ID: 1062306252

View in Genome Browser
Species Human (GRCh38)
Location 9:135908256-135908278
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062306237_1062306252 24 Left 1062306237 9:135908209-135908231 CCCGGAAGGGACGCTGACTTCGT No data
Right 1062306252 9:135908256-135908278 CGCGCTGGGCTGAGAATTACGGG No data
1062306235_1062306252 26 Left 1062306235 9:135908207-135908229 CCCCCGGAAGGGACGCTGACTTC No data
Right 1062306252 9:135908256-135908278 CGCGCTGGGCTGAGAATTACGGG No data
1062306244_1062306252 -1 Left 1062306244 9:135908234-135908256 CCCTGGAGCCTGCGTCGGGGCCC No data
Right 1062306252 9:135908256-135908278 CGCGCTGGGCTGAGAATTACGGG No data
1062306243_1062306252 0 Left 1062306243 9:135908233-135908255 CCCCTGGAGCCTGCGTCGGGGCC No data
Right 1062306252 9:135908256-135908278 CGCGCTGGGCTGAGAATTACGGG No data
1062306238_1062306252 23 Left 1062306238 9:135908210-135908232 CCGGAAGGGACGCTGACTTCGTT No data
Right 1062306252 9:135908256-135908278 CGCGCTGGGCTGAGAATTACGGG No data
1062306236_1062306252 25 Left 1062306236 9:135908208-135908230 CCCCGGAAGGGACGCTGACTTCG No data
Right 1062306252 9:135908256-135908278 CGCGCTGGGCTGAGAATTACGGG No data
1062306245_1062306252 -2 Left 1062306245 9:135908235-135908257 CCTGGAGCCTGCGTCGGGGCCCG No data
Right 1062306252 9:135908256-135908278 CGCGCTGGGCTGAGAATTACGGG No data
1062306247_1062306252 -9 Left 1062306247 9:135908242-135908264 CCTGCGTCGGGGCCCGCGCTGGG No data
Right 1062306252 9:135908256-135908278 CGCGCTGGGCTGAGAATTACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062306252 Original CRISPR CGCGCTGGGCTGAGAATTAC GGG Intergenic