intergenic
1004593236 6:17073808-17073830 ACAGTGTAAACAAAGCCACTGGG + Intergenic
1004944463 6:20596440-20596462 ACAGTGTAAACAAAACTGCCAGG - Intronic
1005274203 6:24198871-24198893 ACAGTGTAAACGAAGCCACGGGG + Intronic
1006198365 6:32263068-32263090 ACAGTATAAACAAAGCTGCTGGG - Intergenic
1007134606 6:39508705-39508727 ACAGTGCAAACAAAGCGGCAGGG + Intronic
1007858149 6:44879288-44879310 ACAGTGTAAGCAAAGCTGCCTGG + Intronic
1008425212 6:51349085-51349107 ACAGTGTAAACAAAGCTGCCAGG - Intergenic
1008575448 6:52856330-52856352 ACAGTGTAAACAAAGCCACCAGG - Intronic
1008782720 6:55126843-55126865 ACAGTATAAACAAAGCAGCCAGG - Intronic
1008785125 6:55158668-55158690 ACAGTGTAAACAAAGCCACTGGG + Intronic
1008865434 6:56204336-56204358 ACAGTGTAAACAAAGCCAGAGGG + Intronic
1008997860 6:57679857-57679879 ACAGTGTAAACAAAGCTGCTGGG + Intergenic
1009054346 6:58316837-58316859 ACAGTGTAAACAAAGCTACCAGG + Intergenic
1009186347 6:60579195-60579217 ACAGTGTAAACAAAGCTGCTGGG + Intergenic
1009236790 6:61133742-61133764 ACAGTGTAAACAAAGCTACCAGG - Intergenic
1009305888 6:62088998-62089020 ACAGTGTAAACAAAGCTGCCTGG - Intronic
1009336071 6:62492383-62492405 ACAGTGTAAACAAAGCCACCAGG + Intergenic
1009345602 6:62610151-62610173 ACAGTGTGAACAATGGCTCCAGG - Intergenic
1009455277 6:63849049-63849071 ACAGTGTAAACAAAGCCATTGGG + Intronic
1009458772 6:63888001-63888023 ACAGTGTAAACAAAGCTTCCTGG + Intronic
1009536688 6:64896813-64896835 ACAGTGTGAACAAAGCCGCCAGG + Intronic
1009652072 6:66489433-66489455 ACAGTGTAAACAAAGCTGCTGGG + Intergenic
1009718253 6:67428227-67428249 ACCGTGTAAACAAAACCCTCAGG - Intergenic
1009880525 6:69560832-69560854 ACAGTGTAAACAAAGCTGCCAGG + Intergenic
1009998144 6:70920071-70920093 ACAGCGTAAACAAAGCAGCAGGG - Intronic
1010006242 6:70998382-70998404 ACAGTGTAAACAAAGCAGCCAGG + Intergenic
1010039132 6:71361098-71361120 ACAGTATAAACAAAGCCTCCAGG - Intergenic
1010459481 6:76097909-76097931 ACAGTGTAAACAAAGCCACCAGG + Intergenic
1010522042 6:76849728-76849750 ACAGTGTAAACAAAGCCGCTGGG - Intergenic
1010574959 6:77518878-77518900 ACAGTGTAAACAAAGCCACTTGG + Intergenic
1010593369 6:77736175-77736197 TTAGGGTAAACAAAGCAGCCTGG - Intronic
1010615358 6:78005838-78005860 ACAGTGTAAACAAAGCTGCTGGG + Intergenic
1010676991 6:78756581-78756603 ACAGGGTAAACGAAGAGGCCAGG + Intergenic
1010681790 6:78807416-78807438 ACAGTGTAAACAAAGCCTCCAGG - Intergenic
1010822673 6:80433436-80433458 ACAGTATAAACAAAGCCCCTTGG - Intergenic
1010837911 6:80612575-80612597 ACAGTGTAAACAAAGTGGCAGGG + Intergenic
1010936594 6:81869957-81869979 ATAGTGTAAACAAAACCACGAGG + Intergenic
1010973120 6:82284133-82284155 ACAGTGTAAGCAAAGCCTCTGGG - Intergenic
1010994024 6:82512642-82512664 ACAGTGTAAACAAAGCCACTGGG + Intergenic
1011020679 6:82809270-82809292 ACAGTGTTAACAAAGGTACCTGG - Intergenic
1011062976 6:83292793-83292815 ACAGTGTAAGCAAAGCGGCAGGG - Intronic
1011065511 6:83321513-83321535 ACAGTGTAAATAAAGCCACTGGG + Intronic
1011086496 6:83546840-83546862 ATAGTGTAAACAAAGCTGCCGGG + Intergenic
1011120103 6:83942826-83942848 ACAGTGTAAAAAAAGCCACTGGG + Intronic
1011174111 6:84541184-84541206 ACAGTGTAAACAAAGCCACCAGG + Intergenic
1011209182 6:84936419-84936441 ACAGCATAAACAAAGCTGCCGGG + Intergenic
1011234626 6:85202466-85202488 ACAGTGTAAACAAAGCATCAAGG + Intergenic
1011235567 6:85212936-85212958 ACAGTGTAAACAAAGATGCCAGG - Intergenic
1011301431 6:85878685-85878707 ACAGTGTAAACAAATTCCCTGGG - Intergenic
1011302629 6:85892406-85892428 ACAGTGTAAACAAAGCCACTGGG - Intergenic
1011332739 6:86228143-86228165 ACAGTGTAAACAAAGCCACCTGG - Intergenic
1011387668 6:86815410-86815432 ACAGTGTAAACAAAGCCACCAGG - Intergenic
1011524937 6:88254062-88254084 ACTAGGTAAACAAAGCAGCCAGG + Intergenic
1011578208 6:88827754-88827776 CCAGTGTAAACAAAGCCTCCAGG + Intronic
1011766275 6:90623470-90623492 ACAGTATAAACAAAGCTGCCAGG + Intergenic
1011776778 6:90739536-90739558 ACTGTGTAAACAAAGCCACTAGG - Intergenic
1012043428 6:94239045-94239067 ACAGTGTAAACAAAACTGAGGGG + Intergenic
1012083056 6:94785217-94785239 ACAGTGTAAACAAAGCAACCAGG - Intergenic
1012127922 6:95454026-95454048 ACAGTGTATGCAAAGCCTCCGGG - Intergenic
1012209271 6:96499974-96499996 ACTAGGTAAACAAAGCTGCCAGG - Intergenic
1012585236 6:100913793-100913815 ACAGTGTAAACAAAGCGGCCGGG - Intergenic
1012597102 6:101053928-101053950 ACAGTGTAAACAAAGCTTCCAGG - Intergenic
1012598007 6:101062461-101062483 ACAGTGTAAACAAAGTGGCCGGG + Intergenic
1012778011 6:103522258-103522280 ACAGTGTAAACAAAGCCGCCAGG + Intergenic
1012870901 6:104671441-104671463 ACAGTGTAAACAAAGCCGCCAGG + Intergenic
1012878453 6:104757038-104757060 ACAGTATAAACAAAGAGGCAGGG + Intronic
1013038007 6:106405246-106405268 ACAGTGTAAACAAAGCTGCTGGG + Intergenic
1013390256 6:109679318-109679340 ACAGTGTAAACAAAGCCTTGGGG + Intronic
1013453007 6:110303527-110303549 ACAGTGTAAACAAAGCCTCTGGG + Intronic
1013625653 6:111934744-111934766 ACAGTGTAAATAAAGCCGCCAGG - Intergenic
1013672636 6:112421740-112421762 ACAATGTAAAGAAAGCCACCAGG + Intergenic
1013682611 6:112541696-112541718 ACAAAGTAAACAAAGCAGCTGGG + Intergenic
1013920133 6:115394364-115394386 ACAGTGTAAACAAAGCCACCAGG - Intergenic
1013956927 6:115852664-115852686 ACAATATAAACAAAGCCTCCAGG + Intergenic
1013964225 6:115935710-115935732 ACAGTCTAAACAAAGCTGCCTGG + Exonic
1013972919 6:116042110-116042132 ACAGTGTAAACAAAGCCACCAGG + Intronic
1014013313 6:116501339-116501361 ACAGTGTAAACAAAAAGGCAGGG + Intronic
1014113401 6:117645984-117646006 ACGGTGTAAACAAAGCTGCCAGG + Intergenic
1014128469 6:117804613-117804635 ACTAGGTAAACAAAGCAGCCGGG - Intergenic
1014129082 6:117810775-117810797 ACAGTGTAAACAAAGCCACCTGG - Intergenic
1014184677 6:118421495-118421517 ACAGTGTAAACAAAGAGGCAGGG + Intergenic
