ID: 1062297694

View in Genome Browser
Species Human (GRCh38)
Location 9:135841613-135841635
Sequence TGTCCCAGAAGGGCACCCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 152}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062297694_1062297698 -6 Left 1062297694 9:135841613-135841635 CCGGAGGGTGCCCTTCTGGGACA 0: 1
1: 0
2: 1
3: 17
4: 152
Right 1062297698 9:135841630-135841652 GGGACAAAGCTTCCAGAGGAAGG 0: 372
1: 839
2: 1314
3: 1087
4: 1244
1062297694_1062297697 -10 Left 1062297694 9:135841613-135841635 CCGGAGGGTGCCCTTCTGGGACA 0: 1
1: 0
2: 1
3: 17
4: 152
Right 1062297697 9:135841626-135841648 TTCTGGGACAAAGCTTCCAGAGG 0: 26
1: 469
2: 1070
3: 3449
4: 2075
1062297694_1062297699 0 Left 1062297694 9:135841613-135841635 CCGGAGGGTGCCCTTCTGGGACA 0: 1
1: 0
2: 1
3: 17
4: 152
Right 1062297699 9:135841636-135841658 AAGCTTCCAGAGGAAGGAACAGG 0: 462
1: 1765
2: 1505
3: 1752
4: 1848

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062297694 Original CRISPR TGTCCCAGAAGGGCACCCTC CGG (reversed) Intronic
900703852 1:4063753-4063775 AGCCCCAGAAAGCCACCCTCAGG + Intergenic
904082303 1:27879890-27879912 TATCCCAGAAGGGGCCCTTCTGG + Exonic
904275727 1:29383035-29383057 TGTCCCTGGTGGGCACCCTATGG + Intergenic
904423216 1:30407415-30407437 TGTCCCTGGTGGGCACCCTGGGG - Intergenic
904472139 1:30742460-30742482 TCTCCCAGATGGGCTACCTCAGG - Exonic
911743104 1:101409339-101409361 TGCCTCAGATGGGCTCCCTCTGG + Intergenic
912412213 1:109487196-109487218 AGACCCAGAAGGACAACCTCTGG + Exonic
913108578 1:115638848-115638870 TGTCCCAGAGGGGCACCTGCCGG + Intergenic
914807533 1:151002509-151002531 AGGCCCAGATGAGCACCCTCAGG - Exonic
919061908 1:192643979-192644001 TGTCCCAAAAGGGAAGCCTTGGG + Intronic
920127756 1:203707169-203707191 TGTGCCAGAGGGGCTGCCTCTGG + Exonic
920738493 1:208557829-208557851 TGTCCCAGAAGCCCAGTCTCAGG + Intergenic
921213131 1:212916635-212916657 TGTCCCAGAAACACTCCCTCTGG + Intergenic
921484777 1:215703189-215703211 TGTCCCAGAGGGGCACCTGCCGG + Intronic
921976418 1:221207661-221207683 CATCCCAGAGGGGCACCCACTGG - Intergenic
922719646 1:227893686-227893708 TGTACCAGACGGGGACCCTCAGG - Intergenic
922760253 1:228124779-228124801 TTTCCCAGATCGGCAACCTCTGG + Intergenic
924111932 1:240708663-240708685 CTTCCCAGAATGGCAACCTCAGG + Intergenic
1062953178 10:1521058-1521080 AGTCCCTGAAGGGCAGCCTCAGG - Intronic
1063449011 10:6139061-6139083 TGTCCCAGAAGAGCCCCTTCAGG + Intergenic
1065261901 10:23932160-23932182 TGTCCCAGGAGGTCAACTTCAGG - Intronic
1068951654 10:62783070-62783092 CGTCCCAGAGGGGCACCTGCCGG - Intergenic
