ID: 1062301425

View in Genome Browser
Species Human (GRCh38)
Location 9:135874024-135874046
Sequence TCCCCAGGACAAACACAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 198}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062301425 Original CRISPR TCCCCAGGACAAACACAAAT TGG (reversed) Intronic
900320189 1:2079760-2079782 AGGCCAGGACAAACACAAAAAGG - Intronic
902725536 1:18333430-18333452 GACCCAGGAAAAACACAAAATGG + Intronic
904409086 1:30314158-30314180 TCCCCAACACGAACACAAAACGG + Intergenic
904824369 1:33265136-33265158 TCCCCAGGAGAAATAGAAGTAGG + Intronic
905678946 1:39852735-39852757 TCCACATGACAAACGCAAAGTGG - Exonic
907019587 1:51053803-51053825 TCCCAAGGATAAACTCAAGTTGG + Intergenic
908330878 1:63069667-63069689 TCCCCAGGACATAAACAAGGTGG - Intergenic
908851821 1:68384593-68384615 TCCCAAGGACAAGCACATAAAGG - Intergenic
910151927 1:84158453-84158475 TCCAAAGTACATACACAAATGGG - Intronic
911118224 1:94268403-94268425 CCCCCAGCACACACACACATTGG + Intronic
912105789 1:106272854-106272876 TACCTAGAACAAACAAAAATAGG - Intergenic
912420358 1:109538582-109538604 GCCCCAGGTCAAAAACAAAGAGG - Intergenic
916560594 1:165931307-165931329 TCCCCAGGAAAAAAAAAAAAAGG - Intergenic
918030265 1:180801001-180801023 TCCCTAGGAAAGACAGAAATGGG - Intronic
918308632 1:183269542-183269564 TCCAGAGAAGAAACACAAATGGG - Intronic
919057205 1:192586106-192586128 TCCCTAGGAAAAAGTCAAATGGG + Intergenic
919101349 1:193100794-193100816 TTCCCAGGCCAAAATCAAATAGG + Intronic
920435373 1:205943625-205943647 TCCCCAGGTAAAACAAAAAAAGG - Intergenic
924442463 1:244097642-244097664 TCCCCAGGACAAACCCTACCTGG - Intergenic
1063516386 10:6700103-6700125 TCCCCAGTACAAACACATGTTGG + Intergenic
1066629439 10:37444668-37444690 TTCCCAGGACAAGCAACAATGGG + Intergenic
1066682758 10:37950231-37950253 GCCACAGGTCAAACATAAATAGG + Exonic
1069074316 10:64021847-64021869 TCCCCAGTAAAAGCAGAAATTGG - Intergenic
1069446062 10:68474190-68474212 TTCCTAGGATAAACCCAAATTGG + Intergenic
1069619338 10:69826856-69826878 ACCCCATGACCAACACAAAAGGG + Intronic
1070308133 10:75252180-75252202 TTCCTAGGTAAAACACAAATTGG + Intergenic
1070486325 10:76935296-76935318 CCCCCAGGACAAACACTCAAGGG - Intronic
1070811493 10:79300417-79300439 TCCCCAGGACAGAGACAGAGGGG - Intronic
1070889806 10:79934760-79934782 TCCCCTGCACTAACACACATGGG - Intergenic
1071555194 10:86596161-86596183 TGCCCAGGAGAAAAATAAATCGG - Intergenic
1072036249 10:91565603-91565625 TACCCAGGACACCCTCAAATGGG - Intergenic
1074370395 10:112896014-112896036 TCCCCAAGACAAGCACAGAGAGG - Intergenic
1074817025 10:117150042-117150064 GCCGCAGGAAAAACACAAATAGG + Intergenic
1077047926 11:554475-554497 TCCCCAGGCCAAACCCAGTTGGG - Exonic
1078158797 11:8822332-8822354 TCCCCACCACATACACAAAATGG - Intronic
1078290544 11:10006358-10006380 TTGCCAGGACAGACACTAATTGG + Intronic
1080416478 11:32074074-32074096 TCCCTAGGAAGAACACAGATGGG + Intronic
1080930689 11:36806946-36806968 TCTCCAGGAAAAAAAAAAATTGG + Intergenic
1081439510 11:43064936-43064958 CTCCCAGGACTCACACAAATTGG - Intergenic
