ID: 1062306237

View in Genome Browser
Species Human (GRCh38)
Location 9:135908209-135908231
Sequence ACGAAGTCAGCGTCCCTTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062306237_1062306251 23 Left 1062306237 9:135908209-135908231 CCCGGAAGGGACGCTGACTTCGT No data
Right 1062306251 9:135908255-135908277 CCGCGCTGGGCTGAGAATTACGG No data
1062306237_1062306242 -1 Left 1062306237 9:135908209-135908231 CCCGGAAGGGACGCTGACTTCGT No data
Right 1062306242 9:135908231-135908253 TTCCCCTGGAGCCTGCGTCGGGG No data
1062306237_1062306252 24 Left 1062306237 9:135908209-135908231 CCCGGAAGGGACGCTGACTTCGT No data
Right 1062306252 9:135908256-135908278 CGCGCTGGGCTGAGAATTACGGG No data
1062306237_1062306248 10 Left 1062306237 9:135908209-135908231 CCCGGAAGGGACGCTGACTTCGT No data
Right 1062306248 9:135908242-135908264 CCTGCGTCGGGGCCCGCGCTGGG No data
1062306237_1062306241 -2 Left 1062306237 9:135908209-135908231 CCCGGAAGGGACGCTGACTTCGT No data
Right 1062306241 9:135908230-135908252 GTTCCCCTGGAGCCTGCGTCGGG No data
1062306237_1062306240 -3 Left 1062306237 9:135908209-135908231 CCCGGAAGGGACGCTGACTTCGT No data
Right 1062306240 9:135908229-135908251 CGTTCCCCTGGAGCCTGCGTCGG No data
1062306237_1062306246 9 Left 1062306237 9:135908209-135908231 CCCGGAAGGGACGCTGACTTCGT No data
Right 1062306246 9:135908241-135908263 GCCTGCGTCGGGGCCCGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062306237 Original CRISPR ACGAAGTCAGCGTCCCTTCC GGG (reversed) Intergenic