ID: 1062303742

View in Genome Browser
Species Human (GRCh38)
Location 9:135890202-135890224
Sequence ATGTGTGTGGAGCATTCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 136}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062303742_1062303747 25 Left 1062303742 9:135890202-135890224 CCTGTGGAATGCTCCACACACAT 0: 1
1: 0
2: 0
3: 11
4: 136
Right 1062303747 9:135890250-135890272 CACACACAATCCACACCTGCAGG No data
1062303742_1062303748 28 Left 1062303742 9:135890202-135890224 CCTGTGGAATGCTCCACACACAT 0: 1
1: 0
2: 0
3: 11
4: 136
Right 1062303748 9:135890253-135890275 ACACAATCCACACCTGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062303742 Original CRISPR ATGTGTGTGGAGCATTCCAC AGG (reversed) Intronic
900610989 1:3544586-3544608 CGGTGTGTGGAGCACTCCCCAGG - Intronic
900646509 1:3711207-3711229 ACGTGTGTGGAGCGCTCCCCAGG - Intronic
900778257 1:4600523-4600545 CAGCGTGTGGAGCATTTCACCGG + Intergenic
900796822 1:4713003-4713025 CTGTGTGTGGTGGATTCCACCGG - Intronic
903918671 1:26783958-26783980 CTGTGTGTGGAGCATTACCTAGG + Intergenic
906145870 1:43560307-43560329 ATGTGTGTGGTGCATACAGCAGG + Intronic
907974186 1:59414868-59414890 ATGGGTGTGGAGCACACCAGAGG - Intronic
909531507 1:76687152-76687174 ATCTGTGTGGAGCAATCCAATGG + Intergenic
912041724 1:105398649-105398671 GTGCATGTGGAGAATTCCACTGG + Intergenic
912693329 1:111821178-111821200 AAATCTGTGGTGCATTCCACAGG - Intronic
915035389 1:152919251-152919273 CTGTGAGTGGTACATTCCACAGG + Intergenic
915925846 1:160018950-160018972 ATGTGTCTGTAGCATTCAAAGGG - Intergenic
920294283 1:204946470-204946492 ATGTGTGTGGGGCATGCTCCGGG - Intronic
1062802830 10:392679-392701 ATGTGTGTTGAAGACTCCACTGG - Intronic
1063976299 10:11418872-11418894 ATGGCTGTGTAGTATTCCACGGG + Intergenic
1067747076 10:48943959-48943981 AGTTGTGTTGATCATTCCACAGG - Intronic
1068038114 10:51786551-51786573 GTGTGTGGGGAGCCTCCCACAGG - Intronic
1069557437 10:69407370-69407392 CTGTGTGTGGAGCAGTTCCCAGG - Intronic
1073198893 10:101718532-101718554 TTGGCTGTGCAGCATTCCACTGG + Intergenic
1073236078 10:102017521-102017543 ATATTTTTGGAGCATTCTACTGG - Intronic
1076777920 10:132708426-132708448 AGGTGTGTGGAACATGCCGCTGG - Intronic
1078016218 11:7617326-7617348 GCGTGTGTGGGGCATTTCACTGG + Intronic
1078405530 11:11067317-11067339 ATGTGTGTAAAGCATTCAGCAGG + Intergenic
1079993011 11:27266393-27266415 ATGTGTGTGGAGCACTGGGCTGG + Intergenic
1081290570 11:41320474-41320496 ATGTCTATGGTGCATTACACTGG + Intronic
1082681465 11:56177035-56177057 AAGTGTGTGGAGCTTGTCACAGG + Exonic
1084848368 11:71918700-71918722 ATCTGTGTGGAGAACTCCAAGGG - Intronic
1087191596 11:95259726-95259748 AAGTGTGTGCATCATTCCCCAGG - Intergenic
1088755667 11:112883227-112883249 TTGTGTGTAGAGCCTTCCCCAGG - Intergenic
