ID: 1062305923

View in Genome Browser
Species Human (GRCh38)
Location 9:135907210-135907232
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 538
Summary {0: 1, 1: 0, 2: 5, 3: 59, 4: 473}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062305918_1062305923 -4 Left 1062305918 9:135907191-135907213 CCGCAACAAAGGCGCCGCCGCCC 0: 1
1: 0
2: 2
3: 6
4: 77
Right 1062305923 9:135907210-135907232 GCCCCTCGCCGCGCCGGGCCCGG 0: 1
1: 0
2: 5
3: 59
4: 473
1062305917_1062305923 0 Left 1062305917 9:135907187-135907209 CCGGCCGCAACAAAGGCGCCGCC 0: 1
1: 0
2: 1
3: 2
4: 44
Right 1062305923 9:135907210-135907232 GCCCCTCGCCGCGCCGGGCCCGG 0: 1
1: 0
2: 5
3: 59
4: 473
1062305916_1062305923 1 Left 1062305916 9:135907186-135907208 CCCGGCCGCAACAAAGGCGCCGC 0: 1
1: 0
2: 0
3: 5
4: 35
Right 1062305923 9:135907210-135907232 GCCCCTCGCCGCGCCGGGCCCGG 0: 1
1: 0
2: 5
3: 59
4: 473

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type