1014278855 6:119418305-119418327 ACAGTGTAAACAAAGCCACTGGG + Intergenic
1014352655 6:120363543-120363565 ACAGTGTAAACAAAGCTGCCAGG - Intergenic
1014357703 6:120433052-120433074 AGTAGGTAAACAAAGCCGCCAGG + Intergenic
1014387055 6:120815972-120815994 ACAGTATAAACAAAGCTAACAGG - Intergenic
1014413405 6:121153771-121153793 ACAATGTAAAACAAGCCACCTGG - Intronic
1014569055 6:122986553-122986575 AGAGCATAAACAAAGCCCCCAGG + Intergenic
1014836541 6:126166891-126166913 ACACTGTAAACAAAGCCTCCAGG - Intergenic
1014872613 6:126614823-126614845 ACAGTGTAAACAAAGCCTCCAGG - Intergenic
1014922443 6:127228850-127228872 ACAGTGTGAACAAAGCCGCCGGG + Intergenic
1014968144 6:127782076-127782098 ACAATGTAAACAAAGCCACCGGG - Intronic
1015108925 6:129569342-129569364 ACAGTGTATACAAAGCTGCTGGG + Intergenic
1015133048 6:129835886-129835908 ACAGTGTAAACAAAGAGGCCTGG + Intronic
1015211330 6:130701982-130702004 ACAGTGTAAACAAAGCCACCAGG + Intergenic
1015291094 6:131538925-131538947 ACAGTGTAAACAAAGCTACCAGG + Intergenic
1015386987 6:132635488-132635510 ACAGTGTAAACAATGCCTCCTGG + Intergenic
1015433203 6:133154842-133154864 ACAGTGTAAACAAAGCTGCCTGG - Intergenic
1015471886 6:133614974-133614996 ACAGTGTAAACCAAGCCACCAGG + Intergenic
1015500778 6:133931049-133931071 ACAGTGTAAACAAAACTGCTGGG + Intergenic
1015623382 6:135156113-135156135 ACAGTGTAAACAAAGCCACTGGG - Intergenic
1015802090 6:137070496-137070518 ACAGTGTAAACAAAGCTGCCAGG + Intergenic
1015883268 6:137891169-137891191 ACAGTGTAAACAAAGCCGCCAGG - Intergenic
1016111490 6:140230501-140230523 ACAGTGTAAACAAAGCCACTGGG + Intergenic
1016241880 6:141940459-141940481 ACAGTGTAAACAAAACTGCCAGG + Intergenic
1016265924 6:142232621-142232643 ACAGTGTAAACAAAGACGCCAGG + Intergenic
1016334900 6:142994226-142994248 ACAGTGTAAAAAAAGAGGCTGGG + Intergenic
1016338542 6:143035150-143035172 ATAGAGTAAACAAAGCTGTCGGG - Intergenic
1016483477 6:144508015-144508037 ACAGTGTAAACAAAGCCTCCAGG - Intronic
1016523861 6:144977392-144977414 ACAGTATAAACAAAGAGACCGGG - Intergenic
1016561987 6:145406627-145406649 ACAGTGTAAACAAAGACACTTGG + Intergenic
1016638690 6:146324171-146324193 CCAGTGTAAACAAAGCTGCTGGG - Intronic
1016691523 6:146943381-146943403 ACAGTGTAAAAAAAGCCACCAGG - Intergenic
1016856004 6:148671338-148671360 ACAATGTAAACAAAGCTGCTGGG - Intergenic
1016985877 6:149895467-149895489 ACAGTGTAAACAAAACTGCTGGG - Intronic
1017197395 6:151716609-151716631 ACAGTGTAAACAAAGCCACCAGG - Intronic
1017231596 6:152078956-152078978 ACAGCGTAAACAAAGCAGCAGGG + Intronic
1017322641 6:153111303-153111325 ACAGTCTAAACAAAGCCGCCAGG + Intronic
1017411528 6:154172633-154172655 ACAGTGTAAACAAAGCAGCAGGG + Intronic
1017571427 6:155748956-155748978 ACAGTGTAAACAAAGCTACTGGG + Intergenic
1017836501 6:158183552-158183574 ACAGTGTAAACAAAGCAGCAGGG - Intronic
1017968689 6:159290312-159290334 ACAGTGTAAACAAAGTCGCCAGG - Intergenic
1018094505 6:160373785-160373807 ACCGTGTAAACAAAGCCTCTGGG - Intronic
1018108734 6:160514051-160514073 ACAGTGTAAACAATGCCCCTGGG + Intergenic
1018114618 6:160571652-160571674 ACAGTGTAAGCAAAACCGCTAGG - Intronic
1018507817 6:164490738-164490760 ACAGTGTAAATGAAGCCGCCGGG - Intergenic
1020333426 7:7042498-7042520 ACATTGTAAACAAAGCCGTCAGG + Intergenic
1020338967 7:7089051-7089073 ACAGTGTAAACAAAACTGCTGGG - Intergenic
1020391395 7:7662087-7662109 ACAGTGTAAACAAAGATGCCGGG - Intronic
1020428654 7:8096596-8096618 ACAGTGTAAACAAAGCTGCTGGG + Intergenic
1020487653 7:8738903-8738925 ACAGTGTAAACAAAGCTGCTGGG - Intronic
1020519573 7:9169150-9169172 ACAGTGTAAACGAAGCCACCAGG - Intergenic
1020608587 7:10367514-10367536 ACAGTGTTAAGGAAGCCGCCAGG - Intergenic
1020629754 7:10625730-10625752 ACGGTGTAAAGAAAGCTGCCAGG + Intergenic
1020635985 7:10696250-10696272 ACAGCGTAAACAAAGCCACTGGG + Intergenic
1020639910 7:10742283-10742305 ACAGTGTAAAAAAAGCCTCCAGG + Intergenic
1020659492 7:10965742-10965764 ACAGTGTAAACAAAGAGGCAGGG - Intergenic
1020693808 7:11391376-11391398 ACAGTGTAAATAAAGTCACCAGG - Intronic
1020694053 7:11392745-11392767 ACAGTGTAAACAAAGCTGCTGGG + Intronic
1020716068 7:11675627-11675649 ACAGTGTAAAAAAAGCAGCCAGG + Intronic
1020753404 7:12170635-12170657 ACAGTGTAAACAAAGCTTCCAGG - Intergenic
1020810005 7:12839976-12839998 ACAGTGTAAACAAAACAGCAGGG + Intergenic
1020823833 7:13002741-13002763 ACCTTGTAAACAAAGCCACCAGG - Intergenic
1020834024 7:13126507-13126529 ACAGTGTAAACAAAGCAGCTGGG - Intergenic
1020845294 7:13274349-13274371 ATTGGGTAAACAAAGCAGCCAGG - Intergenic
1020874255 7:13673797-13673819 ACAGTGTAAACAAAGCTGCCAGG - Intergenic
1020935509 7:14459065-14459087 ACAGTGTAAACAAAGCCACTGGG + Intronic
1021071667 7:16249085-16249107 ACAGTGTAAACAAAGGCACTGGG + Intronic
1021099539 7:16572058-16572080 ACAGTGTTAACAAAGCCGCCAGG + Intronic
1021207883 7:17807338-17807360 ATAGTGTAAACAAAGCCTCAAGG + Intronic
1021224540 7:18012612-18012634 ACAGTGTAAACAAAGCCACTGGG - Intergenic
1021322329 7:19227264-19227286 ACAGTGTAATCAAAGCTACTGGG + Intergenic
1021347658 7:19548015-19548037 ACATTGTAAACAAAGCCACTGGG - Intergenic
1021483964 7:21146905-21146927 CCAGTGTAAACAAAGCCTCTGGG + Intergenic
1021502309 7:21345083-21345105 ACAGTGTAAATAAAGCAGCTGGG - Intergenic
1021749334 7:23779614-23779636 ACAGTGTAAACAAAGCCACCAGG - Intronic
1021782295 7:24118087-24118109 ACAGTGCAAACAAAGCCACCAGG - Intergenic
1022055047 7:26722045-26722067 ACAATGTAAACAAACCTGACTGG + Intronic
1022848447 7:34235413-34235435 ACAGTGTAAACAAAGCCACTGGG - Intergenic
1023034728 7:36120407-36120429 ACAGTGTAAACAAAGTGGCAGGG + Intergenic
1023051739 7:36258604-36258626 ACAATGTAAACAAAGCCGCCTGG - Intronic
1023146249 7:37153628-37153650 ACAGTGTAAACAAAGCAGCAGGG + Intronic
1023311001 7:38886493-38886515 ACAGTGTAAACAAAGTGGCAGGG + Intronic
1023452876 7:40306141-40306163 GCAGTGTCAACAAAGCAGCAAGG - Intronic
