ID: 1062300828

View in Genome Browser
Species Human (GRCh38)
Location 9:135867871-135867893
Sequence TTGTTTGCAGGGCCCCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 205}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062300828_1062300837 14 Left 1062300828 9:135867871-135867893 CCAGGCAGGGGCCCTGCAAACAA 0: 1
1: 0
2: 2
3: 17
4: 205
Right 1062300837 9:135867908-135867930 CCATCCTCAGACCAGAGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062300828 Original CRISPR TTGTTTGCAGGGCCCCTGCC TGG (reversed) Intronic
900537766 1:3187291-3187313 TTTTTGGCAGGGCCCCTGCCTGG + Intronic
900885943 1:5415501-5415523 TTGTGTGCTGGGCTCCTGGCTGG - Intergenic
900991198 1:6099191-6099213 TGGTAGGCATGGCCCCTGCCGGG - Exonic
902651431 1:17840050-17840072 TTGACTTCAGGGCCCTTGCCCGG + Intergenic
903174753 1:21574189-21574211 CTGTCTGCAAGGCCCCTGGCCGG - Intronic
903336329 1:22627034-22627056 TGTTTTCCAAGGCCCCTGCCTGG - Intergenic
904986477 1:34553633-34553655 TTTTTTGCTGGGTCTCTGCCAGG - Intergenic
910346792 1:86248070-86248092 TAGTTTGCTGGGCCAGTGCCCGG + Intergenic
911732214 1:101302916-101302938 TTGTTTGCAAGGCCTCAGCCTGG - Intergenic
916802888 1:168231089-168231111 TTATTTCCTGGGACCCTGCCTGG + Intronic
919128824 1:193428956-193428978 TTGTTTGCTGTGTCTCTGCCAGG + Intergenic
919240790 1:194914063-194914085 TTGGGGGTAGGGCCCCTGCCAGG - Intergenic
922561103 1:226570101-226570123 ATGTTTGCAGGGCTCCAGGCTGG + Intronic
923092817 1:230752764-230752786 TTGATTGCCCAGCCCCTGCCAGG - Intronic
923376084 1:233364219-233364241 TTGCTTGCAGGGTCACTGACTGG + Intronic
1063627797 10:7706787-7706809 CTGTTTGCAGTGCCCCTGCTAGG - Intronic
1064913329 10:20427470-20427492 TTTTTCCCAGGGTCCCTGCCTGG - Intergenic
1065721107 10:28629469-28629491 TTGGCTGCAGTGCCCCTCCCCGG + Intergenic
1066288296 10:33990072-33990094 TTGATTGCAGGGCCCCAGGAAGG + Intergenic
1069190071 10:65476707-65476729 TGGTTTGCAGTTCCACTGCCAGG - Intergenic
1069294137 10:66823051-66823073 ATTGTTGCAGGCCCCCTGCCAGG - Intronic
1069362478 10:67658330-67658352 ATGTTTGTTGAGCCCCTGCCAGG - Intronic
1072438054 10:95431351-95431373 TAGGTTGCTGGGCCCCAGCCTGG - Intronic
1076171672 10:128325146-128325168 TTGTTTCCAGGGCCCCTGCAAGG - Intergenic
1076401315 10:130187167-130187189 CTGTTTCCCGGGCCACTGCCAGG + Intergenic
1076681266 10:132172695-132172717 TGCTTTGCAGGGCGCCGGCCTGG - Intronic
1076743980 10:132503698-132503720 TTGTCCGCAGGCCCCCTGGCAGG + Intergenic
1076894937 10:133306221-133306243 TAGTTTGCAGGGCCTCGTCCAGG - Intronic
1077232559 11:1464562-1464584 CTGTGTGCAGGGCCCCTCCCTGG - Intergenic
1077269325 11:1667699-1667721 TTGATTGCAGGGACCATGCCCGG + Intergenic
1077288794 11:1779369-1779391 TTGTGTTGGGGGCCCCTGCCCGG - Intergenic
