ID: 1062306250 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:135908255-135908277 |
Sequence | CCGTAATTCTCAGCCCAGCG CGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1062306250_1062306255 | 11 | Left | 1062306250 | 9:135908255-135908277 | CCGCGCTGGGCTGAGAATTACGG | No data | ||
Right | 1062306255 | 9:135908289-135908311 | GAGTTTGCATTCCGAGGATTTGG | No data | ||||
1062306250_1062306254 | 5 | Left | 1062306250 | 9:135908255-135908277 | CCGCGCTGGGCTGAGAATTACGG | No data | ||
Right | 1062306254 | 9:135908283-135908305 | CCGTGAGAGTTTGCATTCCGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1062306250 | Original CRISPR | CCGTAATTCTCAGCCCAGCG CGG (reversed) | Intergenic | ||