ID: 1062299601

View in Genome Browser
Species Human (GRCh38)
Location 9:135857951-135857973
Sequence GCATCTACTGAGGGCATGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062299593_1062299601 30 Left 1062299593 9:135857898-135857920 CCTGGGGTCTGAGGCTAGAGCCT 0: 1
1: 0
2: 1
3: 28
4: 263
Right 1062299601 9:135857951-135857973 GCATCTACTGAGGGCATGTGAGG No data
1062299595_1062299601 10 Left 1062299595 9:135857918-135857940 CCTATCTGGCTCAGTTCTCCTCA 0: 1
1: 0
2: 2
3: 15
4: 211
Right 1062299601 9:135857951-135857973 GCATCTACTGAGGGCATGTGAGG No data
1062299596_1062299601 -8 Left 1062299596 9:135857936-135857958 CCTCAAGAGTGTCCCGCATCTAC 0: 1
1: 0
2: 0
3: 2
4: 47
Right 1062299601 9:135857951-135857973 GCATCTACTGAGGGCATGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062299601 Original CRISPR GCATCTACTGAGGGCATGTG AGG Intronic
No off target data available for this crispr