ID: 1062306235

View in Genome Browser
Species Human (GRCh38)
Location 9:135908207-135908229
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062306235_1062306241 0 Left 1062306235 9:135908207-135908229 CCCCCGGAAGGGACGCTGACTTC No data
Right 1062306241 9:135908230-135908252 GTTCCCCTGGAGCCTGCGTCGGG No data
1062306235_1062306251 25 Left 1062306235 9:135908207-135908229 CCCCCGGAAGGGACGCTGACTTC No data
Right 1062306251 9:135908255-135908277 CCGCGCTGGGCTGAGAATTACGG No data
1062306235_1062306252 26 Left 1062306235 9:135908207-135908229 CCCCCGGAAGGGACGCTGACTTC No data
Right 1062306252 9:135908256-135908278 CGCGCTGGGCTGAGAATTACGGG No data
1062306235_1062306248 12 Left 1062306235 9:135908207-135908229 CCCCCGGAAGGGACGCTGACTTC No data
Right 1062306248 9:135908242-135908264 CCTGCGTCGGGGCCCGCGCTGGG No data
1062306235_1062306242 1 Left 1062306235 9:135908207-135908229 CCCCCGGAAGGGACGCTGACTTC No data
Right 1062306242 9:135908231-135908253 TTCCCCTGGAGCCTGCGTCGGGG No data
1062306235_1062306240 -1 Left 1062306235 9:135908207-135908229 CCCCCGGAAGGGACGCTGACTTC No data
Right 1062306240 9:135908229-135908251 CGTTCCCCTGGAGCCTGCGTCGG No data
1062306235_1062306246 11 Left 1062306235 9:135908207-135908229 CCCCCGGAAGGGACGCTGACTTC No data
Right 1062306246 9:135908241-135908263 GCCTGCGTCGGGGCCCGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062306235 Original CRISPR GAAGTCAGCGTCCCTTCCGG GGG (reversed) Intergenic