1079134450 11:17768543-17768565 TTGATGGCAGTGACCCTGCCCGG + Intronic
1083620721 11:64048127-64048149 GTGGGGGCAGGGCCCCTGCCCGG - Intronic
1083697685 11:64453606-64453628 TTGGTTCCAGAGCCCCTGCTGGG - Intergenic
1084573965 11:69976889-69976911 GTGTTTGCCGGGTCCCTGGCAGG + Intergenic
1084604518 11:70164831-70164853 TTTTTTCCAGGGCCACTGGCCGG - Intronic
1084943142 11:72625095-72625117 CTGTTGTCAGGGCCCCTGGCAGG + Intronic
1086850012 11:91798423-91798445 TAGGGTGCAGGCCCCCTGCCGGG - Intergenic
1088637608 11:111838576-111838598 TTGTTGGCAAGCCCTCTGCCTGG - Intronic
1088840620 11:113624639-113624661 TTGTCTGAAGGGCCCATGGCTGG + Intergenic
1089170263 11:116506717-116506739 TTGTGTTCAGGGCCCCACCCTGG + Intergenic
1089789323 11:120931258-120931280 TTATTAGGAGGGCCCCTGCAGGG + Intronic
1091721995 12:2820537-2820559 GAGTTTCCAGGGCTCCTGCCTGG - Intronic
1091726273 12:2848656-2848678 TTGGTTGCAGGGCCCCATGCAGG - Intronic
1097043865 12:56172873-56172895 TTTATTGGGGGGCCCCTGCCCGG - Intronic
1097676154 12:62603818-62603840 TTGTTTTCCGGGGCGCTGCCTGG + Intergenic
1098031552 12:66259852-66259874 GTGCTTGCTGGTCCCCTGCCCGG + Intergenic
1100710660 12:97252742-97252764 CTGTATGCAAGGACCCTGCCAGG + Intergenic
1101839582 12:108318507-108318529 TTGTTTGCAGGGTCACTGTGGGG + Intronic
1104018327 12:124975226-124975248 TTGCTTGGAGGCCCCCTGCTTGG + Intronic
1104605333 12:130183827-130183849 TTGTCTGCAGGTCTTCTGCCCGG + Intergenic
1104845379 12:131844258-131844280 TTCTGTGCAGGACCCCTGGCAGG - Intronic
1105580263 13:21689194-21689216 TTTTCTGAAGTGCCCCTGCCTGG + Intronic
1105813163 13:24011727-24011749 TTCTCTGCATGCCCCCTGCCAGG - Intronic
1106840301 13:33679518-33679540 TTGTTTGCAGGTCTCTGGCCCGG - Intergenic
1109105444 13:58244077-58244099 TTTTTTGCTGGGTCTCTGCCAGG - Intergenic
1112327228 13:98449911-98449933 TTGTTTGCTCTGCCCCTGCCTGG - Intronic
1113069476 13:106406545-106406567 TTGTGTGCGGGGCCCCTTCTTGG - Intergenic
1113169793 13:107487742-107487764 TTTTTTGTTGTGCCCCTGCCAGG + Intronic
1115217310 14:31026185-31026207 TTGTGTGTGGGGCCCCGGCCGGG + Exonic
1115623445 14:35164969-35164991 TTGTTTGCAGGTACCTTGCAGGG + Intronic
1116219145 14:42059832-42059854 TTGTTTTCAGAACCCATGCCTGG - Intergenic
1117400981 14:55358387-55358409 GTATTTGCAGGGCCCATGGCAGG + Intronic
1120071074 14:80103237-80103259 GTGTCTCCAGGGCCCCTTCCTGG - Intergenic
1121337259 14:93085016-93085038 GTGTTTGCAGAGAGCCTGCCAGG - Intronic
1122945600 14:105007269-105007291 TCCTCTGCAAGGCCCCTGCCGGG + Intronic
1123007766 14:105332658-105332680 TTCTCTGCGGGGCCTCTGCCTGG + Intronic
1124078674 15:26470782-26470804 TGGTTTGGAAAGCCCCTGCCAGG + Intergenic
1125412520 15:39420232-39420254 TCAGTGGCAGGGCCCCTGCCAGG + Intergenic
