ID: 1062305921

View in Genome Browser
Species Human (GRCh38)
Location 9:135907205-135907227
Sequence CCGCCGCCCCTCGCCGCGCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 631
Summary {0: 1, 1: 0, 2: 7, 3: 71, 4: 552}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062305916_1062305921 -4 Left 1062305916 9:135907186-135907208 CCCGGCCGCAACAAAGGCGCCGC 0: 1
1: 0
2: 0
3: 5
4: 35
Right 1062305921 9:135907205-135907227 CCGCCGCCCCTCGCCGCGCCGGG 0: 1
1: 0
2: 7
3: 71
4: 552
1062305910_1062305921 26 Left 1062305910 9:135907156-135907178 CCATCTGCAGACAAAGGGCTGAG 0: 1
1: 0
2: 0
3: 31
4: 340
Right 1062305921 9:135907205-135907227 CCGCCGCCCCTCGCCGCGCCGGG 0: 1
1: 0
2: 7
3: 71
4: 552
1062305918_1062305921 -9 Left 1062305918 9:135907191-135907213 CCGCAACAAAGGCGCCGCCGCCC 0: 1
1: 0
2: 2
3: 6
4: 77
Right 1062305921 9:135907205-135907227 CCGCCGCCCCTCGCCGCGCCGGG 0: 1
1: 0
2: 7
3: 71
4: 552
1062305917_1062305921 -5 Left 1062305917 9:135907187-135907209 CCGGCCGCAACAAAGGCGCCGCC 0: 1
1: 0
2: 1
3: 2
4: 44
Right 1062305921 9:135907205-135907227 CCGCCGCCCCTCGCCGCGCCGGG 0: 1
1: 0
2: 7
3: 71
4: 552
1062305909_1062305921 29 Left 1062305909 9:135907153-135907175 CCACCATCTGCAGACAAAGGGCT 0: 1
1: 0
2: 0
3: 9
4: 170
Right 1062305921 9:135907205-135907227 CCGCCGCCCCTCGCCGCGCCGGG 0: 1
1: 0
2: 7
3: 71
4: 552

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062305921 Original CRISPR CCGCCGCCCCTCGCCGCGCC GGG Exonic