ID: 1062305931

View in Genome Browser
Species Human (GRCh38)
Location 9:135907232-135907254
Sequence GTGCGCCCCGAGCCACCACT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 62}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062305927_1062305931 -9 Left 1062305927 9:135907218-135907240 CCGCGCCGGGCCCGGTGCGCCCC 0: 1
1: 0
2: 1
3: 49
4: 421
Right 1062305931 9:135907232-135907254 GTGCGCCCCGAGCCACCACTCGG 0: 1
1: 0
2: 0
3: 5
4: 62
1062305920_1062305931 4 Left 1062305920 9:135907205-135907227 CCGCCGCCCCTCGCCGCGCCGGG 0: 1
1: 0
2: 9
3: 80
4: 607
Right 1062305931 9:135907232-135907254 GTGCGCCCCGAGCCACCACTCGG 0: 1
1: 0
2: 0
3: 5
4: 62
1062305922_1062305931 1 Left 1062305922 9:135907208-135907230 CCGCCCCTCGCCGCGCCGGGCCC 0: 1
1: 0
2: 9
3: 108
4: 818
Right 1062305931 9:135907232-135907254 GTGCGCCCCGAGCCACCACTCGG 0: 1
1: 0
2: 0
3: 5
4: 62
1062305926_1062305931 -4 Left 1062305926 9:135907213-135907235 CCTCGCCGCGCCGGGCCCGGTGC 0: 1
1: 0
2: 3
3: 64
4: 414
Right 1062305931 9:135907232-135907254 GTGCGCCCCGAGCCACCACTCGG 0: 1
1: 0
2: 0
3: 5
4: 62
1062305925_1062305931 -3 Left 1062305925 9:135907212-135907234 CCCTCGCCGCGCCGGGCCCGGTG 0: 1
1: 0
2: 3
3: 13
4: 217
Right 1062305931 9:135907232-135907254 GTGCGCCCCGAGCCACCACTCGG 0: 1
1: 0
2: 0
3: 5
4: 62
1062305924_1062305931 -2 Left 1062305924 9:135907211-135907233 CCCCTCGCCGCGCCGGGCCCGGT 0: 1
1: 0
2: 1
3: 17
4: 199
Right 1062305931 9:135907232-135907254 GTGCGCCCCGAGCCACCACTCGG 0: 1
1: 0
2: 0
3: 5
4: 62
1062305917_1062305931 22 Left 1062305917 9:135907187-135907209 CCGGCCGCAACAAAGGCGCCGCC 0: 1
1: 0
2: 1
3: 2
4: 44
Right 1062305931 9:135907232-135907254 GTGCGCCCCGAGCCACCACTCGG 0: 1
1: 0
2: 0
3: 5
4: 62
1062305916_1062305931 23 Left 1062305916 9:135907186-135907208 CCCGGCCGCAACAAAGGCGCCGC 0: 1
1: 0
2: 0
3: 5
4: 35
Right 1062305931 9:135907232-135907254 GTGCGCCCCGAGCCACCACTCGG 0: 1
1: 0
2: 0
3: 5
4: 62
1062305918_1062305931 18 Left 1062305918 9:135907191-135907213 CCGCAACAAAGGCGCCGCCGCCC 0: 1
1: 0
2: 2
3: 6
4: 77
Right 1062305931 9:135907232-135907254 GTGCGCCCCGAGCCACCACTCGG 0: 1
1: 0
2: 0
3: 5
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062305931 Original CRISPR GTGCGCCCCGAGCCACCACT CGG Intergenic