1023511610 7:40959445-40959467 ACAGTGTAAACAAAGCTGGCTGG - Intergenic
1023697754 7:42865208-42865230 ACAGTGTAAACAAAGCCACCAGG - Intergenic
1024106140 7:46088606-46088628 ACAGTGTAAACAAAGAGGCTGGG - Intergenic
1024152991 7:46591395-46591417 ACAGTGTAAACAAAGCCTCTGGG + Intergenic
1024320493 7:48062348-48062370 ACAGTGTAAAAAAAGCAGGTTGG + Intergenic
1024372903 7:48606982-48607004 AAAGTGTAAACAAAGCCCTCAGG - Intronic
1024495459 7:50041020-50041042 ACAGTGTAAATAAAGCTGCCTGG + Intronic
1024512353 7:50213764-50213786 ACAGTGTAGACAAAGAGGACAGG - Intergenic
1024664890 7:51536541-51536563 ACAGTGTAAACAAAGCTGCTGGG - Intergenic
1024950500 7:54855804-54855826 ATAGTGTAAACAAAGCCACAGGG - Intergenic
1024998510 7:55294691-55294713 ATAGTGTAAACAAAGCCACCGGG - Intergenic
1025621377 7:63174775-63174797 ACAGTGTAAACAAAGCTACCAGG - Intergenic
1026442312 7:70455268-70455290 ACAGTGGAAATAAAGCTGCATGG - Intronic
1027510347 7:79071739-79071761 ACAGTGTAAACAAAGCCACCAGG - Intronic
1027574518 7:79915522-79915544 AGAAGGTAAACAAAGCAGCCAGG + Intergenic
1027582899 7:80020485-80020507 ACAGTGTAAACAAAGCCTCTGGG + Intergenic
1027637095 7:80689405-80689427 ACAGTATAAACAAAGATGCCTGG + Intergenic
1027638752 7:80707990-80708012 ACAGTCTAAACAAAGTCCCAAGG + Intergenic
1027701803 7:81478929-81478951 ACAGTGTAAACAAAGTGGCAGGG + Intergenic
1027778207 7:82492501-82492523 TCAGTGTAAACAAAGCCACCAGG - Intergenic
1027790407 7:82633750-82633772 TCAGTGTAAACAAAGCCACCTGG + Intergenic
1027843368 7:83341987-83342009 ACAGTGTAAACAAAGCTTCCAGG + Intergenic
1027864559 7:83629569-83629591 ACAGTATAAACACAGCCACCGGG - Intronic
1027910711 7:84246134-84246156 TGAGTGTAAACAAAGCCACCAGG - Intronic
1028080328 7:86567549-86567571 ACAGTGTAAACAATGTGGCAGGG + Intergenic
1028142356 7:87288186-87288208 ACAGTGTAAACAAAGCCACTGGG - Intergenic
1028144310 7:87304719-87304741 ACAGTGTAAAAAAAGCTGCCAGG + Intergenic
1028145867 7:87319293-87319315 ACAGTGTAAACAAAGCCGCCAGG - Intergenic
1028236928 7:88373564-88373586 ACAGTGTAAACAAAGAGGCCAGG - Intergenic
1028327036 7:89540322-89540344 ACAGTGTAAACAAAGCCACCTGG + Intergenic
1028340953 7:89719171-89719193 ACAGTGTAAACAAAGCCACAGGG + Intergenic
1028369059 7:90070411-90070433 ACTAGGTAAACAAAGCAGCCAGG + Intergenic
1028396016 7:90369466-90369488 ACAGTGTAAACAAAGAGGCCTGG - Intronic
1028413003 7:90551192-90551214 ACAGTGTAAACAAAGTCGCCAGG - Intronic
1028429945 7:90735603-90735625 ACAGTGTAAACAAAGCCATCGGG - Intronic
1028476323 7:91257652-91257674 ACAGTGTAAACAAAGCTGCCTGG - Intergenic
1028523648 7:91759447-91759469 ACAGTGTAAACAAAGCAACCAGG + Intronic
1028648274 7:93121693-93121715 ACAGTGTAAACAAAGCCACCAGG + Intergenic
1028652831 7:93170188-93170210 ACAGGGTACACAAAGCTGCTGGG - Intergenic
1028785985 7:94794838-94794860 ACAGTGTAAACAAGGTGGCAGGG + Intergenic
1028806025 7:95026861-95026883 ACAGTGTAAACAAAGCAGAGGGG - Intronic
1028836157 7:95377241-95377263 ACAGTGTAAACAAAGAGGCCGGG + Intronic
1028862448 7:95668325-95668347 CCAGAGTAAATAAAGCAGCCTGG + Intergenic
1028991270 7:97051272-97051294 ACAGTGGAAACAAAGCCGCAGGG + Intergenic
1029313881 7:99693571-99693593 ACTGTGTAAACAAAGAGGCCTGG - Intronic
1029324739 7:99796491-99796513 GCGGTGTAAACAAAGCTGCTGGG - Intergenic
1029810075 7:103038286-103038308 ACAGTGTAAACAAAGAGGCCAGG + Intronic
1029816994 7:103106613-103106635 ACAGTGTAAACAAAGCCACTGGG + Intronic
1029845240 7:103405956-103405978 ACAGTGTAAACAAAGCCACCTGG - Intronic
1029850555 7:103457270-103457292 ACAGTGTAAACGAAGTTGCCAGG - Intergenic
1029851093 7:103462523-103462545 ACAGTGTAAACAAAGCCAACGGG - Intergenic
1029902755 7:104059270-104059292 ACAGTGTAAACAAAGCAGTCTGG + Intergenic
1030141024 7:106304264-106304286 ACAGTGTAAACAAAGCCACCAGG - Intergenic
1030159552 7:106493235-106493257 ACAGTGTAAACAAAGCCACCAGG + Intergenic
1030166392 7:106560100-106560122 ACAGTGTAAACAAAGAGGCCAGG - Intergenic
1030202487 7:106919261-106919283 ACAGTGTAAACAAAGAAGCCAGG + Intergenic
1030325833 7:108217697-108217719 ACAGTGTAAACAAACCCACCAGG - Intronic
1030331716 7:108278408-108278430 ACCGTGTAAACAAAGTGGCAGGG - Intronic
1030403590 7:109083589-109083611 TGAGTGTAAACAAAGCTGTCAGG + Intergenic
1030451602 7:109719587-109719609 AGAAGGTAAACAAAGCAGCCAGG + Intergenic
1030500805 7:110356560-110356582 ACAGTGTAAACAAAGCCACCGGG - Intergenic
1030534043 7:110744121-110744143 ACAGTGTAAACAAAGCCACCAGG + Intronic
1030547381 7:110913731-110913753 ACAGTGTAAAAGAAGCTGCATGG - Intronic
1030703064 7:112662339-112662361 ACAGTGTAAACAAAGACGCCAGG - Intergenic
1030705621 7:112689943-112689965 ACAGTGTAAACAAAGCCGCAGGG - Intergenic
1030801353 7:113856632-113856654 ACAGTGTAAACAAAGCCTCCAGG + Intergenic
1030958865 7:115889511-115889533 ACAGTGTAAACAAAGCCTCCGGG + Intergenic
1031397725 7:121293283-121293305 ACAGTGTAAACAAAACCGCTGGG - Intronic
1031591252 7:123594955-123594977 ACAGTGTAAACAAAGCGGCAGGG - Intronic
1031613755 7:123856963-123856985 AAAGTGTAAACAAAGCCACTGGG - Intronic
1031711016 7:125046664-125046686 ACAGTGTAAACAAAGCTGCCAGG + Intergenic
1031902706 7:127428539-127428561 ACAGTGTAAACAGAGCCTCCTGG - Intronic
1032120071 7:129149202-129149224 ACAGGGCAAACAAAGCTGCTGGG - Intronic
1032659737 7:133970122-133970144 ACAGTGTAAACAAAGCCACTGGG - Intronic
1032883452 7:136114607-136114629 ACAGTGTAAATAAAGCTACAAGG - Intergenic
1032893333 7:136222843-136222865 ACAGTGTAAACAAAGCCACTGGG + Intergenic
1032957100 7:136984217-136984239 ACAGTGCAAACAAAGCCTCTGGG - Intronic
1033468128 7:141616037-141616059 ACAGTGTAGACAAAGTAGACTGG + Intronic
1033525626 7:142210551-142210573 ACAGTGTAAACAAAGCCACCAGG + Intronic
1033623845 7:143088750-143088772 ATAAGGTAAACAAAGCTGCCAGG + Intergenic
1034314501 7:150117445-150117467 ACAGTGTAAACAAAGCCACAGGG + Intergenic
