ID: 1062297625

View in Genome Browser
Species Human (GRCh38)
Location 9:135841229-135841251
Sequence GCCAGGAAGTTTAAACTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062297620_1062297625 -2 Left 1062297620 9:135841208-135841230 CCTCACAGTGTAAACAAAGCCGC 0: 65
1: 567
2: 484
3: 266
4: 165
Right 1062297625 9:135841229-135841251 GCCAGGAAGTTTAAACTGGGTGG No data
1062297616_1062297625 30 Left 1062297616 9:135841176-135841198 CCATTACTGAGGCTTGAGTAGGT 0: 224
1: 1946
2: 1882
3: 1130
4: 1039
Right 1062297625 9:135841229-135841251 GCCAGGAAGTTTAAACTGGGTGG No data
1062297619_1062297625 -1 Left 1062297619 9:135841207-135841229 CCCTCACAGTGTAAACAAAGCCG 0: 69
1: 630
2: 464
3: 273
4: 179
Right 1062297625 9:135841229-135841251 GCCAGGAAGTTTAAACTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062297625 Original CRISPR GCCAGGAAGTTTAAACTGGG TGG Intronic
No off target data available for this crispr