ID: 1062306245

View in Genome Browser
Species Human (GRCh38)
Location 9:135908235-135908257
Sequence CGGGCCCCGACGCAGGCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062306245_1062306252 -2 Left 1062306245 9:135908235-135908257 CCTGGAGCCTGCGTCGGGGCCCG No data
Right 1062306252 9:135908256-135908278 CGCGCTGGGCTGAGAATTACGGG No data
1062306245_1062306251 -3 Left 1062306245 9:135908235-135908257 CCTGGAGCCTGCGTCGGGGCCCG No data
Right 1062306251 9:135908255-135908277 CCGCGCTGGGCTGAGAATTACGG No data
1062306245_1062306254 25 Left 1062306245 9:135908235-135908257 CCTGGAGCCTGCGTCGGGGCCCG No data
Right 1062306254 9:135908283-135908305 CCGTGAGAGTTTGCATTCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062306245 Original CRISPR CGGGCCCCGACGCAGGCTCC AGG (reversed) Intergenic