1034715098 7:153234769-153234791 ACAGTGTAAACAAAGCCGCAGGG - Intergenic
1034792395 7:153983324-153983346 ACAGTGTAAACAAAGCCACAGGG - Intronic
1035710766 8:1712242-1712264 ACCGTGTAAACAAAGCCTCTGGG + Intergenic
1035998302 8:4573900-4573922 ACAGTGTAAACATAGCTGCCAGG - Intronic
1036551212 8:9816325-9816347 ACAGTGTGAACAAAGCTGCTGGG + Intergenic
1036558020 8:9876951-9876973 ACAGTGTAAACAAAGCTGCCAGG + Intergenic
1036804482 8:11820518-11820540 ACAGTGTAAACAAAGCAGCAAGG - Intronic
1037033318 8:14136625-14136647 ACTAGGTAAACAAAGCTGCCAGG + Intronic
1037258271 8:16979595-16979617 ACAGTGTAAACAAAGCCTCTGGG - Intergenic
1037285459 8:17294230-17294252 ACAGTGTAAACAAAGCCTCCGGG - Intronic
1037664545 8:20956652-20956674 CCAGTGTAAACAAAGCCACCTGG + Intergenic
1037719665 8:21431716-21431738 ACAGTGTAAACAAAGCTCCCGGG + Intergenic
1037748723 8:21666253-21666275 ACAGTGTGATCAATGCCGCAAGG - Intergenic
1039133862 8:34297933-34297955 ACAGTGTAAACAAAGCTACAGGG + Intergenic
1039145208 8:34438971-34438993 ACAGTGTAAACAAAGCTGCTGGG + Intergenic
1039146337 8:34451400-34451422 AGTGGGTAAACAAAGCAGCCGGG - Intergenic
1039154100 8:34535868-34535890 ACAGTGTAAACAAAGTGGCAGGG + Intergenic
1039284574 8:36026732-36026754 ACAGTGTAAACAAAGTCGCTGGG + Intergenic
1039347711 8:36726210-36726232 ACAGTGTAAACAAAGCAGCCAGG + Intergenic
1039634042 8:39143881-39143903 ACAGTGTAAACAAAGTGGCCAGG - Intronic
1039754823 8:40512216-40512238 ACAGTGTAAACAAAGCCACTAGG - Intergenic
1039801794 8:40964380-40964402 TCAGTGTAAACAAAGCCGCCAGG + Intergenic
1040473848 8:47759903-47759925 ACAGTGTAAACAAAGACACTGGG - Intergenic
1040736569 8:50515665-50515687 ACAGTGTAAACAAAGTTGCTGGG + Intronic
1040779917 8:51095333-51095355 ACAGTGTAAACAAAGCTGCTGGG + Intergenic
1040968793 8:53112261-53112283 ACAGTGTAAACAAAGCCGCCAGG - Intergenic
1041050829 8:53932491-53932513 ACAGTGTAAACAAAGCCACCAGG + Intronic
1041286330 8:56265969-56265991 AGAAGGTAAACAAAGCAGCCAGG - Intergenic
1041323293 8:56637094-56637116 ACAGTGTAAACAAAGCTGCTGGG - Intergenic
1041349888 8:56937749-56937771 ACAGTGTAAACAAAAAGGCTGGG + Intergenic
1041383160 8:57273230-57273252 ACAGTGTAAACAAAGCCACTGGG - Intergenic
1041423572 8:57695535-57695557 ACAGTGTAAACAAAGCTGCTGGG + Intergenic
1041459730 8:58098321-58098343 ACAGCATAAACAAAGCTGCCAGG - Intronic
1041574760 8:59381263-59381285 ACAGTGTAAACAAATCATCCAGG + Intergenic
1041630557 8:60082712-60082734 ACAGTGTAAACAAAGCCTCCAGG - Intergenic
1041666329 8:60448430-60448452 ACAGTGTAAACAAAGCCTCAGGG + Intergenic
1041836651 8:62223785-62223807 ACAGTGTAAACAAAGCCCCCAGG + Intergenic
1041838321 8:62242013-62242035 ACAGTGTAAACAAAGCCCCCCGG - Intergenic
1041900618 8:62978493-62978515 ACAGTGTAAACAAAGCTGCCAGG - Exonic
1041951684 8:63510419-63510441 ACAGTGTAAACAAAGTGGCCAGG - Intergenic
1042110943 8:65380307-65380329 ACAGCATAAACAAAGCCACCAGG + Intergenic
1042195589 8:66228898-66228920 ACAGTGTAAACAAAGCCTCTGGG + Intergenic
1042327149 8:67540781-67540803 ACAGTGTAAACAAAGCTGCCAGG - Intronic
1042349363 8:67761482-67761504 ACAGTGTAAACAAAGCCTCCAGG + Intergenic
1042597504 8:70465683-70465705 ACAGTGTAAACAAAGCAGCAGGG - Intergenic
1042627146 8:70770691-70770713 ACAGTGTAAACAAAGCCACTGGG - Intronic
1042812896 8:72845716-72845738 ACGGTGTAATCAAAGCTGCCTGG - Intronic
1042946194 8:74156867-74156889 ACAGTGTAAACAAAGCTGCATGG + Intergenic
1042969295 8:74390960-74390982 ATAGTGTAAACAAAGCCACCAGG - Intronic
1043036659 8:75208102-75208124 ACAGTGTTAAGGAAGCCACCAGG - Intergenic
1043129385 8:76442085-76442107 ACAGTGTAAACAAAGCGGCAGGG - Intergenic
1043366306 8:79537217-79537239 ACAGTGTAAACAAAGCCACAGGG - Intergenic
1043368255 8:79560430-79560452 ATAGTGTAAACAAAGCCCTTGGG - Intergenic
1043647233 8:82536144-82536166 ACAGTGTAAACAAAGCTGCCAGG - Intergenic
1043703628 8:83322148-83322170 ACAATGTAAACAAAGCCACTAGG + Intergenic
1044131112 8:88525550-88525572 ACAGTGTAAGCAAAGCCTACAGG + Intergenic
1044267735 8:90203528-90203550 ACAGTGTAAACAAAGCCACCGGG + Intergenic
1044503578 8:92991115-92991137 CCAGTGTAAACAAAGCCACTGGG + Intronic
1044509457 8:93058241-93058263 ACAGTGTAAACAAAGCTGCCAGG - Intergenic
1044595241 8:93953047-93953069 ACTATGTAAACAAAGCTGCTGGG - Intergenic
1044597007 8:93969500-93969522 AGTATGTAAACAAAGCAGCCAGG - Intergenic
1044940238 8:97334917-97334939 ACAGTGTAAACAAAGCCACTGGG - Intergenic
1044961031 8:97530539-97530561 ACAGTGTAAATAAAGCCTCCAGG + Intergenic
1045151768 8:99416193-99416215 ACAGTGTAAACAAAGCCATCGGG - Intronic
1045212133 8:100109035-100109057 CCAGTGTAAACAAAGCTACTGGG + Intronic
1045390597 8:101710628-101710650 ACAGTGTAAACAAAGCCACTGGG + Intronic
1045538947 8:103062635-103062657 ACACTGGAAACAAAGCAGCTTGG + Intronic
1045618911 8:103951965-103951987 ACAGTGTAAACAAAGCGGCCAGG + Intronic
1045797717 8:106065448-106065470 ACAGTGTAAACAAAGCTACCAGG + Intergenic
1045883175 8:107064959-107064981 ACAGTGTAAACAAAGCCATTGGG - Intergenic
1045928350 8:107596948-107596970 ACAGTGTAAACAAAGAGGCAGGG - Intergenic
1045933496 8:107653898-107653920 ACAGTGTAAACAAAGAGGCAGGG - Intergenic
1045975080 8:108122803-108122825 ATAGTGTAAACAAAGCTGCCTGG - Intergenic
1046047960 8:108986340-108986362 TCAGTGTAAACAAAGCCGCCAGG - Intergenic
1046067966 8:109218787-109218809 ATAGTGTAAACAAAGCCGCCAGG - Intergenic
1046106512 8:109672894-109672916 ACAGTGTAAACAAAGCCACTGGG + Intronic
1046153463 8:110257658-110257680 TCAGTGTAAACAAAACTGCCAGG - Intergenic
1046219943 8:111201023-111201045 ACAGTGTAAACAAAGCCACCTGG + Intergenic
1046277827 8:111985940-111985962 ACAGTATAAGCAAAGCCTCCGGG + Intergenic
1046295878 8:112218488-112218510 ACAGTGTAAACAAAGCTGCCAGG + Intergenic
1046886830 8:119376732-119376754 ACAGTGTAAACAAAGCTGCTGGG + Intergenic
1046972527 8:120238385-120238407 ACAGTGTAAACAAAGCTGCCTGG - Intronic