1089489910 11:118876356-118876378 AAGTGTGAGGAGCACTCCCCTGG + Intergenic
1089583624 11:119496649-119496671 ATCTGTGTGGAGCAATTCAAGGG + Intergenic
1092071565 12:5635651-5635673 ATGTGTGTTGAACACTCCACAGG - Intronic
1092231807 12:6779961-6779983 ATGTGTGAGTGGCATCCCACTGG + Intergenic
1098620254 12:72588341-72588363 ATCTGAGTAGAGCATTCCAGAGG + Intronic
1104309540 12:127642339-127642361 ATGAGAGTGAAACATTCCACCGG + Intergenic
1105722931 13:23134732-23134754 CTGAGTGGGGAGCATTCCCCTGG + Intergenic
1106558426 13:30829357-30829379 ATGTGTGTGGAGCATGAAAGGGG + Intergenic
1120068511 14:80075114-80075136 ATTGGTGTGGACAATTCCACAGG + Intergenic
1120425148 14:84338278-84338300 TTGTGTGTGGAAAATTGCACAGG + Intergenic
1121002597 14:90463119-90463141 AAGAGTGTGGAGCATTCGAAGGG + Intergenic
1121707850 14:96012775-96012797 ATGTATGTGGAACATTCTCCAGG + Intergenic
1124859762 15:33427681-33427703 ATGTGAGGGGAGCTTTGCACAGG - Intronic
1127821428 15:62659554-62659576 GTGAGTGTGGAGCATTCAATAGG - Intronic
1128762942 15:70230271-70230293 ATGCCTGTGGAGCTTTCCAATGG + Intergenic
1130865418 15:87929512-87929534 ATTTCTGTGGGGCATTCCAGAGG - Intronic
1132283386 15:100640540-100640562 AGGTGTGTAGAGCAATCCAGAGG + Intronic
1132828418 16:1916306-1916328 GTGGGTGTGGAGAATTCCAAGGG - Intronic
1135176761 16:20236701-20236723 GTGTGTGAGGAGCGTTACACTGG + Intergenic
1137690530 16:50423810-50423832 ATGTGTGTGCAGAATTCAATTGG - Intergenic
1141252879 16:82374769-82374791 ATGTTTGTGGAGCACTGCAATGG + Intergenic
1141542584 16:84737504-84737526 ATGTGTGTGTTTTATTCCACAGG - Intronic
1148823583 17:50375941-50375963 ATGTGTTTTAAGCATTCCTCTGG - Exonic
1153530335 18:6039606-6039628 ATGTGTGTGCATAAATCCACTGG - Intronic
1156665223 18:39396733-39396755 ATGTGTGTGGATCATTTTTCTGG - Intergenic
1159413204 18:68108140-68108162 ATGAGTGTGAAGCATTGTACAGG - Intergenic
1159673334 18:71250712-71250734 ATGTGTGTGTATCATTCTAATGG + Intergenic
1160239897 18:77115636-77115658 ATGGGTGTGCAGCATTTTACTGG + Intronic
1162391936 19:10395207-10395229 AGGTGAGTGGAGCTTTCCCCGGG - Exonic
1166378168 19:42340191-42340213 AAATGTGTGGAGCACTTCACTGG - Intronic
1167765013 19:51476353-51476375 ATGGCTGTGTAGTATTCCACTGG - Intergenic
926682401 2:15674012-15674034 AACTGAGTGGAGCATTCCAGAGG + Intergenic
926857517 2:17272929-17272951 ATGTGTGAAGAGCATCTCACAGG + Intergenic
927558734 2:24053928-24053950 ACGTGTGTGGTGCACTACACAGG + Exonic
928159604 2:28909970-28909992 ATATGTGTATATCATTCCACTGG + Intronic
928720885 2:34119510-34119532 CTGTGTGTGCAGCATTCATCCGG - Intergenic
929592931 2:43158673-43158695 ATGTGTGTGGAGCAGCCTCCTGG + Intergenic
931749816 2:65320472-65320494 ATGTCTGGGGAGCTTTGCACTGG - Intronic
935071810 2:99700982-99701004 ATGAGTGTGGAGTGTTCCCCGGG - Intronic
935863772 2:107362955-107362977 ATGTTTGTGATGAATTCCACTGG + Intergenic
