ID: 1062306250

View in Genome Browser
Species Human (GRCh38)
Location 9:135908255-135908277
Sequence CCGTAATTCTCAGCCCAGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062306250_1062306255 11 Left 1062306250 9:135908255-135908277 CCGCGCTGGGCTGAGAATTACGG No data
Right 1062306255 9:135908289-135908311 GAGTTTGCATTCCGAGGATTTGG No data
1062306250_1062306254 5 Left 1062306250 9:135908255-135908277 CCGCGCTGGGCTGAGAATTACGG No data
Right 1062306254 9:135908283-135908305 CCGTGAGAGTTTGCATTCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062306250 Original CRISPR CCGTAATTCTCAGCCCAGCG CGG (reversed) Intergenic