1125538218 15:40454919-40454941 TGGTTTGGAGGGGCCCTGGCAGG + Intronic
1125601726 15:40919117-40919139 TTGTCTCCTGGGCCCCTCCCTGG - Intergenic
1127350886 15:58150841-58150863 TTGTTTGAAGGGCTCATGGCAGG - Intronic
1127515557 15:59689582-59689604 CTGTTCGCAGGGACGCTGCCTGG + Intergenic
1127734335 15:61827863-61827885 TGGCTTCCAGGGCCCCTCCCAGG + Intergenic
1127940890 15:63694789-63694811 TTGCTTGCAGGGCTCTTTCCAGG + Exonic
1128305281 15:66594341-66594363 CTGTTTGGAGGGTCCCTGCCAGG + Intronic
1129267221 15:74400201-74400223 TGGGCTGCAGGGCCCCTGCAGGG - Intergenic
1129709229 15:77811977-77811999 TTGTGTGTGGGGCTCCTGCCTGG - Intronic
1130549660 15:84881915-84881937 TTGTTTTCCTGGCTCCTGCCAGG + Intergenic
1132075350 15:98815462-98815484 CTGTTTGCATGGGCCCAGCCCGG - Intronic
1132568382 16:633496-633518 TGCCGTGCAGGGCCCCTGCCGGG + Exonic
1132632675 16:927407-927429 TTAATTGCACGGCCCCTCCCTGG - Intronic
1133285708 16:4689682-4689704 CTGTTTGGCAGGCCCCTGCCAGG + Exonic
1133683556 16:8144053-8144075 TGGATTGGAGGACCCCTGCCTGG + Intergenic
1136569108 16:31086336-31086358 TGGGGTGCAGGGCCCCTGTCAGG - Exonic
1140042013 16:71414316-71414338 TTGTTTGCAGGTCACCTTCCAGG - Intergenic
1140700385 16:77575932-77575954 TTATTTTCAGGGCACCTCCCAGG + Intergenic
1147718165 17:42521882-42521904 TTGTGGGCAGGGCCCATGCAAGG - Exonic
1148896179 17:50840457-50840479 GGCTTTGCAGGGCCCCTGCAGGG - Exonic
1148909258 17:50931727-50931749 TTGTTCGCTCGGCCCCTGCCGGG - Intergenic
1151147727 17:72057027-72057049 AAGTGTGAAGGGCCCCTGCCTGG - Intergenic
1152405536 17:80096021-80096043 GTGAGTGCAGGGCCCCTGGCTGG - Intronic
1152647700 17:81477420-81477442 GTGAGGGCAGGGCCCCTGCCTGG + Intergenic
1152804986 17:82351447-82351469 TCGGTCGCAGGGCCCCAGCCCGG - Intergenic
1154968648 18:21384788-21384810 TTGTTTGCAGGGCCGGGGGCGGG - Intronic
1160480829 18:79238414-79238436 GCATGTGCAGGGCCCCTGCCTGG + Intronic
1161067329 19:2245219-2245241 TTGTTGGAAGGGCCCCAGCCAGG + Intronic
1161516587 19:4699931-4699953 GTCCTCGCAGGGCCCCTGCCCGG + Intronic
1162340267 19:10087468-10087490 CTGTTTGCAGGCTCCCTGGCCGG - Intronic
1163332184 19:16646822-16646844 TTGTTAACAGGGCCCCTGGCCGG + Exonic
1164642666 19:29837907-29837929 GTGATTCCAGGGCCGCTGCCGGG + Intergenic
1165065773 19:33226977-33226999 GGGTTTGCTGGGGCCCTGCCAGG + Intergenic
1165129942 19:33625523-33625545 TTTTTTGCTGTGCCACTGCCGGG - Intronic
1165419325 19:35715328-35715350 TGGTTTGCAGGGAGCCTGCTGGG - Exonic
926142219 2:10374545-10374567 CTGTCTGCAGGGCCCATGCGGGG + Intronic
926681330 2:15666037-15666059 TATTTTGCAGGCACCCTGCCTGG + Intergenic
928247037 2:29639362-29639384 TTCTGTGCACTGCCCCTGCCAGG + Intronic
931444425 2:62314975-62314997 TTGTCTGCAGATTCCCTGCCAGG - Intergenic
935639457 2:105277098-105277120 TAGGGTGCAGGACCCCTGCCAGG + Intronic
