ID: 1062306255

View in Genome Browser
Species Human (GRCh38)
Location 9:135908289-135908311
Sequence GAGTTTGCATTCCGAGGATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062306249_1062306255 12 Left 1062306249 9:135908254-135908276 CCCGCGCTGGGCTGAGAATTACG 0: 1
1: 0
2: 0
3: 3
4: 51
Right 1062306255 9:135908289-135908311 GAGTTTGCATTCCGAGGATTTGG No data
1062306247_1062306255 24 Left 1062306247 9:135908242-135908264 CCTGCGTCGGGGCCCGCGCTGGG No data
Right 1062306255 9:135908289-135908311 GAGTTTGCATTCCGAGGATTTGG No data
1062306250_1062306255 11 Left 1062306250 9:135908255-135908277 CCGCGCTGGGCTGAGAATTACGG No data
Right 1062306255 9:135908289-135908311 GAGTTTGCATTCCGAGGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062306255 Original CRISPR GAGTTTGCATTCCGAGGATT TGG Intergenic