1047133692 8:122051726-122051748 ACAGTGTAAATAAAACTGCTGGG + Intergenic
1047171958 8:122502434-122502456 ACAGTGTAAGCAAAGCCACATGG + Intergenic
1047369566 8:124245328-124245350 ACAGTGTAAACAAAGCCACTGGG - Intergenic
1048467068 8:134674461-134674483 ACAGTGTAACAAAAGCTGCCAGG + Intronic
1048914102 8:139165451-139165473 ACAGTGTAAACAAAGCAGGCAGG - Intergenic
1049130872 8:140839304-140839326 GCAGTGTAAACAAAGCCCCCTGG + Intronic
1050141539 9:2521282-2521304 ACGGTGTAAATAAAGCTACCAGG - Intergenic
1050201329 9:3148786-3148808 ACGGTCTAAACAAAGCCACTGGG - Intergenic
1050239886 9:3624113-3624135 ATAGTGTAAACAAAACCACCTGG - Intergenic
1050300492 9:4253385-4253407 ATAGTGTAAACAAAGCCACGGGG - Intronic
1050369017 9:4901862-4901884 ACAGTGTAAACAAAGCTGCCAGG - Intergenic
1050391963 9:5153403-5153425 ACGGTGTAAACAAAGCCACTGGG + Intronic
1050404504 9:5293442-5293464 ACAGTGTAAACAAAGCCACTGGG + Intergenic
1050407700 9:5327377-5327399 ACAGTGTAAACAAAGAGGCTAGG + Intergenic
1050450858 9:5779857-5779879 ACAGTGTAAACAAAGCCACTGGG + Intronic
1050597323 9:7216728-7216750 ACAGTGTAAACAAAGAGGCAGGG + Intergenic
1050637422 9:7626867-7626889 ACAGTGTAAAAAAAGCTGCCAGG + Intergenic
1050640809 9:7665523-7665545 GCAGTGTAAACAATGCTGGCAGG + Intergenic
1050700173 9:8329787-8329809 ACAGTGTAAACAAAGCCAGCAGG - Intronic
1050750601 9:8932649-8932671 ACAGTGTAAACAAAGCCGCTGGG - Intronic
1050852073 9:10300627-10300649 ACAGTGTAAACAAAGCCACCAGG + Intronic
1050943140 9:11485529-11485551 ACAGTGTGAAGAAAGCCACCAGG - Intergenic
1051230478 9:14950093-14950115 ACAGTGTAAACAAAGCCGTCAGG + Intergenic
1051308823 9:15747120-15747142 ACAGTGTAAACCAAGTTGCCGGG + Intronic
1051321931 9:15914424-15914446 ACAGTTTAAACAAAGCCTCCAGG - Intronic
1051353935 9:16223745-16223767 ACTGTGTAAACAAAGCCACTGGG + Intronic
1051447445 9:17155539-17155561 ACAGTGTAAACAAAGCTGCTGGG - Intronic
1051548743 9:18305569-18305591 ACAGTGTAAACAAAGCCGCAGGG + Intergenic
1051670457 9:19504850-19504872 ACAGTGTAAACAAAGCCACAGGG - Intergenic
1051674565 9:19546464-19546486 ACAGTGTAAACAAAGCCACCGGG - Intronic
1051695799 9:19767071-19767093 ACAGTGGAAACAAAGTCACTGGG - Intronic
1051814335 9:21087585-21087607 ACGGTGTAAAAAAAGCTGCCTGG + Intergenic
1051940209 9:22496227-22496249 ACAGTGTAAACAAAGCTGCCAGG - Intergenic
1051998483 9:23248098-23248120 ACAGTGTAAACAAAGACCCTGGG + Intergenic
1052052703 9:23866381-23866403 ACAGCGTAAACAAAGTCACTGGG - Intergenic
1052096571 9:24391257-24391279 AGGGTGTAAACAAAGCCACTAGG - Intergenic
1052125120 9:24765176-24765198 ACAGTGTAAACAAAGCCACCAGG - Intergenic
1052134098 9:24889141-24889163 ACAGTGTAAACAAAGCCACCTGG + Intergenic
1052146883 9:25061088-25061110 ACAGCGTATGCAAAGCCACCTGG - Intergenic
1052241389 9:26277766-26277788 ACAGTGTAAACAAAGCCACCAGG + Intergenic
1052366180 9:27614711-27614733 ACGGTGTAAACAAAGCTGCCTGG - Intergenic
1052382325 9:27784983-27785005 ACAGTATAAACAAAGCCTCTAGG - Intergenic
1052667995 9:31519156-31519178 ACTGTGTAAACAAAGCCCTGGGG - Intergenic
1052752758 9:32508963-32508985 ACAGTGTAAACAAAGCCACCAGG + Intronic
1052964610 9:34330105-34330127 ACAGCGTAAACAATGCAGGCCGG + Intronic
1053532852 9:38899052-38899074 ACAGTGTGAACAAATCTCCCAGG - Intergenic
1053608150 9:39681166-39681188 ACAGTGTAAACAAAGCTGCCAGG - Intergenic
1053865991 9:42437526-42437548 ACAGTGTAAACAAAGCTGCCAGG - Intergenic
1054245381 9:62661243-62661265 ACAGTGTAAACAAAGCTGCCAGG + Intergenic
1054559510 9:66695774-66695796 ACAGTGTAAACAAAGCTGCCAGG + Intergenic
1054719866 9:68593924-68593946 ACAGTGTAAACAAAGCTGCCAGG - Intergenic
1054985977 9:71262293-71262315 ACAGTGTAAACAAAGCCCCTGGG - Intronic
1054997366 9:71407552-71407574 ACTAGGTAAACAAAGCAGCCAGG + Intronic
1055061440 9:72072861-72072883 ACAGTGTAAACAAAGCTGCCAGG + Intergenic
1055125699 9:72716540-72716562 ACAGTGTACACAAAGTTGCCAGG - Intronic
1055210330 9:73783411-73783433 ACAGTGTAAACAAAGCCACCTGG + Intergenic
1055239239 9:74163858-74163880 ACTGTGTAAACAAAGCCACTGGG + Intergenic
1055312058 9:74992916-74992938 ACAGGGTAAATTAAGCCTCCAGG + Intronic
1055386825 9:75771719-75771741 ATAGTGTAAACAAAGCCACTCGG - Intergenic
1055390931 9:75821521-75821543 ACAGTGTAAACAAAGCCACCGGG - Intergenic
1055494587 9:76841660-76841682 ATAGTGTAAACAAAGCTGCAGGG + Intronic
1055537865 9:77267944-77267966 ACAGTGTAAACAAAGTTGCCTGG - Intronic
1055571793 9:77624132-77624154 ACAGTGTAAACAAAGCAGCAGGG + Intronic
1055628769 9:78201311-78201333 ACAGTGTAAACAAAGCCTACAGG + Intergenic
1055894822 9:81162775-81162797 ACAGTGTAAACAATGCCTCTGGG + Intergenic
1056000993 9:82216255-82216277 ACAGTGAAAACAAAGCTGCCAGG + Intergenic
1056003513 9:82242778-82242800 ACAGTGTAAAGAAAGCCACAAGG - Intergenic
1056123751 9:83514325-83514347 ACAGTGTAAACAAAGCTGCTAGG + Intronic
1056176770 9:84043842-84043864 ACAGTATAAACAAAGCCACCAGG - Intergenic
1056302618 9:85257926-85257948 ACAGTGTGAACAAAGCTGCCAGG - Intergenic
1056320931 9:85433779-85433801 ACAGTGTAAACAAAGCCACCAGG + Intergenic
1056348448 9:85723344-85723366 ACAGTGTAAACAAAGAGGCCAGG - Intronic
1057175918 9:92999134-92999156 AGTAGGTAAACAAAGCCGCCGGG - Intronic
1057460337 9:95254940-95254962 ACAGCGTAAACAAAGCCGCAGGG + Intronic
1058012014 9:99989010-99989032 ACTAGGTAAACAAAGCGGCCAGG + Intronic
1058029288 9:100177488-100177510 ACAGTGTAAACAAAGCCACCAGG + Intronic
1058072858 9:100619390-100619412 ACGGTGTAAAGAAAGCCACTAGG - Intergenic
1058074602 9:100637943-100637965 ACAGTGTAAACAAAGCAGCAGGG - Intergenic
1058081941 9:100710102-100710124 ACAGTGTAAACAAAGCAGCTGGG - Intergenic
1058093266 9:100829537-100829559 ACAGTGTAAACAAAGCCGCCAGG - Intergenic
1058393203 9:104520536-104520558 ATAGTGTAAAGAAAGCTGCTGGG + Intergenic
1058492365 9:105516058-105516080 ATAGTGTAAACAAAGCTGCTGGG + Intronic
