ID: 1062305916

View in Genome Browser
Species Human (GRCh38)
Location 9:135907186-135907208
Sequence GCGGCGCCTTTGTTGCGGCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 35}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062305916_1062305931 23 Left 1062305916 9:135907186-135907208 CCCGGCCGCAACAAAGGCGCCGC 0: 1
1: 0
2: 0
3: 5
4: 35
Right 1062305931 9:135907232-135907254 GTGCGCCCCGAGCCACCACTCGG 0: 1
1: 0
2: 0
3: 5
4: 62
1062305916_1062305923 1 Left 1062305916 9:135907186-135907208 CCCGGCCGCAACAAAGGCGCCGC 0: 1
1: 0
2: 0
3: 5
4: 35
Right 1062305923 9:135907210-135907232 GCCCCTCGCCGCGCCGGGCCCGG 0: 1
1: 0
2: 5
3: 59
4: 473
1062305916_1062305921 -4 Left 1062305916 9:135907186-135907208 CCCGGCCGCAACAAAGGCGCCGC 0: 1
1: 0
2: 0
3: 5
4: 35
Right 1062305921 9:135907205-135907227 CCGCCGCCCCTCGCCGCGCCGGG 0: 1
1: 0
2: 7
3: 71
4: 552
1062305916_1062305919 -5 Left 1062305916 9:135907186-135907208 CCCGGCCGCAACAAAGGCGCCGC 0: 1
1: 0
2: 0
3: 5
4: 35
Right 1062305919 9:135907204-135907226 GCCGCCGCCCCTCGCCGCGCCGG 0: 1
1: 0
2: 4
3: 50
4: 362

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062305916 Original CRISPR GCGGCGCCTTTGTTGCGGCC GGG (reversed) Exonic