ID: 1062306229

View in Genome Browser
Species Human (GRCh38)
Location 9:135908193-135908215
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062306229_1062306240 13 Left 1062306229 9:135908193-135908215 CCCCGCCGGCGCATCCCCCGGAA No data
Right 1062306240 9:135908229-135908251 CGTTCCCCTGGAGCCTGCGTCGG No data
1062306229_1062306239 1 Left 1062306229 9:135908193-135908215 CCCCGCCGGCGCATCCCCCGGAA No data
Right 1062306239 9:135908217-135908239 GGACGCTGACTTCGTTCCCCTGG No data
1062306229_1062306242 15 Left 1062306229 9:135908193-135908215 CCCCGCCGGCGCATCCCCCGGAA No data
Right 1062306242 9:135908231-135908253 TTCCCCTGGAGCCTGCGTCGGGG No data
1062306229_1062306248 26 Left 1062306229 9:135908193-135908215 CCCCGCCGGCGCATCCCCCGGAA No data
Right 1062306248 9:135908242-135908264 CCTGCGTCGGGGCCCGCGCTGGG No data
1062306229_1062306246 25 Left 1062306229 9:135908193-135908215 CCCCGCCGGCGCATCCCCCGGAA No data
Right 1062306246 9:135908241-135908263 GCCTGCGTCGGGGCCCGCGCTGG No data
1062306229_1062306241 14 Left 1062306229 9:135908193-135908215 CCCCGCCGGCGCATCCCCCGGAA No data
Right 1062306241 9:135908230-135908252 GTTCCCCTGGAGCCTGCGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062306229 Original CRISPR TTCCGGGGGATGCGCCGGCG GGG (reversed) Intergenic
No off target data available for this crispr