1082302151 11:50520264-50520286 TCTGCAGTACAATCACAAATCGG + Intergenic
1083730613 11:64650610-64650632 TCCCCAGGTCAAACACGTAGTGG + Exonic
1089864805 11:121622514-121622536 TCCCCTGAAGAAAGACAAATGGG + Intronic
1093401328 12:18750366-18750388 TTCTCAAGACAAACACAAACTGG + Intergenic
1094674349 12:32604184-32604206 TAACCAGGACAAATACAAAAAGG - Intronic
1098220653 12:68266700-68266722 TCCCCAGGTCAAATATAAATTGG - Intergenic
1099014972 12:77333468-77333490 TCCCCAGCATACACACAAAAAGG + Intergenic
1100796140 12:98183761-98183783 GCCCCAGGACACACAGAAAGTGG + Intergenic
1101791346 12:107930456-107930478 TCCCCAGCAGATACAGAAATAGG - Intergenic
1101825902 12:108219757-108219779 TACCCAGGACAACCCCAAAGGGG + Intronic
1101856546 12:108448251-108448273 CACCCTGGACAAACAGAAATCGG - Intergenic
1102279413 12:111607170-111607192 TCCCCAGTAGAATCACATATGGG + Intergenic
1106461008 13:29968944-29968966 TCCCCAGGAGAACCAGAAAATGG + Intergenic
1106661362 13:31803079-31803101 TGCCCAGGGCACAAACAAATTGG + Exonic
1107601506 13:42018216-42018238 TCCCCACTACACACACAAAACGG + Intergenic
1108529520 13:51315954-51315976 CCCCCAGGAAAAGCACAGATTGG - Intergenic
1108820039 13:54337182-54337204 ACTCCAGGACAAAGATAAATGGG - Intergenic
1109907159 13:68858688-68858710 TTCCTAGGAGAAACACCAATAGG - Intergenic
1109933411 13:69246220-69246242 TCCCTAGGACAATAATAAATTGG - Intergenic
1110664563 13:78101676-78101698 TCCTCAGTAAAAACACAAAAAGG - Intergenic
1112083856 13:96006835-96006857 GCCTCAGGACAAAGACAAAGAGG + Intronic
1112309274 13:98303500-98303522 TCCCCAGAACATACACAACGAGG - Intronic
1115189897 14:30736805-30736827 TGTTCAGGACAAACACAAAATGG + Intergenic
1115336401 14:32247475-32247497 TCCCCAGGTCAACCCCAATTGGG - Intergenic
1115857277 14:37644080-37644102 TCGCTAGGACAAAACCAAATCGG + Intronic
1117922693 14:60741827-60741849 TCCCAGAGACAGACACAAATTGG - Intronic
1118151987 14:63199571-63199593 CCCCCAGGACAAAAGCAAAAAGG - Intergenic
1122810598 14:104285881-104285903 TCCCCAGCACAAAGACCACTTGG + Intergenic
1123869737 15:24558296-24558318 TCCCCAAGACAAAAACATCTCGG + Intergenic
1124998590 15:34748014-34748036 TGCCCAGGACAGACCCAATTTGG + Intergenic
1126573952 15:50180131-50180153 TCCCCAGGACCCACAGACATTGG + Intronic
1128777375 15:70331912-70331934 TTCCCAGGACAAACCCCACTTGG + Intergenic
1129955709 15:79634979-79635001 TCCCCAGGAAAGACACTATTGGG + Intergenic
1130035449 15:80356935-80356957 TTCCTAGGATAAACACAACTTGG + Intronic
1130144728 15:81265251-81265273 TTCCGAGGACAAGCACAAACAGG - Intronic
1135133699 16:19872539-19872561 TCCCCAGGAGGAACAGAAAGTGG + Exonic
1137750878 16:50860166-50860188 TCCCCAGAAGAAACTCCAATTGG - Intergenic
1138869205 16:60860806-60860828 TGCCCAGGAGACATACAAATTGG + Intergenic
1140360330 16:74338689-74338711 TTCCCAGGACAAAAAAAAAAAGG + Intergenic
1140510001 16:75500235-75500257 TCCCCAGCAGAAACACATGTGGG - Intergenic
1140767267 16:78171924-78171946 TACCTAGTACAAAGACAAATAGG - Intronic
1141021992 16:80506054-80506076 TCCATAGGACACACACCAATGGG + Intergenic
1141026643 16:80555015-80555037 GCCCCATATCAAACACAAATTGG - Intergenic
1141284782 16:82661314-82661336 TCCCTAGGAAAAGCATAAATAGG - Intronic
