ID: 1062297623

View in Genome Browser
Species Human (GRCh38)
Location 9:135841226-135841248
Sequence GCCGCCAGGAAGTTTAAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062297616_1062297623 27 Left 1062297616 9:135841176-135841198 CCATTACTGAGGCTTGAGTAGGT 0: 224
1: 1946
2: 1882
3: 1130
4: 1039
Right 1062297623 9:135841226-135841248 GCCGCCAGGAAGTTTAAACTGGG No data
1062297620_1062297623 -5 Left 1062297620 9:135841208-135841230 CCTCACAGTGTAAACAAAGCCGC 0: 65
1: 567
2: 484
3: 266
4: 165
Right 1062297623 9:135841226-135841248 GCCGCCAGGAAGTTTAAACTGGG No data
1062297619_1062297623 -4 Left 1062297619 9:135841207-135841229 CCCTCACAGTGTAAACAAAGCCG 0: 69
1: 630
2: 464
3: 273
4: 179
Right 1062297623 9:135841226-135841248 GCCGCCAGGAAGTTTAAACTGGG No data
1062297614_1062297623 30 Left 1062297614 9:135841173-135841195 CCACCATTACTGAGGCTTGAGTA 0: 377
1: 1425
2: 1153
3: 673
4: 763
Right 1062297623 9:135841226-135841248 GCCGCCAGGAAGTTTAAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062297623 Original CRISPR GCCGCCAGGAAGTTTAAACT GGG Intronic
No off target data available for this crispr