1070467298 10:76736449-76736471 TGTTTCAGAAGGGAAGCCTCTGG + Intergenic
1073065179 10:100754322-100754344 CTTCCCAAAAGAGCACCCTCGGG - Intronic
1073152186 10:101319643-101319665 TGACCCAGAAGTGTACTCTCAGG - Intergenic
1075098514 10:119489770-119489792 TCTCCCAGAAGGGTGCCCTGGGG - Intergenic
1075573134 10:123559464-123559486 TGTCCAAGAAGGACACCGACGGG + Intergenic
1075714424 10:124547933-124547955 TGTCCAGGCAGGGCAGCCTCTGG + Intronic
1076131814 10:128018705-128018727 TCTCCCAGATCAGCACCCTCAGG + Intronic
1081766607 11:45615679-45615701 TGTCCCAGAAGGCCCTCCCCAGG + Intergenic
1084592707 11:70099746-70099768 TTTCCCAGCAGGGGAGCCTCTGG - Intronic
1085507491 11:77068597-77068619 TGTCCAAGAAGGGCCACCTTTGG + Intronic
1088973021 11:114790113-114790135 TGTCTCTGAAGAGCCCCCTCTGG + Intergenic
1092703338 12:11257095-11257117 TGTCCCAGAGGGGCACCCAGCGG - Intergenic
1093405978 12:18805380-18805402 TGTCCCAGAAGCCCAGCCTATGG + Intergenic
1096487645 12:51994485-51994507 GGTCCCCGAAGGAAACCCTCAGG - Intronic
1102290204 12:111692994-111693016 TGTCCCAGCAGGCCATGCTCTGG + Intronic
1106391076 13:29336518-29336540 TGTCCCGAAAGGGCACCCGCCGG + Intronic
1113188340 13:107715716-107715738 CGTGCCAGAAGGGCACACTGTGG - Intronic
1113808766 13:113124580-113124602 GGTCCCAGAAGGTCCCACTCAGG + Intronic
1114278747 14:21170458-21170480 TCACCCAGCAGGGAACCCTCAGG + Intergenic
1117104355 14:52382915-52382937 CATCCCAGAGGGGCACCCACTGG - Intergenic
1117299168 14:54407221-54407243 CGTCCCAGAGGGGCACCTGCCGG + Intronic
1119354664 14:73996010-73996032 TTTCCCAGAACGTCACACTCTGG + Intronic
1119560952 14:75589415-75589437 TGTCAAAGAAGGGCACACTGGGG + Intronic
1121218550 14:92267224-92267246 TGTCCCAGCAGAGGAGCCTCAGG - Intergenic
1122401384 14:101469517-101469539 TGTCCCAGGGTGGGACCCTCAGG - Intergenic
1122799039 14:104220764-104220786 TGTCCCAGAAGAGGACCCTGGGG - Intergenic
1125406125 15:39354081-39354103 TGTCCTAGCAGGCCAGCCTCTGG - Intergenic
1127006926 15:54581319-54581341 AGTCCCAGAACAGCAGCCTCAGG + Intronic
1132092805 15:98959467-98959489 TGGCCCAGGGCGGCACCCTCAGG + Exonic
1133143907 16:3769464-3769486 TTTCACAGAAGGGCACCTGCTGG - Intronic
1134243364 16:12522055-12522077 TGTGCCAGCAGGGGCCCCTCGGG - Intronic
1137619600 16:49867800-49867822 TGTCACAGCAGGGCCCCCACCGG - Intergenic
1139957651 16:70700761-70700783 TGTTCCAGAAGGGCAGGCACAGG + Intronic
1142050791 16:87956885-87956907 TGTCCCAGAAGCCCCCTCTCAGG + Intronic
1142342167 16:89530862-89530884 TCTCCCAGAAGGGCTCCTGCGGG + Intronic
1146646637 17:34580927-34580949 TGTCCCCGAATTGCACTCTCTGG + Exonic
1147374286 17:40014915-40014937 TCTCCCAGACAGGCAGCCTCCGG + Intergenic