1059088866 9:111334656-111334678 ACAGTGTAAACAAAGCCGCCAGG + Intergenic
1059513367 9:114870072-114870094 ACAGTGTAAACAAAGCCTCCAGG + Intergenic
1059816178 9:117918351-117918373 ACACTGTAAACCAAGACCCCAGG + Intergenic
1059864651 9:118501186-118501208 AGTGGGTAAACAAAGCAGCCAGG - Intergenic
1060129897 9:121086231-121086253 ACAGTGTAAACAAAACAGACAGG + Intronic
1062297621 9:135841212-135841234 ACAGTGTAAACAAAGCCGCCAGG + Intronic
1185911163 X:3982384-3982406 ACAGTATAAACAAAGCTGCCAGG + Intergenic
1186181303 X:6975977-6975999 ACAGCGTAAACAAAGCTGCTGGG - Intergenic
1186354218 X:8773317-8773339 ACAGGGTAAACAAAGCTGCCAGG + Intergenic
1186370001 X:8937169-8937191 ACAGTGTAAACAAAGCCACTGGG - Intergenic
1186599789 X:11024571-11024593 ACAGTGTAAACAAAGCCACCAGG - Intergenic
1186773299 X:12839135-12839157 ACAGTGTAAACAAAGCTGCCAGG - Intergenic
1186937203 X:14463520-14463542 ACAGTGTAAACAAAGCTGCAGGG - Intergenic
1186960934 X:14736012-14736034 ACAGTGTAAACAAAGTCACAGGG - Intergenic
1187248346 X:17574350-17574372 ACAGTGTAAACAAAGTGGCAGGG - Intronic
1187660868 X:21545249-21545271 ACAGTGTAAACAAAGCCTCTGGG + Intronic
1187729049 X:22234543-22234565 ACAGTGTAAACAAAGCCACCAGG - Intronic
1187729549 X:22238630-22238652 ACAGTGTAAACAAAGCCACTGGG + Intronic
1187784333 X:22867043-22867065 ACAGTGTAAACAAAGCCACAGGG + Intergenic
1187839929 X:23476669-23476691 AGATTGTAAACAAAGCCGCCTGG - Intergenic
1188084146 X:25882735-25882757 ACAGTGTAAACAAGGCATCCTGG + Intergenic
1188130004 X:26419542-26419564 ACAGTGTAAACAAAGCCGCTGGG - Intergenic
1188201702 X:27299884-27299906 ACACTGTAAACAAAGTCACCAGG + Intergenic
1188664652 X:32804336-32804358 ACAGTGTAAACAAAGTCGCTGGG + Intronic
1188893278 X:35636140-35636162 AAAGTGTGAACAAAGCCACCGGG - Intergenic
1189189652 X:39089168-39089190 ACAGTGTAAACAAAGCCGCAGGG + Intergenic
1189210798 X:39280482-39280504 ACAGTGTAAACAAAGCCACTGGG - Intergenic
1189243365 X:39542526-39542548 ACAGTGTAAACAAAGCTACTGGG + Intergenic
1189273432 X:39767807-39767829 CCAGTGTGAACCAAGCCCCCTGG - Intergenic
1189575091 X:42343148-42343170 ACAGTGTAAACAAAACCACCTGG - Intergenic
1189583286 X:42430407-42430429 ATTAGGTAAACAAAGCCGCCGGG - Intergenic
1189590658 X:42507393-42507415 ACAGTGTAAACAAAGCCACCAGG + Intergenic
1189619072 X:42816444-42816466 ACAGTGTAAACAAAGCTGCCAGG - Intergenic
1189702605 X:43727439-43727461 ACAGTGTAAACAAAGCCACCAGG - Intronic
1189754152 X:44253485-44253507 ACAGTGTAAACAAAGCTGCCAGG + Intronic
1189937781 X:46087483-46087505 ACAGTGTAAACAAAGCTGCAGGG + Intergenic
1189978442 X:46486040-46486062 ACAATGTAAACAAAGAGGCCAGG - Intronic
1190341449 X:49299788-49299810 ACATTATGAACAAAGCCTCCGGG - Intronic
1190495069 X:51020840-51020862 ATGGTGTAAACAAAGCCACCAGG - Intergenic
1190567559 X:51746157-51746179 ACAGAGAAAACAAAGCCCACTGG - Exonic
1190959754 X:55234597-55234619 ACAGTGTAAACAAAGCCACCAGG - Intronic
1191005093 X:55702786-55702808 ACAGTGTAAACAAAGCTGCTGGG + Intergenic
1191080876 X:56508321-56508343 ATGATGTAAACAAAGCCTCCTGG + Intergenic
1191088702 X:56597443-56597465 ACAGTATAAACAAAGCTGCCGGG - Intergenic
1191096096 X:56674137-56674159 ACAGTGTACACAAAGTGGCAGGG + Intergenic
1191098957 X:56704709-56704731 ACAGTGTAAACAAAGCTGCTGGG - Intergenic
1191113923 X:56832362-56832384 ACAGTGTAAACAAAGCTGCCAGG - Intergenic
1191121652 X:56912588-56912610 ACAATGTAAACAAACCTGCCAGG - Intergenic
1191122470 X:56920826-56920848 ACTGTGTGAACAAAGCAGCCTGG - Intergenic
1191133278 X:57037811-57037833 ACAGTGTAAACAAAGCCACCAGG - Intergenic
1191135392 X:57058700-57058722 ACAGTGTAAACAATGGTGCCAGG - Intergenic
1191138926 X:57095011-57095033 AAAGTATAAACAAAGCCGCAGGG + Intergenic
1191153267 X:57243115-57243137 ACAGCATAAACAAAGCTGCCAGG + Intergenic
1191154037 X:57252213-57252235 ACAGTGTAAGCAAAGCAACAGGG + Intergenic
1191155784 X:57271196-57271218 ACAGTGTAAACAAAGCTTCTGGG + Intergenic
1191168518 X:57418008-57418030 TCAGTGTAAACAAAGCCTTCAGG - Intronic
1191181177 X:57565388-57565410 ACAGTGTAAACAAAGAGGCCAGG + Intergenic
1191208867 X:57863638-57863660 AGAAGGTAAACAAAGCAGCCGGG + Intergenic
1191222360 X:58003107-58003129 ACAGTTTAAAAAAAGCCACAGGG + Intergenic
1191601759 X:63016685-63016707 ACAGTGTAAACAAAGGCACCAGG - Intergenic
1191606264 X:63066006-63066028 ACAGTGTAAACAAAGCCACCAGG + Intergenic
1191631963 X:63331390-63331412 TCACTGTAAACAAAGCCTCCAGG + Intergenic
1191657459 X:63613831-63613853 ACAGTGTAAACAACGCCACCAGG + Intergenic
1191676645 X:63798139-63798161 ACAGCATAAACAAAGCCACTGGG + Intergenic
1191686752 X:63899810-63899832 ACAGTGTAAACAAAGATGCCAGG + Intergenic
1191705135 X:64086050-64086072 ACAGTGTAAACAAAGCTGCTGGG + Intergenic
1191711395 X:64153054-64153076 ACAGTGTAAACAAAGCAGCTGGG + Intergenic
1191762610 X:64661972-64661994 ACAGTGTAAACAAATCAGCTGGG - Intergenic
1191788753 X:64945857-64945879 ACAGTGTAAACAAAGCCACCAGG - Intronic
1191795669 X:65018897-65018919 AGAGTATAAACAAAGCTGCCAGG + Intronic
1191799911 X:65066917-65066939 ACAGTGTAAACAGAGCCACCAGG - Intergenic
1191810019 X:65176252-65176274 ACAGTGTAAAGAAAGCCACCAGG + Intergenic
1191824860 X:65353826-65353848 ACAGTGTAAACAAAGTCACCGGG + Intergenic
1191848585 X:65569098-65569120 ACAGTGTAAACAAAGCCCCTGGG - Intergenic
1191886543 X:65894330-65894352 ACGGTGTAAACAAAGTGGCAGGG - Intergenic
1191931344 X:66376421-66376443 ACAGTGTAAACAAAGCAACTGGG - Intergenic
1191941859 X:66489576-66489598 ACAGTGTAAACAAGGCCACCAGG + Intergenic
1191947767 X:66554155-66554177 ACAGTGTAAACACAGCTGCCAGG + Intergenic
1191969684 X:66799394-66799416 ACACTGTAAACAAAGTCGCCTGG + Intergenic
1191984853 X:66968842-66968864 ACAGTGTAAATAAAGTCACTGGG + Intergenic
1192009270 X:67250560-67250582 ACAGTGTAAACAGAGCTACCGGG + Intergenic
1192020603 X:67386749-67386771 ACAGTGTAAACTAAGCTGTCGGG + Intergenic
