ID: 1062306246

View in Genome Browser
Species Human (GRCh38)
Location 9:135908241-135908263
Sequence GCCTGCGTCGGGGCCCGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062306238_1062306246 8 Left 1062306238 9:135908210-135908232 CCGGAAGGGACGCTGACTTCGTT No data
Right 1062306246 9:135908241-135908263 GCCTGCGTCGGGGCCCGCGCTGG No data
1062306235_1062306246 11 Left 1062306235 9:135908207-135908229 CCCCCGGAAGGGACGCTGACTTC No data
Right 1062306246 9:135908241-135908263 GCCTGCGTCGGGGCCCGCGCTGG No data
1062306234_1062306246 20 Left 1062306234 9:135908198-135908220 CCGGCGCATCCCCCGGAAGGGAC No data
Right 1062306246 9:135908241-135908263 GCCTGCGTCGGGGCCCGCGCTGG No data
1062306230_1062306246 24 Left 1062306230 9:135908194-135908216 CCCGCCGGCGCATCCCCCGGAAG No data
Right 1062306246 9:135908241-135908263 GCCTGCGTCGGGGCCCGCGCTGG No data
1062306231_1062306246 23 Left 1062306231 9:135908195-135908217 CCGCCGGCGCATCCCCCGGAAGG No data
Right 1062306246 9:135908241-135908263 GCCTGCGTCGGGGCCCGCGCTGG No data
1062306229_1062306246 25 Left 1062306229 9:135908193-135908215 CCCCGCCGGCGCATCCCCCGGAA No data
Right 1062306246 9:135908241-135908263 GCCTGCGTCGGGGCCCGCGCTGG No data
1062306237_1062306246 9 Left 1062306237 9:135908209-135908231 CCCGGAAGGGACGCTGACTTCGT No data
Right 1062306246 9:135908241-135908263 GCCTGCGTCGGGGCCCGCGCTGG No data
1062306236_1062306246 10 Left 1062306236 9:135908208-135908230 CCCCGGAAGGGACGCTGACTTCG No data
Right 1062306246 9:135908241-135908263 GCCTGCGTCGGGGCCCGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062306246 Original CRISPR GCCTGCGTCGGGGCCCGCGC TGG Intergenic
No off target data available for this crispr