1147374833 17:40017244-40017266 GGTCCCAGGTGGGGACCCTCAGG - Exonic
1147643165 17:42017501-42017523 GCGCCCAGAAGGGCTCCCTCGGG + Exonic
1149686498 17:58538579-58538601 TGACCCATTAGGGCACCCTCAGG + Intronic
1150249233 17:63697097-63697119 TGTCCCACCGGGGCGCCCTCAGG + Exonic
1153941432 18:9981999-9982021 TGTCCCAGAGGGGCACCTGTTGG + Intergenic
1153952689 18:10070421-10070443 TGTCCCAGCAGGGGAGTCTCAGG - Intergenic
1156462618 18:37329877-37329899 GGACCCAGAAAGGCACCCCCAGG - Intronic
1157258298 18:46157513-46157535 TGTCCCAGGAGGGAAACCCCGGG + Intergenic
1157483893 18:48073550-48073572 TGGCCCAGAAGAGCAGCCACTGG - Intronic
1158653401 18:59307650-59307672 TGACCCAGATGGGCACTGTCTGG + Intronic
1163500229 19:17671887-17671909 TGTCCCAGATGGGCAGCAGCAGG - Intronic
1164509072 19:28882867-28882889 TGTCCCAAAGGGGAACCCTGGGG - Intergenic
1166069298 19:40377948-40377970 TGGAGCATAAGGGCACCCTCGGG - Intronic
1167145404 19:47678571-47678593 AGACCCAGCGGGGCACCCTCAGG - Intronic
1168145772 19:54419370-54419392 TGTCCCCGGAGGACACCCCCAGG - Intronic
927318900 2:21720059-21720081 TGCCCCTCAAGGGCACCCTGAGG + Intergenic
927716866 2:25358749-25358771 TTCCCCTGAAGGACACCCTCTGG - Intergenic
929789501 2:45012906-45012928 TTGCCCAGAAGTGCACCCGCTGG - Intergenic
930476810 2:51892079-51892101 CGTCCCAGAGGGGCACCCGCTGG - Intergenic
931515150 2:63046636-63046658 TGTGTCAGTAGGGCCCCCTCTGG - Intergenic
931664317 2:64599310-64599332 TGGCCCAGAAAGGCTCCCTGAGG - Intergenic
931910101 2:66889709-66889731 TTTCCCAGGAGGGCAACTTCCGG + Intergenic
932732873 2:74232943-74232965 TGTCCCAGCTGGGGCCCCTCAGG - Intronic
934553641 2:95276554-95276576 TGACCAGGAAGGGCAGCCTCAGG + Intronic
937043010 2:118835675-118835697 GGTCGCAGAAGGGCGGCCTCCGG + Intergenic
937869408 2:126776825-126776847 TCTCCCAGCCGGGCACCTTCGGG + Intergenic
938238292 2:129723797-129723819 TGTCCCAGCAGGGCACACAGTGG - Intergenic
940054455 2:149499591-149499613 CATCCCAGAGGGGCACCCACCGG + Intergenic
945533682 2:210986594-210986616 CGTCCCAGAGGGGCACCTGCCGG + Intergenic
946175409 2:217919397-217919419 TGTCCCGGAAGGACACCTTGCGG - Intronic
948807399 2:240458961-240458983 GGAGCCAGGAGGGCACCCTCAGG - Intronic
1172275511 20:33676948-33676970 TGTCCCGGATGGGCAGCCTGCGG - Exonic
1172384652 20:34525420-34525442 TGTCCCAGAGAGGCACACCCAGG + Intronic
1172887524 20:38241219-38241241 TGCCCCAGAAGTACACCCACTGG + Exonic
1173339662 20:42141895-42141917 GCTCCCAGAAGGGCACCTACAGG + Exonic
1174420531 20:50396443-50396465 TGTCCCAGAAGGTAACCTCCTGG + Intergenic
1175121324 20:56718284-56718306 AGTCCCAGATGGGCACCTCCAGG - Intergenic