937001257 2:118469441-118469463 TTGTTATCAGGGCAGCTGCCAGG - Intergenic
937468581 2:122155954-122155976 ATGTTGGCAGGCCCCCTGCCTGG + Intergenic
937908819 2:127065458-127065480 TGGTTGGCAGCCCCCCTGCCAGG - Intronic
939510473 2:143098585-143098607 TTGTTTGAAGGGCTCATGGCAGG + Intronic
943657349 2:190523731-190523753 TAGTTTGAAGGGGCCCTGACTGG + Intronic
944138617 2:196429802-196429824 TTCTTTCCAGGGCCCTGGCCTGG - Intronic
944741538 2:202617504-202617526 TTGTTTGAAGGGCTCATGGCAGG - Intergenic
947815139 2:233031862-233031884 TTGGCTGCAGGGCCCTGGCCTGG - Intergenic
947916968 2:233839011-233839033 TTCTCTGCAGGGCCCCAGCTAGG - Intronic
948376433 2:237523989-237524011 TTGTTTGAAGGGCTCATGGCAGG + Intronic
1168862944 20:1059146-1059168 TTGTTTGCCAGGCTCATGCCTGG + Intergenic
1168948328 20:1779689-1779711 TTGTTTTCAGGGGCTCTGCCAGG + Intergenic
1169093533 20:2875799-2875821 GTATTTGCAGAGCCTCTGCCAGG + Intronic
1173437227 20:43044171-43044193 TTGTTTTCTGGTCTCCTGCCAGG - Intronic
1174037057 20:47674859-47674881 TTGTGAGCAGGGCCGTTGCCTGG + Intronic
1176220469 20:63967153-63967175 TCTTGTGCATGGCCCCTGCCAGG - Intronic
1178843744 21:36157338-36157360 TTGTTTGCTGGTGCCCTGGCTGG + Intronic
1179308579 21:40176815-40176837 TGGTCTGCAGGGCAGCTGCCTGG - Intronic
1179995445 21:44971876-44971898 TTCATTGCAGGGGCTCTGCCGGG - Intronic
1179997698 21:44981582-44981604 CTGTGTGCAGGGCCCCGTCCGGG - Intergenic
1179997729 21:44981695-44981717 CTGTGTGCAGGGCCCCGTCCGGG - Intergenic
1179997745 21:44981752-44981774 CTGTGTGCAGGGCCCCGTCCAGG - Intergenic
1179997762 21:44981809-44981831 CTGTGTGCAGGGCCCCGTCCGGG - Intergenic
1179997780 21:44981866-44981888 CTGTGTGCAGGGCCCCGTCCAGG - Intergenic
1179997812 21:44981979-44982001 CTGTGTGCAGGGCCCCGTCCAGG - Intergenic
1179997828 21:44982037-44982059 CTGTGTGCAGGGCCCCGTCCAGG - Intergenic
1179997844 21:44982094-44982116 CTGTGTGCAGGGCCCCGTCCAGG - Intergenic
1179997860 21:44982152-44982174 CTGTGTGCAGGGCCCCGTCCAGG - Intergenic
1179997877 21:44982209-44982231 CTGTGTGCAGGGCCCCGTCCAGG - Intergenic
1179997937 21:44982433-44982455 CTGTGTGCAGGGCCCCGTCCAGG - Intergenic
1180645118 22:17332550-17332572 TAGTTTGCTGGGCCCCTCCCAGG + Intergenic
1181283210 22:21734720-21734742 ATGTTTGCTGAGCCCCTGCCAGG - Intronic
1183062389 22:35344294-35344316 GTGCTCGCAGGGCTCCTGCCAGG + Intronic
1183100152 22:35578892-35578914 GTGGGTGCAGGGCCCCTCCCAGG - Intergenic
1183536260 22:38403276-38403298 CTGAATGCAGGGCCCATGCCAGG - Intergenic
1183935943 22:41262373-41262395 ATGTTTGCAGAGCACCTGCTAGG + Intronic
1183947486 22:41334887-41334909 TGTCTTGCAGGGCCTCTGCCTGG - Intronic
1184296459 22:43528222-43528244 TTTTGTTCATGGCCCCTGCCAGG - Intergenic