1192023850 X:67427136-67427158 ACAGTGTAAACAAAGCCACCAGG - Intergenic
1192064263 X:67864515-67864537 ACAGTGTAAACAAAGCCTCTGGG - Intergenic
1192128962 X:68530243-68530265 ACAGTGTAAAGAAAGCCACAGGG - Intronic
1192151153 X:68713281-68713303 ACGGTGTGAAGAATGCCGCCTGG + Intronic
1192228477 X:69246271-69246293 ATAGTGCAAACAAAGCCACCGGG + Intergenic
1192393659 X:70756086-70756108 ACCGTGAAAACAAAGAGGCCAGG + Intronic
1192524562 X:71830328-71830350 ACAGTGTAAATAAAGCCCCTGGG + Intergenic
1192598564 X:72437704-72437726 ACAGTGTAAACGAAGCCTCTGGG + Intronic
1192629016 X:72760659-72760681 ACCGTGTAAACAAAGCAGCTGGG - Intergenic
1192637171 X:72830896-72830918 ACTGTGTAAACAAAGCCTCTGGG - Intronic
1192644543 X:72889918-72889940 ACTGTGTAAACAAAGCCTCTGGG + Intronic
1192652694 X:72960155-72960177 ACCGTGTAAACAAAGCAGCTGGG + Intergenic
1192662149 X:73052735-73052757 ACAGTGTAAACAAAACCACCAGG + Intergenic
1192674603 X:73182748-73182770 ACAGTGTAAACAAAGCTGATGGG + Intergenic
1192694748 X:73401732-73401754 ACAGTGTAAACAAAGCCGCTGGG + Intergenic
1192703159 X:73497816-73497838 ACAGTGTAAACAAACCTGTGGGG - Intergenic
1192712597 X:73607259-73607281 ACAGCGTAAACAAACCTGCCAGG - Intronic
1192741040 X:73892894-73892916 ACGGTGTAAACAAAGCCACCAGG + Intergenic
1192755815 X:74046378-74046400 TCAGTGTAAACAAAGCTGCCAGG - Intergenic
1192835474 X:74794517-74794539 ATAAGGTAAACAAAGCAGCCGGG - Intronic
1192878602 X:75258485-75258507 ACAGTGTAAACAAAGCCACGAGG + Intergenic
1192884257 X:75320330-75320352 ACAGTGTAAACGAAGCTGCCAGG - Intergenic
1192922735 X:75724375-75724397 ACAGTGTAAGCAAAGCCCCTGGG - Intergenic
1192938003 X:75881426-75881448 ACAGTATAAACAAAGCTTCTGGG - Intergenic
1192958160 X:76095623-76095645 ACAGTGTAAACAAAGCTGCCAGG - Intergenic
1192974962 X:76273468-76273490 ACAGTGTAAATGAAGCCACCAGG - Intergenic
1192977267 X:76299819-76299841 ACAGTGTAAACAAAGCTGCTGGG - Intergenic
1192977649 X:76303198-76303220 ACAGTGTATACAAAGCTACTGGG - Intergenic
1192995003 X:76504449-76504471 AAATTATAAACAAAGCCTCCAGG - Intergenic
1192999608 X:76550222-76550244 ACAGTGTAAACAAAGCTGCCAGG - Intergenic
1193001571 X:76568500-76568522 ACAGTATAAACAAAGCAGCCGGG + Intergenic
1193010653 X:76671396-76671418 ACAATATAAACAAAGCCACCTGG + Intergenic
1193019931 X:76780759-76780781 ACAGTGTAAACAAAGTGGCAGGG - Intergenic
1193034491 X:76934589-76934611 ACAGTGTACACAAAGCCACCAGG + Intergenic
1193043828 X:77031813-77031835 ACAGTGTAAACAAAGCCACCTGG - Intergenic
1193060143 X:77197235-77197257 ACAGTGTAAACAAAGCTGCTGGG - Intergenic
1193068605 X:77283191-77283213 ACGGTGTAAAGAAAGCTGCTGGG + Intergenic
1193079360 X:77390567-77390589 GCAGTGTAAACAAAGCCCCAGGG + Intergenic
1193081571 X:77411817-77411839 ACAGTGTAAACAAAGCTGCTGGG - Intergenic
1193161353 X:78232835-78232857 ACAGTGTAAACAAATCCACTGGG - Intergenic
1193254014 X:79325441-79325463 ACAGTGTAAACAAAGCCGCTGGG - Intergenic
1193266862 X:79482376-79482398 ACAGTGTAAACAAAGCCCCTGGG + Intergenic
1193284610 X:79697062-79697084 ACTGTGTAAACAAAGATGCCGGG - Intergenic
1193352027 X:80474931-80474953 ACAGTGTAAACAAAGCTGCCGGG - Intergenic
1193355974 X:80520973-80520995 ACAATGTAAACAAAGCGGCTGGG - Intergenic
1193389185 X:80906467-80906489 GCAGTGTAAACAAAGCTGGCTGG + Intergenic
1193409341 X:81143861-81143883 ACCATGTAAACAAAGCCACATGG + Intronic
1193419896 X:81270898-81270920 ACAATGTAAACAAAGTGGCAGGG - Intronic
1193477254 X:81981924-81981946 ACAGTGTAAACAAAGCAGCAGGG + Intergenic
1193525275 X:82581112-82581134 ACAGTGTAAACAAAGCCACCAGG - Intergenic
1193542471 X:82788738-82788760 ACAGTGTAAACAAAGTGGCAGGG + Intergenic
1193547950 X:82852564-82852586 ATAGTGTAAACAAAGCCACCAGG - Intergenic
1193615984 X:83688670-83688692 ACAGTGTAAACAAAGCCACTGGG - Intergenic
1193646786 X:84079688-84079710 ACAGCGTAAACAAAGCCACCCGG + Intronic
1193685446 X:84571844-84571866 ACAGTGTAAACAAAGCCGCTGGG + Intergenic
1193774224 X:85622807-85622829 ACAGTGTAAACAAAGCCACTGGG + Intergenic
1193878745 X:86896216-86896238 ACAGTTTAAACAAAGCCACCAGG + Intergenic
1193906736 X:87253697-87253719 ACAGTGTAAATAAAGCTTCCAGG - Intergenic
1193949345 X:87778775-87778797 ACAGTGTAAACAAAGCCAACAGG + Intergenic
1194021269 X:88694877-88694899 ACACTGTAAACAAAGTCTCTGGG + Intergenic
1194098597 X:89674479-89674501 ACAGTCGAAACAAAGCCACCAGG + Intergenic
1194118968 X:89937510-89937532 ACAGTGTAAACAAAGCTGCCGGG - Intergenic
1194139872 X:90196322-90196344 ACAGTGTAAACAAAGCTGCCAGG + Intergenic
1194158557 X:90422786-90422808 ACAGTGTAAACAAAGCTGCCGGG + Intergenic
1194203112 X:90978909-90978931 ACAGTGTAATCAAAGCTGCCTGG - Intergenic
1194208488 X:91039950-91039972 ACAGTGTAAACAAAGCTGCTGGG - Intergenic
1194242581 X:91470150-91470172 ACAGTGTAAACAAAGCCACTGGG + Intergenic
1194355797 X:92882335-92882357 ACAGTGTAAACAAAGCCACTGGG + Intergenic
1194391180 X:93319797-93319819 ACAGTGTTAACAAAGCCACTGGG + Intergenic
1194515316 X:94844969-94844991 ACAGTGTAAACAAAGCTGCAGGG - Intergenic
1194559563 X:95403762-95403784 ACAGTGTAAACAAAGCTACTGGG + Intergenic
1194576339 X:95618697-95618719 ACAGTGTAAACAAAGCCACCAGG - Intergenic
1194624793 X:96214891-96214913 ACAGTGTAAACAAAGCTGTCAGG + Intergenic
1194643381 X:96429330-96429352 ACAGTGTAAACAAAGCCGCCTGG - Intergenic
1194652628 X:96533628-96533650 ACAGTGTAAACAAAGCCACCTGG + Intergenic
1194783117 X:98049134-98049156 ACAGTGTGAACAAAGCTACCAGG - Intergenic
1194837457 X:98698889-98698911 ACAGCGTATACAAAGTCACCTGG - Intergenic
1194959053 X:100214550-100214572 ACAGTGTAAACAAAGCCATGGGG - Intergenic
1195102318 X:101567224-101567246 ACAGTGTATACAAAGCCGCCAGG + Intergenic
1195344939 X:103940434-103940456 ACAGTGTAAACAAAGCCTCTGGG - Intronic
1195351165 X:103998152-103998174 ACAGTGTAAACAAAGCCGCCAGG - Intergenic
1195414243 X:104602695-104602717 ACAGTGTAAACAAAGCCACTGGG + Intronic