1142277266 16:89127052-89127074 TTCCCAGGACAAACCCCACTTGG + Intronic
1203012038 16_KI270728v1_random:303305-303327 GCCCCAGGATAAACACTAAGAGG + Intergenic
1203030373 16_KI270728v1_random:576464-576486 GCCCCAGGATAAACACTAAGAGG + Intergenic
1203041348 16_KI270728v1_random:757967-757989 GCCCCAGGATAAACACTAAGAGG - Intergenic
1142684217 17:1568268-1568290 TCCCCAGGACACCCAGAGATGGG - Intergenic
1144421283 17:15101430-15101452 TTCCCAGAACAAACACAACCTGG - Intergenic
1148502566 17:48102674-48102696 TCCCAAGGAAACACACAATTAGG + Intergenic
1148735012 17:49860439-49860461 TCCCCAGGCCAAACACAGGGTGG - Intergenic
1152122359 17:78426598-78426620 TCCCTAGGAGACACACAGATGGG + Exonic
1153349004 18:4058359-4058381 TTGCCAGGACAGACACTAATTGG + Intronic
1153757375 18:8298042-8298064 TCCCCAGGACAAACCCAACCGGG + Intronic
1156801427 18:41119382-41119404 TCCCCAGAACACTCACACATAGG + Intergenic
1160843646 19:1157257-1157279 TCCCCAGGATAAACCCTAGTGGG + Intronic
1162322962 19:9980718-9980740 GCCCCAGAACAAACTCAACTGGG + Intronic
1162583676 19:11546183-11546205 ACCCAAGCACACACACAAATGGG - Intronic
1163606730 19:18279995-18280017 TCCCGAGTAGAAACATAAATAGG + Exonic
1168366586 19:55793200-55793222 TTCCCAGGGCAAACAGAAAACGG - Intronic
1168636507 19:58001260-58001282 GGCCCAGGAGAAACACAACTTGG + Intronic
1168679543 19:58304502-58304524 TCTCCTGGACATACAGAAATAGG + Intronic
927342846 2:22002124-22002146 TCCCCATCACAAACACTACTTGG - Intergenic
928401691 2:30983535-30983557 TCCCCAGAACAAAGACCACTTGG + Intronic
928800791 2:35088802-35088824 TCCCCAGGATAAGCACCAAAAGG + Intergenic
929779871 2:44950716-44950738 TCACCATGACAAACACACAGAGG + Intergenic
930087722 2:47509801-47509823 TCCCCTGGCCTTACACAAATTGG - Intronic
930421308 2:51156633-51156655 TCCCCTCCTCAAACACAAATTGG + Intergenic
932008236 2:67949088-67949110 TCACCAGGAGAAATAAAAATAGG - Intergenic
933135938 2:78735602-78735624 TGCCCAGGATAAGCAAAAATAGG + Intergenic
933780654 2:85798598-85798620 TCCCCTGTAAAAACAAAAATAGG - Intergenic
933825015 2:86151659-86151681 TCCCCAGTTCAATCAGAAATTGG + Intronic
933865329 2:86510778-86510800 CACCCAGGAAAATCACAAATGGG + Intronic
933993863 2:87653219-87653241 TCCTCAGGAGGAACACAAAGTGG + Intergenic
935413720 2:102792800-102792822 TCCCCTGTACAACCACAGATTGG - Intronic
936300000 2:111297664-111297686 TCCTCAGGAGGAACACAAAGTGG - Intergenic
936710202 2:115122546-115122568 TTGCCAGGACACACACTAATTGG - Intronic
938610516 2:132943150-132943172 TCCTCTGGACATACCCAAATGGG + Intronic
939183270 2:138828610-138828632 ACCCCAGGACATACACCAAAAGG - Intergenic
941621580 2:167785038-167785060 ACCACAGGATCAACACAAATTGG + Intergenic
942053095 2:172158808-172158830 TGCCCAGGACAGACAGACATGGG + Intergenic
942409614 2:175694720-175694742 TTCTCATGACATACACAAATAGG - Intergenic
943420767 2:187666084-187666106 TGCCCTTGTCAAACACAAATTGG - Intergenic
943705822 2:191033146-191033168 TCCCCTTGAAAAACAGAAATTGG + Exonic
945939147 2:215931056-215931078 TGCCGAAGACAAACACAATTTGG + Intergenic
1172811428 20:37650927-37650949 ATCCCAGGGCAAACACAGATTGG + Intergenic
