ID: 1062306247

View in Genome Browser
Species Human (GRCh38)
Location 9:135908242-135908264
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062306247_1062306252 -9 Left 1062306247 9:135908242-135908264 CCTGCGTCGGGGCCCGCGCTGGG No data
Right 1062306252 9:135908256-135908278 CGCGCTGGGCTGAGAATTACGGG No data
1062306247_1062306254 18 Left 1062306247 9:135908242-135908264 CCTGCGTCGGGGCCCGCGCTGGG No data
Right 1062306254 9:135908283-135908305 CCGTGAGAGTTTGCATTCCGAGG No data
1062306247_1062306255 24 Left 1062306247 9:135908242-135908264 CCTGCGTCGGGGCCCGCGCTGGG No data
Right 1062306255 9:135908289-135908311 GAGTTTGCATTCCGAGGATTTGG No data
1062306247_1062306251 -10 Left 1062306247 9:135908242-135908264 CCTGCGTCGGGGCCCGCGCTGGG No data
Right 1062306251 9:135908255-135908277 CCGCGCTGGGCTGAGAATTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062306247 Original CRISPR CCCAGCGCGGGCCCCGACGC AGG (reversed) Intergenic