1195415112 X:104611423-104611445 GCAGTGTAAAGAAAGCTGCCAGG - Intronic
1195434678 X:104828906-104828928 ACAGGGTAAACAAAGCCGCCAGG - Intronic
1195519231 X:105812225-105812247 ACAGTGTAAACAAAGCCAACGGG - Intergenic
1195580270 X:106493599-106493621 ACAGAGTAAACAAAACCGCTGGG - Intergenic
1195622065 X:106966778-106966800 ACAGTGTATACAAAGCAGCAGGG + Intronic
1195774809 X:108391463-108391485 ACAGTGTAAACAAAGCCACCAGG - Intronic
1195828116 X:109024998-109025020 ACAGTGTCAACAAAGAGGCCAGG - Intergenic
1195832741 X:109077676-109077698 AGAGTGTAAACAAAGTCACCAGG - Intergenic
1195833716 X:109089037-109089059 ACAGTGTAGACAAAGCCACTGGG - Intergenic
1195948201 X:110238410-110238432 ACAGTGTAAACAAAGCCGCCAGG + Intronic
1195985587 X:110626679-110626701 ACAGTGTACACAAAGCCACCAGG + Intergenic
1195988363 X:110657352-110657374 ACAGTGTAAACAAAGAGACCTGG + Intergenic
1196133412 X:112181543-112181565 ACAGTGTAAACAAAGCCTCCAGG + Intergenic
1196159032 X:112462273-112462295 ACAGTGTAAACAAAGCAGCAGGG + Intergenic
1196269790 X:113697688-113697710 ACAGTGTAAAGAAAGCTGCCGGG - Intergenic
1196281162 X:113825293-113825315 ATAGTGTAAACAAAGCCCTTGGG - Intergenic
1196308049 X:114127582-114127604 ACAGTGTAAACAAACCCTCTGGG - Intergenic
1196312394 X:114183845-114183867 ACAGTGTAAACAAAGCCACCAGG + Intergenic
1196367796 X:114942990-114943012 ACAGTATAAACAAAGCCACTGGG - Intergenic
1196545710 X:116962354-116962376 ACAGTGTAAACAAAGCAGCCAGG - Intergenic
1196587218 X:117443807-117443829 TCAGTGTAAACAAAGCCACCTGG + Intergenic
1196946577 X:120832839-120832861 ACAGTGTAAACAAAGCCGCTGGG - Intergenic
1197004075 X:121474656-121474678 ACAGTGTAAAAAAAGCCACAAGG - Intergenic
1197157239 X:123283608-123283630 ACAGTGTAAACAAAGCCACCTGG + Intronic
1197191110 X:123648677-123648699 ACAGTGTAAACAAAGCTGCTGGG + Intronic
1197614289 X:128674801-128674823 ACAGTGTAAACAGAGCCACTGGG - Intergenic
1197847061 X:130814106-130814128 ACACTGTAAACAAAGCCACCAGG + Intronic
1197906265 X:131428627-131428649 ACAGTGTAAAAAAAGCCAACAGG + Intergenic
1197926949 X:131656596-131656618 ACAGTGTAAACAAAGGCACCAGG + Intergenic
1198072124 X:133159409-133159431 ACAGTGTAAACAAAGCCACTGGG + Intergenic
1198085639 X:133279294-133279316 ACAGTGTAAACAAAGCCTCAGGG + Intergenic
1198123782 X:133621631-133621653 ACTAGGTAAACAAAGCGGCCAGG + Intronic
1198259270 X:134951447-134951469 ACAGTGTAAACAAAGCCACTGGG + Intergenic
1198295376 X:135282268-135282290 ACAGTATAAACAAAGCCACCAGG - Intronic
1198335789 X:135665205-135665227 ACTAGGTAAACAAAGCAGCCAGG - Intergenic
1198519010 X:137433743-137433765 ACAGCGTAAACAAAGCTACCAGG + Intergenic
1198572372 X:137971440-137971462 ACAGTGTAAACAAAGTGGCAGGG + Intergenic
1198663491 X:138996549-138996571 ACAGTGTAAACAAAGCTGCTGGG + Intronic
1199004109 X:142675147-142675169 ACAATGTAAACAAAGCTGCCTGG - Intergenic
1199012167 X:142770552-142770574 ACAGTGTAAACAAAGCCACCAGG - Intergenic
1199068454 X:143448027-143448049 ACATTGTATATAAAGCCTCCTGG + Intergenic
1199094486 X:143723838-143723860 ACAGTGTCAACAAAGCTGCAGGG + Intergenic
1199436617 X:147819737-147819759 ACAGTGTAAACAAAGCCCCCTGG + Intergenic
1199469803 X:148181819-148181841 ACAGTGTAAACAAAGCTGCCAGG - Intergenic
1199477348 X:148260180-148260202 ACAGTGTAAACAAAGCCACCAGG - Intergenic
1200388480 X:155918085-155918107 ACTGTGTAAACAGAGTGGCCAGG - Intronic
1200451619 Y:3335854-3335876 ACAGTCGAAACAAAGCCACCAGG + Intergenic
1200471844 Y:3595064-3595086 ACAGTGTAAACAAAGCTGCCGGG - Intergenic
1200485619 Y:3765291-3765313 ACAGTGTAAACCAAGCTGCCAGG + Intergenic
1200504873 Y:3999754-3999776 ACAGTGTAAACAAAGCTGCTGGG + Intergenic
1200548944 Y:4554335-4554357 ACAGTGTAATCAAAGCTGCCTGG - Intergenic
1200573471 Y:4861704-4861726 ACAGTGTAAAAAAAGCCTTGGGG - Intergenic
1200664144 Y:5999316-5999338 ACAGTGTAAACAAAGCCACTGGG + Intergenic
1200732571 Y:6758412-6758434 ACAGTGTAAACAAAGCAGCCAGG - Intergenic
1201013433 Y:9573467-9573489 AGTAGGTAAACAAAGCCGCCAGG - Intergenic
1201312833 Y:12612387-12612409 ACAGTGTTAAGGAAGCTGCCAGG + Intergenic
1201394749 Y:13536609-13536631 ACAGTGTAAACAAAGTCACCAGG - Intergenic
1201462279 Y:14239660-14239682 ACAGTATAAACAAAGCCACCAGG + Intergenic
1201493120 Y:14564485-14564507 ACAGTATAAACAAAGCTGCCAGG + Intronic
1201519633 Y:14859349-14859371 ACAGTGTAAACAAAGCCTCAGGG + Intergenic
1201543211 Y:15131887-15131909 ACAGGGTAAACAAAGCTACTGGG + Intergenic
1201563581 Y:15343642-15343664 ACAATGTAAACAAAGCCACTGGG - Intergenic
1201611884 Y:15852080-15852102 ACAGTGTAAACAAAGCCTCTAGG + Intergenic
1201692917 Y:16789200-16789222 ACAGTGTAAACAAAGCTGCCTGG + Intergenic
1201705117 Y:16928361-16928383 ACAGTGTATACAGAGCCGCCAGG + Intergenic
1201752219 Y:17445401-17445423 ACAGTGTAAACAAAGAGGCCAGG - Intergenic
1201850913 Y:18478775-18478797 ACAGTATAAACAAAGCCACTGGG - Intergenic
1201882406 Y:18841603-18841625 ACAGTATAAACAAAGCCACTGGG + Intergenic
1201920892 Y:19232476-19232498 AGTATGTAAACAAAGCAGCCAGG - Intergenic
1201922202 Y:19245670-19245692 ACAGTGTAAATTAAGCCACGAGG + Intergenic
1201979340 Y:19890730-19890752 ACAGGGTAAACACAGTTGCCAGG - Intergenic
1201992524 Y:20043156-20043178 ACAGTGTAAACAAAGCTGCCAGG - Intergenic
1202054720 Y:20817981-20818003 ACAGTGTAAATAAAGTGGCTGGG + Intergenic
1202330630 Y:23748939-23748961 AGAGTGTAAACAAAGCCACTGGG + Intergenic
1202335196 Y:23801372-23801394 ATAGTGTAAACAAAGCTGCAGGG + Intergenic
1202342244 Y:23882068-23882090 ACAGTATTAAGAAAGCTGCCAGG - Intergenic
1202347929 Y:23954646-23954668 ACAGTGTAAACAAAGCCACTGGG + Intergenic
1202522845 Y:25715458-25715480 ACAGTGTAAACAAAGCCACTGGG - Intergenic
1202528525 Y:25788017-25788039 ACAGTATTAAGAAAGCTGCCAGG + Intergenic
1202535571 Y:25868687-25868709 ATAGTGTAAACAAAGCTGCAGGG - Intergenic
1202540139 Y:25921122-25921144 AGAGTGTAAACAAAGCCACTGGG - Intergenic