1184455735 22:44608613-44608635 TTGTCTCCAGGGGCCCTGCTGGG - Intergenic
1184470481 22:44692819-44692841 GTGTTTGCAGCCGCCCTGCCAGG - Intronic
1185053296 22:48564893-48564915 TTTTTTGCAGGGCCACTGGGGGG - Intronic
1185375994 22:50482783-50482805 CTGTGTGCTGGGCACCTGCCAGG + Exonic
950912045 3:16605078-16605100 CTGTTTGGGGGGCACCTGCCTGG - Intronic
955195695 3:56802792-56802814 TTGTTTGCAGCAGCCCTGTCTGG + Intronic
959583201 3:108002711-108002733 ATATTTGCAGGGGCACTGCCCGG - Intergenic
961710465 3:128824296-128824318 TGGCTTGCAGGGCCCGTTCCTGG - Intergenic
965238533 3:166160875-166160897 TTGTTTGAAGGGCTCATGGCAGG + Intergenic
965759280 3:172057851-172057873 TTGTTTGAGTGGCCCCTGGCTGG + Intronic
965855326 3:173081180-173081202 TTGTTTGCCTGGTCACTGCCAGG - Intronic
967093875 3:186160752-186160774 TGGTTTTCAGGGCCTCTGCTGGG - Intronic
968208195 3:196823528-196823550 TTGTTTGCGGGGATCCAGCCTGG - Intronic
969276278 4:6137888-6137910 TTGTCTGCCAGGCCCATGCCAGG - Intronic
971335516 4:25720200-25720222 TTGTTTGAAGGGCTCATGGCAGG + Intergenic
975364657 4:73515291-73515313 TTGTTTGCTGTGTCTCTGCCAGG + Intergenic
978952588 4:114579036-114579058 TTTTTTGCTGGGTCTCTGCCAGG + Intergenic
979529379 4:121752718-121752740 TTTTTTGCTGTGCCTCTGCCAGG - Intergenic
982442816 4:155456867-155456889 TTGTTTGAAGGGCTCATGGCAGG + Intergenic
983362724 4:166747162-166747184 TTGTTTGCTGTGTCTCTGCCAGG - Intronic
983404548 4:167311374-167311396 TTTTTGGCAGGGCCGCAGCCTGG - Intergenic
986304653 5:6506330-6506352 TTGTTCCAAGGGCCCCTCCCTGG - Intergenic
986571929 5:9174642-9174664 TTGTATAGATGGCCCCTGCCTGG - Intronic
992253087 5:74895151-74895173 TCATTTGTAGGGCCCTTGCCAGG + Intergenic
997362497 5:133303966-133303988 TTGGTTTCTGGGCTCCTGCCTGG + Intronic
999064438 5:148670660-148670682 TTTTTTGTAGTGCCTCTGCCAGG + Intronic
1002319017 5:178364171-178364193 TTGGTTTCTGGGCCCCTCCCTGG + Intronic
1002906436 6:1452968-1452990 ATGTCTGCAGGGCCTCTGACAGG - Intergenic
1004474821 6:15961509-15961531 ATCTTTGCTGGGCCCTTGCCGGG + Intergenic
1007089354 6:39172551-39172573 TTGTTTGCAGGGGGCCGACCTGG + Intergenic
1008077743 6:47163399-47163421 TTGTTTTGATGGCCTCTGCCTGG - Intergenic
1008763512 6:54882555-54882577 TGGTTTGCATGGAGCCTGCCTGG - Intronic
1009656926 6:66559025-66559047 TTGTCTGCAGGGCCCTTACTGGG - Intergenic
1010470483 6:76221298-76221320 TTATTTTCAGGGTCCCTTCCAGG - Intergenic
1013999288 6:116346297-116346319 TTTTTTGTTGGGCCTCTGCCAGG - Intronic
1015337659 6:132059178-132059200 GTGTTTGCAGTGCTGCTGCCAGG + Intergenic
1017102995 6:150865283-150865305 TTGGTTCCAGGGCCCCTCCAGGG - Intergenic
1018365637 6:163117169-163117191 TGGTTTGCAGGGACCCTGAAGGG - Intronic
1019626035 7:2016122-2016144 TTGTTTCCAGGGCAGCTGGCTGG - Intronic