1175758876 20:61547729-61547751 ATTCCCAGAAAGGCAGCCTCAGG - Intronic
1175891791 20:62318985-62319007 TGTCCCAGACGGGCCACCTGGGG - Exonic
1176230894 20:64032393-64032415 TGTCCTAGAAAGCCACACTCAGG - Intronic
1177388183 21:20433695-20433717 TGTCCCAGAGGGGCACTGACCGG - Intergenic
1177763849 21:25434218-25434240 CCTCCCAGAGGGGCACCCACTGG - Intergenic
1179981604 21:44898891-44898913 TGTCCCCGACGGGAAGCCTCGGG + Intronic
1180634429 22:17253176-17253198 TCTCCCATAAGGGCAGCCTTTGG + Intergenic
1183623186 22:38986682-38986704 TGTCACAGAAGGGCAGCGGCTGG - Intronic
1185342556 22:50298186-50298208 TGTCCCCGCAGGTCACCCCCAGG + Intronic
949573871 3:5319853-5319875 TGTCCTAGAAGGGAACTGTCTGG + Intergenic
950332643 3:12168715-12168737 TGTCTCAGAAAGCCACCCTTGGG + Intronic
950497184 3:13340760-13340782 TGTGCTAGAAGAGCAACCTCTGG - Intronic
950704981 3:14773882-14773904 TGTCCCTCACAGGCACCCTCAGG - Intergenic
954510417 3:51120342-51120364 TGTCCTAGAGGGGCACCCATTGG + Intronic
954750675 3:52811726-52811748 TGTCCCAGAAGGGTAAGCTCGGG + Intergenic
957437686 3:80200149-80200171 TGTCCCAGAAGGTAAGGCTCTGG - Intergenic
959067966 3:101676930-101676952 TGTCCCTGACAGGCGCCCTCAGG - Exonic
961814966 3:129544673-129544695 TGTCCCAGAGAGCCACCCCCAGG - Intronic
962854185 3:139329428-139329450 TGGCCCGGAAGGGCAGCCTAAGG + Intronic
967896152 3:194397418-194397440 TCTCCCCGAAGAGCACCCCCGGG + Exonic
972541595 4:40043787-40043809 TGACCAATAAGGCCACCCTCTGG - Intergenic
973730343 4:53816772-53816794 TGTCCCAGCAGCCGACCCTCTGG + Intronic
976656848 4:87497692-87497714 TGTCCCAGAAAGGAAACATCTGG + Intronic
977500344 4:97829136-97829158 CGTCCCAGAGGGGCACCCACCGG - Intronic
982609811 4:157559086-157559108 TGTCCCAGAGGGGAGCCCTGTGG - Intergenic
984019007 4:174461935-174461957 TGTCCCAGAAGGGCAGACGTGGG + Intergenic
986510917 5:8505402-8505424 TGTCCCAGAAGGGGGTCCTGTGG - Intergenic
990494840 5:56337130-56337152 TGTACCTGAGGGGCACCCTCTGG - Intergenic
990765618 5:59178683-59178705 TCTCCCAGAAGAGCAGCATCAGG - Intronic
998236481 5:140402362-140402384 TGTCACAGAAGGGCTCCACCAGG - Intronic
998433655 5:142088453-142088475 TGTCCCTGAAGGGCCTCCCCTGG - Intergenic
999254046 5:150199745-150199767 TGTGCCTGAAGCACACCCTCTGG - Intronic
999501512 5:152151320-152151342 TGTGCCAGAAGCACAGCCTCAGG - Intergenic
1001245374 5:170102155-170102177 TGTCCAAGAAGGCCTCCCTCTGG + Intergenic
1002102040 5:176862476-176862498 TGTCCCAGCTGGGCAATCTCAGG - Intronic
1002278041 5:178115717-178115739 TGACCCAAAAGGGCACCAACAGG + Intronic
1002297230 5:178238477-178238499 TGTACCTGAGGGGCACCCTTGGG - Exonic
1002931327 6:1637111-1637133 TGTCCCAGCTGGGCTCCATCTGG + Intronic