936110054 2:109657680-109657702 ATGCCTGTGGAGCTTTCCATCGG - Intergenic
939282271 2:140079583-140079605 ATGTGTGTGGAGCTTCCCAAAGG - Intergenic
943280102 2:185921266-185921288 ATGTGCCTGGAGCATTCTCCAGG - Intergenic
945889633 2:215414872-215414894 ATGGCTGTGGTGCATTCCACTGG + Exonic
1169490411 20:6066755-6066777 ATGTGTGTGGACCTTTGCAATGG - Intergenic
1176002017 20:62836458-62836480 ATGTGTGGGGTGAATTCCAGGGG + Exonic
1178350093 21:31866739-31866761 ATTTGTGTTGAGCACTCCCCAGG + Intergenic
1179493561 21:41757099-41757121 ACGTGTGTGAATAATTCCACAGG + Intronic
1182620184 22:31614578-31614600 ATGTGGGTGAAGCAGTCCCCTGG + Intronic
1184372388 22:44090692-44090714 CTATGTGTGGAGGATTACACAGG - Intronic
949311999 3:2710267-2710289 ATGTGTGTAAAGCACTTCACAGG + Intronic
951539789 3:23771408-23771430 ATGAGTGTAGAATATTCCACTGG + Intergenic
953703216 3:45212449-45212471 CTGTTTCTGGATCATTCCACTGG + Intergenic
953897089 3:46811195-46811217 ATGTGCGTGGAGTAATTCACAGG + Intronic
954413055 3:50379550-50379572 AGGTGTGTGAAGCATGACACAGG + Exonic
954635660 3:52069471-52069493 ATGTGTGGGGAGCACTCCTGTGG + Intergenic
956490978 3:69771820-69771842 ATGTGTGTAGAGAATTGGACTGG + Intronic
956791985 3:72686950-72686972 ATGTGTGTGCAGGGTTCCATAGG - Intergenic
961611822 3:128145578-128145600 GTGTGTGTGCAGGATTTCACAGG + Intronic
962932852 3:140053540-140053562 ATGTGTGTGGAGGACTGCCCAGG + Intronic
963566227 3:146934518-146934540 CTGTGTGAGGAGGACTCCACCGG - Intergenic
965486071 3:169280130-169280152 ATGTCTGTGGAACATGCCACGGG + Intronic
965739332 3:171857031-171857053 CTTTGTGTGGAGCATTCATCGGG + Intronic
969442397 4:7225160-7225182 ATGTGTGTGCAGCACAGCACGGG - Intronic
969530141 4:7725985-7726007 ACATGTGTGGAGCATTCAGCTGG - Intronic
971840037 4:31839110-31839132 AGGTGTGTGGATCATGCCATGGG - Intergenic
974070532 4:57119382-57119404 ATGTTTGTGGAGAATACAACAGG - Intergenic
978377614 4:108092347-108092369 ATGTGTGAGCAGAATTCCAAGGG + Intronic
980063913 4:128161292-128161314 AAATGTGTGGAGCATTACAGAGG - Intronic
980941408 4:139278978-139279000 ATGTGCGCGGAGAATTCCATGGG - Intronic
983511429 4:168613113-168613135 ATGTGTGTGATGCATTGCAAAGG - Intronic
989213645 5:38881656-38881678 AAGTGTGTGGCACATTCCAAAGG - Exonic
997397456 5:133575270-133575292 ATGTGTGTTGAGCATTTCCTTGG - Intronic
998099350 5:139419241-139419263 ATGTGTGTGTAGAATTCAAGTGG + Intronic
999956422 5:156707928-156707950 AAGTGTGGAGAGCATACCACTGG + Intronic
999998271 5:157113106-157113128 CTGAATGTGGAGCATTTCACAGG - Intronic
1009549345 6:65067166-65067188 ATGTATGTGGAGAATTCAATTGG + Intronic
1010291043 6:74138279-74138301 ATGTGTGTAGAGCAGATCACAGG + Intergenic
1011091443 6:83606151-83606173 ATCTATGTGCAGCATTCTACAGG + Intronic
1012386629 6:98690342-98690364 GTGTGTGTTTAGCATCCCACAGG + Intergenic
