ID: 1062306249 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:135908254-135908276 |
Sequence | CGTAATTCTCAGCCCAGCGC GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 55 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 3, 4: 51} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1062306249_1062306254 | 6 | Left | 1062306249 | 9:135908254-135908276 | CCCGCGCTGGGCTGAGAATTACG | 0: 1 1: 0 2: 0 3: 3 4: 51 |
||
Right | 1062306254 | 9:135908283-135908305 | CCGTGAGAGTTTGCATTCCGAGG | No data | ||||
1062306249_1062306255 | 12 | Left | 1062306249 | 9:135908254-135908276 | CCCGCGCTGGGCTGAGAATTACG | 0: 1 1: 0 2: 0 3: 3 4: 51 |
||
Right | 1062306255 | 9:135908289-135908311 | GAGTTTGCATTCCGAGGATTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1062306249 | Original CRISPR | CGTAATTCTCAGCCCAGCGC GGG (reversed) | Intergenic | ||