1007071237 6:39039844-39039866 TGTCCTTGAGGGGCACCCCCAGG + Intergenic
1007632919 6:43282855-43282877 TGTGCGAGAAGCCCACCCTCCGG - Exonic
1008380325 6:50833758-50833780 TGTCCCAGAAGCTAAACCTCTGG - Intronic
1010615423 6:78006241-78006263 TGTCCTAGAGGGGCACCTGCCGG - Intergenic
1013964295 6:115936105-115936127 CGTCCCAGAGGGGCACCCACTGG - Exonic
1014098373 6:117483247-117483269 TGTCCCCTAAGGCGACCCTCGGG - Intronic
1014569124 6:122986954-122986976 CGTCCCAGAGAGGCACCCGCCGG - Intergenic
1019513051 7:1427763-1427785 AGTCCCAGAAAGCCACCCTTGGG - Intergenic
1020137975 7:5597019-5597041 TGGCTCAGAGGGGCACCCCCTGG - Intronic
1023938276 7:44754948-44754970 TGTCCCTGAAGGGCCCTCACTGG - Intronic
1026526013 7:71154122-71154144 TGTCCCTGAAGAGCACCCTCAGG - Intronic
1027137843 7:75637877-75637899 TGCCTCGAAAGGGCACCCTCTGG + Intronic
1029158402 7:98533612-98533634 TTTCCTAGCAGGGCACACTCTGG - Intergenic
1031582797 7:123498048-123498070 TGTCCCAGAAGGTGACACCCAGG + Intronic
1034416705 7:150969089-150969111 TGCCCCAGAAGGGCTCTCTGGGG + Intronic
1035052038 7:156004578-156004600 CGTCCCAGAAGGGTGCCTTCTGG + Intergenic
1035782660 8:2240771-2240793 TGTCCCAGCAGGTCACTCGCCGG + Intergenic
1036190232 8:6663340-6663362 TGTCCATGGAGGGCACGCTCTGG - Intergenic
1036743934 8:11390791-11390813 CTTCCCAGAAGTGCACACTCTGG - Intronic
1037996560 8:23356725-23356747 TTTCCTAGAAGGCCTCCCTCTGG - Intronic
1039199086 8:35067660-35067682 TGTCTAAGAAGGGGACCCTAGGG + Intergenic
1041704902 8:60836233-60836255 TGTCCAAGCAGCGCACCATCTGG - Exonic
1046089198 8:109478919-109478941 TGACCCAGAAGTGCTACCTCAGG + Intronic
1047062990 8:121248971-121248993 TGTCGCTGAAGGGCTCCCTCTGG - Intergenic
1048329642 8:133463176-133463198 TGTCACAGATGGACATCCTCAGG - Intronic
1053034230 9:34810438-34810460 TGACACAGAAGGGCTCCCTAAGG - Intergenic
1060937915 9:127526722-127526744 TGTCCGAGAAGGACATCCTATGG - Intronic
1062254637 9:135615158-135615180 AGCCCCAGCAGGCCACCCTCTGG - Intergenic
1062297694 9:135841613-135841635 TGTCCCAGAAGGGCACCCTCCGG - Intronic
1062324717 9:136006428-136006450 GGTCCCCCAGGGGCACCCTCAGG - Intergenic
1188885740 X:35546996-35547018 TGACCCAGCAGGTCACCCTCTGG - Intergenic
1193382077 X:80827548-80827570 CCTCCCAGAGGGGCACCCACCGG + Intergenic
1198394363 X:136207483-136207505 TGGCCCAGAATGACACCCTGAGG - Intronic
1199556399 X:149114002-149114024 TGTCCCGGATGAGCTCCCTCTGG - Intergenic
1199595565 X:149503838-149503860 TGCTGCAGAAGGGCACCCACAGG - Intronic
1199598313 X:149525373-149525395 TGCTGCAGAAGGGCACCCACAGG + Intronic
1201011008 Y:9548132-9548154 TGTCGCAGATGGGCACCCGGTGG - Intergenic