1173477607 20:43372819-43372841 TCCCCAGGGCAAACAGAATGGGG - Intergenic
1174199429 20:48797247-48797269 TCCCCAGAAAAAAGCCAAATGGG + Intronic
1177359543 21:20050092-20050114 CCCACAGGACCAACACCAATTGG - Intergenic
1177721375 21:24910931-24910953 TCCCCACCACACACACACATAGG + Intergenic
1178716126 21:34966028-34966050 TCCCCAGGAGAAAGGCACATTGG + Intronic
1178844928 21:36166738-36166760 TCCCCAGGCCAAACACACCAGGG + Intronic
1180130534 21:45824134-45824156 TGCCCAAGACAATGACAAATGGG - Intronic
1180629112 22:17215009-17215031 GCCCCAGTACAAACAGACATGGG + Intronic
1181850734 22:25748224-25748246 TCCCCAGGACAGTCACACAGTGG - Intronic
1182468395 22:30532179-30532201 TCCCATGGACAGACACAAAGAGG - Intronic
1183095970 22:35552541-35552563 CCCCCAGCACACACACAAGTTGG + Exonic
950448231 3:13050388-13050410 TCCCCGGGGCACACACAAGTTGG - Intronic
950994164 3:17477224-17477246 TTCCCAGGATAAACAAAATTTGG + Intronic
951269004 3:20602746-20602768 TCCCCAGCACAAAGACAACAAGG + Intergenic
955020127 3:55112110-55112132 TCCCTAGAACAAACCCAAGTTGG - Intergenic
957900613 3:86483729-86483751 TCCCCCAGACATACACAGATTGG - Intergenic
960166663 3:114410511-114410533 TCTCCAGAACAAAAACAAACAGG + Intronic
960225472 3:115163428-115163450 TCCTCAGGAAGAACATAAATTGG - Intergenic
960708803 3:120506894-120506916 TTGCCGGGACAAACACTAATTGG + Intergenic
961978610 3:131053382-131053404 TCCCTAGGAAAAGCAGAAATTGG + Intronic
962808271 3:138941928-138941950 TACCCAGGACATTCAGAAATTGG + Intergenic
964365859 3:155950283-155950305 TTCCTAGGAAAAACAAAAATAGG + Intergenic
972024764 4:34362814-34362836 TTGCCAGGACAGACACTAATTGG - Intergenic
972362291 4:38338234-38338256 TTCCTAGGACAAACCCAACTTGG - Intergenic
975083104 4:70304090-70304112 CCCCCAGCACAAAAACAAAAAGG + Intergenic
975633247 4:76422356-76422378 TACCCTGGACACACACAAAAAGG + Intergenic
975694646 4:76999736-76999758 TTCCCAGGACCAACAGAGATGGG - Intronic
975835381 4:78417668-78417690 TCCCCAGGACAAATACGCCTTGG + Intronic
977574797 4:98664413-98664435 TCCCCAGGAATAACATAAAATGG + Intergenic
977831319 4:101597062-101597084 TCCCCAAGGCCAAAACAAATGGG + Intronic
981886863 4:149686101-149686123 TCCCCAGGAAAGCCACAAATTGG + Intergenic
982037420 4:151359876-151359898 TCCACAGGACAGACAGGAATGGG + Intergenic
982658444 4:158177565-158177587 TCCCCAGGGCACACACACAAAGG + Intergenic
985769571 5:1800378-1800400 TCACCCGGACACACACAAAAAGG - Intronic
987119132 5:14750044-14750066 TCACTAGGCCAACCACAAATTGG - Intronic
988735616 5:34017630-34017652 CTCAGAGGACAAACACAAATAGG - Intronic
989142199 5:38212614-38212636 TTCCCATGACAAAAACAAATAGG - Intergenic
989158032 5:38363254-38363276 TACCCAGGGCAAACACAACAGGG - Intronic
997776861 5:136616975-136616997 TCCCCAGGACTGACACAGATTGG - Intergenic
999247231 5:150161661-150161683 TCCCCAGGACACAGACACTTAGG - Intergenic
1000132560 5:158313928-158313950 TCCACAGGAGAAAGACAAATGGG + Intergenic
1000425162 5:161081547-161081569 TCCCCATGTGAAAAACAAATGGG - Intergenic
1001261725 5:170235128-170235150 ACCCCAGCAGAAACACAAACTGG - Intronic
1001438125 5:171716308-171716330 TCCTCAGGAAAACCACAACTGGG - Intergenic
