ID: 1062305916

View in Genome Browser
Species Human (GRCh38)
Location 9:135907186-135907208
Sequence GCGGCGCCTTTGTTGCGGCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 35}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062305916_1062305923 1 Left 1062305916 9:135907186-135907208 CCCGGCCGCAACAAAGGCGCCGC 0: 1
1: 0
2: 0
3: 5
4: 35
Right 1062305923 9:135907210-135907232 GCCCCTCGCCGCGCCGGGCCCGG 0: 1
1: 0
2: 5
3: 59
4: 473
1062305916_1062305921 -4 Left 1062305916 9:135907186-135907208 CCCGGCCGCAACAAAGGCGCCGC 0: 1
1: 0
2: 0
3: 5
4: 35
Right 1062305921 9:135907205-135907227 CCGCCGCCCCTCGCCGCGCCGGG 0: 1
1: 0
2: 7
3: 71
4: 552
1062305916_1062305919 -5 Left 1062305916 9:135907186-135907208 CCCGGCCGCAACAAAGGCGCCGC 0: 1
1: 0
2: 0
3: 5
4: 35
Right 1062305919 9:135907204-135907226 GCCGCCGCCCCTCGCCGCGCCGG 0: 1
1: 0
2: 4
3: 50
4: 362
1062305916_1062305931 23 Left 1062305916 9:135907186-135907208 CCCGGCCGCAACAAAGGCGCCGC 0: 1
1: 0
2: 0
3: 5
4: 35
Right 1062305931 9:135907232-135907254 GTGCGCCCCGAGCCACCACTCGG 0: 1
1: 0
2: 0
3: 5
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062305916 Original CRISPR GCGGCGCCTTTGTTGCGGCC GGG (reversed) Exonic
901017854 1:6242089-6242111 GTGGCCCCTTTATGGCGGCCCGG + Intergenic
906180312 1:43812271-43812293 GCGGGGCCTGCGTTGCTGCCTGG + Intronic
1065844703 10:29735497-29735519 GCCGCGCCTTTGTTACGGCTCGG + Intronic
1077779893 11:5315662-5315684 GCGGCTCCTTTTTTGCTGCCTGG - Intronic
1117424522 14:55580527-55580549 GCGGGGCTCTTGTTGGGGCCGGG + Intronic
1123153350 14:106203122-106203144 CAGGCTCCTCTGTTGCGGCCAGG + Intergenic
1124648135 15:31454229-31454251 GCGGCGGGTGTGTTTCGGCCTGG - Intergenic
1129761388 15:78131127-78131149 GCGGGGCCTGTGTTGGGGGCCGG + Intronic
1131220988 15:90583971-90583993 GCAGCCCCTTTGTTGTGGACAGG + Intronic
1142259249 16:89034915-89034937 GCAGGGCCTGTGTTGAGGCCGGG + Intergenic
1142656872 17:1400192-1400214 GCGCCGCCATTTTTGCTGCCCGG - Exonic
1152758741 17:82097789-82097811 GCGGCGCCTTTGTGGGCGCGGGG + Intronic
1160453312 18:78979680-78979702 CCGGCGCCTTTGTCTCGCCCGGG - Intergenic
1161474573 19:4477134-4477156 GCCTCTCCTTTGTTTCGGCCTGG + Intronic
1164512865 19:28911799-28911821 GCTGCGCATTTGTTGCGGTCTGG - Intergenic
1166100292 19:40567756-40567778 GCGGCGCCCCTGCTGCGGCCAGG + Exonic
1166714070 19:44955427-44955449 GCAGCGCCGTGGTGGCGGCCGGG + Exonic
927256378 2:21043962-21043984 GCGGCTCCTGGGCTGCGGCCTGG + Exonic
927863295 2:26573740-26573762 GCGGCGCCTCTGTGGCATCCAGG + Intronic
933279971 2:80322623-80322645 GCGGCGGCTGGGCTGCGGCCGGG - Intronic
941177852 2:162221300-162221322 GCGGCGGATTTCTTGAGGCCAGG + Intronic
948767692 2:240231979-240232001 GAGTCGGCTTTGTTGGGGCCAGG + Intergenic
960577077 3:119240589-119240611 GCGCCGCCTCTGCTGCGGGCCGG - Exonic
966787728 3:183636048-183636070 GCGGCGCGGCTGGTGCGGCCTGG + Intronic
977990108 4:103431492-103431514 GCTGTGCCTTTGTAGCTGCCTGG - Intergenic
981093439 4:140756208-140756230 GCTGGGGCTTTGTTGTGGCCCGG - Intergenic
1002707275 5:181170309-181170331 GCAGCGCCTTTCTTACGGGCGGG - Intergenic
1002929538 6:1624015-1624037 GCGGCCCCGCTCTTGCGGCCGGG + Exonic
1003552363 6:7109565-7109587 GCGGCGCCTGTCAAGCGGCCCGG - Intronic
1021360705 7:19708846-19708868 GATGTGCCTTTGGTGCGGCCCGG + Exonic
1023737714 7:43249157-43249179 GCGGAGCCTTGGCTGCGGCCCGG + Intronic
1029110874 7:98212447-98212469 CCGGAGCCCTTGCTGCGGCCCGG - Exonic
1033477196 7:141702218-141702240 GCGGCGGCGTTGGCGCGGCCAGG - Intergenic
1034470336 7:151251507-151251529 GCGGCGCCAGTGTGGGGGCCCGG + Intronic
1055514728 9:77023210-77023232 GCGGCGCCTCCGCTGGGGCCTGG + Intergenic
1062305916 9:135907186-135907208 GCGGCGCCTTTGTTGCGGCCGGG - Exonic
1062717084 9:138016489-138016511 GAGGCGCCTGGGTTGCAGCCTGG + Intronic
1190053432 X:47168895-47168917 GGGGCACCTTGGTTGTGGCCTGG - Intronic
1195679883 X:107537096-107537118 ATGGCCCCTTTGCTGCGGCCAGG + Intronic
1201764849 Y:17566877-17566899 GCAGCCCCTGTGTTGGGGCCGGG - Intergenic
1201836703 Y:18339112-18339134 GCAGCCCCTGTGTTGGGGCCGGG + Intergenic