1019660211 7:2219857-2219879 TCCTTTCCAGGGCCCCTGGCTGG - Intronic
1021962782 7:25889268-25889290 TGGGTTGGAGGGCCCCTGCCTGG - Intergenic
1022489392 7:30805142-30805164 CTGGCAGCAGGGCCCCTGCCGGG + Intronic
1024063662 7:45716303-45716325 TTGACAGCAGGGCCCCAGCCAGG - Exonic
1026023469 7:66728045-66728067 TTCTTTGCAGACCCTCTGCCTGG + Intronic
1026063568 7:67048372-67048394 TTGGTGGTAGGGCCACTGCCTGG + Intronic
1026714782 7:72779102-72779124 TTGGTGGTAGGGCCACTGCCTGG - Intronic
1026888267 7:73967236-73967258 TTCTTTGCAGACCCTCTGCCTGG + Intergenic
1029724382 7:102392686-102392708 TTGTGTGCATGGCCCCAGCCAGG + Intronic
1032089468 7:128904055-128904077 TTGTCTACAGTGCACCTGCCTGG - Exonic
1032172893 7:129600527-129600549 GTGTTTGCAGGGGCCCTGGGAGG - Intergenic
1037412817 8:18616334-18616356 CTGTTTGCAGGGCCTCTGAAAGG - Intronic
1037414170 8:18630978-18631000 TTGATTCCAGGGCCTCTGACAGG - Intronic
1037856906 8:22378391-22378413 GGGTTTTCAGGGCCTCTGCCAGG + Intronic
1038356020 8:26830179-26830201 TTCTCTGCAGGGGACCTGCCTGG - Intronic
1044186122 8:89254030-89254052 TTCCTTCCAGGGCCCCTGCCTGG - Intergenic
1047675476 8:127197024-127197046 TTGTTAGCTGGGCCCCTGGGAGG + Intergenic
1047916935 8:129592967-129592989 TTGTTTGCAGATCTCCTGTCTGG + Intergenic
1049071923 8:140362202-140362224 TTGTTATCAGGCACCCTGCCAGG - Intronic
1049109429 8:140634429-140634451 TTGTCCGCTGGGCCCCAGCCGGG - Intronic
1049673514 8:143879839-143879861 TTGCAGGCAGCGCCCCTGCCAGG + Intergenic
1051126634 9:13812583-13812605 TTGTTAGCAGGTCCCCAGTCAGG - Intergenic
1054906119 9:70415004-70415026 TTCTTTCCAGAGCCCCTGCATGG + Intergenic
1057072364 9:92110388-92110410 TTGTTTGAAGGGCTCATGGCAGG - Intronic
1057312024 9:93948785-93948807 TTGTCAGAAGGGCCCCGGCCCGG - Intergenic
1057329692 9:94101960-94101982 ATGTTTGCAGTGCCTCTCCCAGG - Intronic
1057473574 9:95380003-95380025 TTGTTTACTGGGCCCAAGCCAGG + Intergenic
1057893504 9:98887707-98887729 TTGGTTCCAGGGCCCCTCCAAGG + Intergenic
1060200386 9:121648981-121649003 TTGATTCCAGGTCCCCTGCTGGG + Intronic
1062022104 9:134324756-134324778 TTGTTTGCCGCCCCCCTCCCTGG + Intronic
1062280518 9:135749747-135749769 GTGGGTGCAGGGCACCTGCCAGG - Intronic
1062300828 9:135867871-135867893 TTGTTTGCAGGGCCCCTGCCTGG - Intronic
1062601402 9:137320162-137320184 ATGTCTGCAAGGCCCCTGGCCGG + Intronic
1190702722 X:53000202-53000224 CTGGTTGGAGGGCCCCAGCCAGG + Intergenic
1190834650 X:54089400-54089422 GTGTTTGCAGGTCCCCTCCTAGG + Intronic
1193638982 X:83988298-83988320 TTTTTTGTTGGGTCCCTGCCAGG - Intergenic
1194765011 X:97839380-97839402 TTGACTGCAGTGTCCCTGCCAGG - Intergenic
1194905339 X:99568994-99569016 TTTTTTGTTGTGCCCCTGCCAGG + Intergenic
1197393596 X:125898437-125898459 TCCCTTCCAGGGCCCCTGCCTGG - Intergenic