1002574356 5:180163604-180163626 TCCCCAGGATAAACCCCACTTGG + Intronic
1003950131 6:11109045-11109067 TCCCCAGGTCAACCCCAATTGGG - Intronic
1005755074 6:28918928-28918950 TGCCCAGGACATACAAAAACAGG + Intronic
1010668670 6:78659628-78659650 TCCTCAGAACCAACACAAATAGG + Intergenic
1011966428 6:93163426-93163448 CACACAGGAAAAACACAAATAGG - Intergenic
1012492211 6:99794820-99794842 TGCCCAGGAGAGACAAAAATGGG + Intergenic
1016170730 6:141012493-141012515 TCCCCAGAACTCACACAAATAGG + Intergenic
1017748118 6:157465478-157465500 TCCCCAGGAACCACACAAAACGG + Intronic
1017999854 6:159569475-159569497 TCCCCAGGTCAATCACACTTAGG + Intergenic
1019991975 7:4698434-4698456 ACCCCAGGACACCCAAAAATGGG + Intronic
1024439262 7:49396847-49396869 CCCAGAGGACAAACACAAGTAGG + Intergenic
1025529097 7:61854434-61854456 GCCCCAGGATAAACACTAAGAGG - Intergenic
1025529118 7:61854701-61854723 GCCCCAGGATAAACACTAAGAGG - Intergenic
1025969429 7:66308475-66308497 TCCCTAGGACTAACAGAGATGGG - Intronic
1031238675 7:119210885-119210907 CCCACAGGACAAACACCAAGTGG - Intergenic
1035220962 7:157406383-157406405 TCCCCAGGCCAAGCACACAAGGG - Intronic
1037260581 8:17002586-17002608 TCCCAAGGACAACCCCAAAGAGG - Intergenic
1045886853 8:107108515-107108537 TTCCCAGGAGTAACAGAAATTGG + Intergenic
1047043011 8:121019490-121019512 TCCCCATGAGAAGAACAAATGGG - Intergenic
1047964206 8:130033695-130033717 TCCCCAGTAAAAACACATTTGGG + Intergenic
1049105316 8:140608991-140609013 TCCCCAGGCCTAACACCCATGGG + Intronic
1050030567 9:1381232-1381254 TCTCCAGGACACAGATAAATAGG - Intergenic
1050836431 9:10085746-10085768 TCCCCAGGTGAAACACAAGTAGG + Intronic
1051715742 9:19981712-19981734 GCACCAGAACAAACACACATAGG - Intergenic
1055370811 9:75596955-75596977 TACCCAGTAGAAACAAAAATAGG + Intergenic
1055429198 9:76226895-76226917 TCCCAAGGAAAAACACATATGGG - Intronic
1057146579 9:92763348-92763370 TCACCAGGACACACTCAAGTGGG + Intronic
1057174592 9:92986806-92986828 TGGCCAGGACAGACACTAATTGG - Intronic
1059400439 9:114066247-114066269 TCCCCAGGACCAACACCTGTAGG - Intronic
1061659176 9:132116956-132116978 GCCCCAGGACACACAGAACTGGG + Intergenic
1062301425 9:135874024-135874046 TCCCCAGGACAAACACAAATTGG - Intronic
1185794093 X:2950049-2950071 TCTCCAGGCCACACTCAAATTGG + Intronic
1186073383 X:5848555-5848577 TCCCCAGCATAGAAACAAATTGG - Intronic
1187009219 X:15263392-15263414 ATCCCAGGACAAACAGAAAGAGG + Intronic
1187455877 X:19440827-19440849 TGCCCAGGAAAAAAAGAAATGGG - Intronic
1188668559 X:32854985-32855007 TCCCTAGGACAAATACCACTTGG - Intronic
1190293344 X:49008000-49008022 TCACCAGGACAGGGACAAATTGG + Intergenic
1192215735 X:69156919-69156941 TCCACAGGACAAACAGAAAATGG + Intergenic
1192544180 X:71999076-71999098 TCCCCAGGTCAGACACAAGGAGG - Intergenic
1193576836 X:83209686-83209708 GCCCCAGTACAAACAAAACTGGG + Intergenic
1193732224 X:85115430-85115452 TTGCCAGGACAGACACTAATTGG - Intergenic
1194716145 X:97289002-97289024 CACCCTGGACAAAAACAAATTGG - Intronic
1199034176 X:143031987-143032009 TCCCCAGGACTTACACCAATTGG - Intronic
1199999227 X:153048851-153048873 CCCCCAGGACAAACACCAAGGGG + Intergenic