ID: 1062306254

View in Genome Browser
Species Human (GRCh38)
Location 9:135908283-135908305
Sequence CCGTGAGAGTTTGCATTCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062306247_1062306254 18 Left 1062306247 9:135908242-135908264 CCTGCGTCGGGGCCCGCGCTGGG No data
Right 1062306254 9:135908283-135908305 CCGTGAGAGTTTGCATTCCGAGG No data
1062306249_1062306254 6 Left 1062306249 9:135908254-135908276 CCCGCGCTGGGCTGAGAATTACG 0: 1
1: 0
2: 0
3: 3
4: 51
Right 1062306254 9:135908283-135908305 CCGTGAGAGTTTGCATTCCGAGG No data
1062306243_1062306254 27 Left 1062306243 9:135908233-135908255 CCCCTGGAGCCTGCGTCGGGGCC No data
Right 1062306254 9:135908283-135908305 CCGTGAGAGTTTGCATTCCGAGG No data
1062306250_1062306254 5 Left 1062306250 9:135908255-135908277 CCGCGCTGGGCTGAGAATTACGG No data
Right 1062306254 9:135908283-135908305 CCGTGAGAGTTTGCATTCCGAGG No data
1062306244_1062306254 26 Left 1062306244 9:135908234-135908256 CCCTGGAGCCTGCGTCGGGGCCC No data
Right 1062306254 9:135908283-135908305 CCGTGAGAGTTTGCATTCCGAGG No data
1062306245_1062306254 25 Left 1062306245 9:135908235-135908257 CCTGGAGCCTGCGTCGGGGCCCG No data
Right 1062306254 9:135908283-135908305 CCGTGAGAGTTTGCATTCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062306254 Original CRISPR CCGTGAGAGTTTGCATTCCG AGG Intergenic