ID: 1062306239

View in Genome Browser
Species Human (GRCh38)
Location 9:135908217-135908239
Sequence GGACGCTGACTTCGTTCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062306223_1062306239 25 Left 1062306223 9:135908169-135908191 CCCCTGAGGCAGAAACAGGTGCG No data
Right 1062306239 9:135908217-135908239 GGACGCTGACTTCGTTCCCCTGG No data
1062306229_1062306239 1 Left 1062306229 9:135908193-135908215 CCCCGCCGGCGCATCCCCCGGAA No data
Right 1062306239 9:135908217-135908239 GGACGCTGACTTCGTTCCCCTGG No data
1062306226_1062306239 23 Left 1062306226 9:135908171-135908193 CCTGAGGCAGAAACAGGTGCGGC No data
Right 1062306239 9:135908217-135908239 GGACGCTGACTTCGTTCCCCTGG No data
1062306230_1062306239 0 Left 1062306230 9:135908194-135908216 CCCGCCGGCGCATCCCCCGGAAG No data
Right 1062306239 9:135908217-135908239 GGACGCTGACTTCGTTCCCCTGG No data
1062306234_1062306239 -4 Left 1062306234 9:135908198-135908220 CCGGCGCATCCCCCGGAAGGGAC No data
Right 1062306239 9:135908217-135908239 GGACGCTGACTTCGTTCCCCTGG No data
1062306224_1062306239 24 Left 1062306224 9:135908170-135908192 CCCTGAGGCAGAAACAGGTGCGG No data
Right 1062306239 9:135908217-135908239 GGACGCTGACTTCGTTCCCCTGG No data
1062306231_1062306239 -1 Left 1062306231 9:135908195-135908217 CCGCCGGCGCATCCCCCGGAAGG No data
Right 1062306239 9:135908217-135908239 GGACGCTGACTTCGTTCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062306239 Original CRISPR GGACGCTGACTTCGTTCCCC TGG Intergenic
No off target data available for this crispr