1012830229 6:104195304-104195326 ATGAGTGTGCACCCTTCCACTGG + Intergenic
1013616808 6:111850970-111850992 TTGTGTGTGGAGCAAGACACAGG - Intronic
1013674129 6:112438157-112438179 ATGTTCGTGGAGCATCTCACTGG - Intergenic
1014148100 6:118021644-118021666 TTGTGTGTGCAGAATTCCATGGG - Intronic
1014741660 6:125154215-125154237 AAGAGGGTAGAGCATTCCACGGG - Intronic
1017643110 6:156513407-156513429 CTGTGTTTGGAGGACTCCACTGG - Intergenic
1018808781 6:167282219-167282241 ATGTGTCTGTATCATTCCAGGGG + Intronic
1020829570 7:13077273-13077295 ATGTGTAGGAAGCATTGCACAGG + Intergenic
1021288829 7:18818026-18818048 ATGTGTGTGAACTATTTCACTGG - Intronic
1023254266 7:38297669-38297691 ATTTGTTTGGATCATTACACAGG + Intergenic
1024011623 7:45271727-45271749 ATGTGAGTGGAGCCTGGCACAGG + Intergenic
1024088103 7:45913534-45913556 ACATGTGGTGAGCATTCCACGGG + Intronic
1028488270 7:91383756-91383778 CTGTTTGTGGAGCCTCCCACTGG + Intergenic
1030919776 7:115368079-115368101 GTTTATGTGGAACATTCCACAGG + Intergenic
1031116355 7:117673166-117673188 ATGGGGGTGGAGCAGGCCACGGG - Intronic
1035589485 8:802091-802113 AGGTGTGTGGACCATTCCCCAGG - Intergenic
1035815776 8:2538539-2538561 CTGTGTGTGCAGCATCCCACTGG + Intergenic
1037971644 8:23176326-23176348 ATTTGGGTGGAGCATGACACTGG + Intergenic
1038466798 8:27772191-27772213 AGGTGTGTGGAGGAGCCCACAGG + Intronic
1039200754 8:35091066-35091088 ATGTGTGTGGAGACTTCTAAAGG - Intergenic
1039305082 8:36252648-36252670 CAGTGTGTTGAGCATTCGACAGG + Intergenic
1044141633 8:88661108-88661130 ATGTGTGTGTAGATTACCACTGG + Intergenic
1044545444 8:93454216-93454238 ATGTGTTTGAAGGATTCCCCAGG - Intergenic
1046434677 8:114171816-114171838 ATGTGTGTGGGACATTCTCCAGG + Intergenic
1049932350 9:469669-469691 ATGTGTGCAGTGCATTCCCCTGG + Intergenic
1050227190 9:3473144-3473166 ATGTGTGGAGATAATTCCACAGG - Intronic
1057515318 9:95715516-95715538 AAGAGTGTGGAGGATGCCACAGG - Intergenic
1057586119 9:96330292-96330314 ATATGTGTGGGGGTTTCCACAGG - Intronic
1057992194 9:99782022-99782044 ATGTGTGTTGAGACTTCAACAGG + Intergenic
1060465538 9:123901508-123901530 AAGTGTGAGGAGCTTTCCAGGGG - Intronic
1062303742 9:135890202-135890224 ATGTGTGTGGAGCATTCCACAGG - Intronic
1189942377 X:46138019-46138041 ATGTTTGTGCAGTGTTCCACAGG - Intergenic
1190973826 X:55379724-55379746 ATGTGTGTAGAACATGCCAGTGG - Intergenic
1191167943 X:57411396-57411418 ATGTGTGGGGTGCTTTCCACTGG + Intronic
1194732551 X:97473094-97473116 AAGTGTGTGGGGCATCCCATAGG - Intronic
1196428875 X:115601131-115601153 ATGGGTGAAGAGCATTCCACTGG + Intronic
1198378657 X:136063871-136063893 ATGTGTCTGAGGCATTCCATGGG + Intergenic
1199601095 X:149541496-149541518 CTGTGTGTGGAGCAGTACACGGG - Exonic
1202191159 Y:22247329-22247351 ATGAGGGTGGAGCATTGGACAGG - Intergenic