ID: 1062311252

View in Genome Browser
Species Human (GRCh38)
Location 9:135938689-135938711
Sequence CCACAGGCAAGCTGGGCACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 1, 2: 1, 3: 28, 4: 270}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062311252_1062311261 15 Left 1062311252 9:135938689-135938711 CCAAGTGCCCAGCTTGCCTGTGG 0: 1
1: 1
2: 1
3: 28
4: 270
Right 1062311261 9:135938727-135938749 TCAGCAGTGCTGGAGCCATGAGG No data
1062311252_1062311260 5 Left 1062311252 9:135938689-135938711 CCAAGTGCCCAGCTTGCCTGTGG 0: 1
1: 1
2: 1
3: 28
4: 270
Right 1062311260 9:135938717-135938739 TTATGGGCAGTCAGCAGTGCTGG No data
1062311252_1062311262 22 Left 1062311252 9:135938689-135938711 CCAAGTGCCCAGCTTGCCTGTGG 0: 1
1: 1
2: 1
3: 28
4: 270
Right 1062311262 9:135938734-135938756 TGCTGGAGCCATGAGGACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062311252 Original CRISPR CCACAGGCAAGCTGGGCACT TGG (reversed) Intronic
900144189 1:1150831-1150853 CCAGAGGGAATCTGGGGACTTGG - Intergenic
900287019 1:1906714-1906736 CCACAGGCTGGCAGGGCACATGG + Intergenic
900402780 1:2479434-2479456 CCCCGGGCCAGCCGGGCACTGGG + Intronic
900797819 1:4719899-4719921 ACACAGGCAAGCTGGGGGCCTGG + Intronic
901204975 1:7489430-7489452 CCATTGGCATGCAGGGCACTGGG + Intronic
901850250 1:12010534-12010556 CCACAGAGAAGCTGGTTACTTGG + Intronic
902644059 1:17785897-17785919 CCACAGTCAAGGTGGTGACTGGG + Intronic
902956963 1:19932028-19932050 CTGCAGGTAAGCGGGGCACTCGG - Intergenic
903773324 1:25777750-25777772 CCACAGGCCAGCTGGGCTTCTGG + Intronic
904008152 1:27374462-27374484 ACACAGGCAGGGTGGGCACAGGG + Intronic
904754004 1:32758182-32758204 TCCCAGGCTAGCTGAGCACTCGG + Intronic
905025039 1:34844117-34844139 CCACAGCCTTGCTTGGCACTGGG + Intronic
905249681 1:36639895-36639917 CCACCAGCCAGCTGGTCACTGGG + Intergenic
906055454 1:42912615-42912637 CCACCCCCAAGCTGGGCACCTGG - Intergenic
906646273 1:47477790-47477812 GCAAAAGCAAGCTGAGCACTGGG + Intergenic
906715208 1:47963687-47963709 ACACATGCAAGCAAGGCACTGGG - Intronic
907000214 1:50845434-50845456 CCACAGGCAGGCTGTGTACAAGG - Intronic
907927380 1:58967192-58967214 CCACCAGCAACCTGGGCAGTAGG + Intergenic
907938629 1:59065726-59065748 GCACTGGCAGGCTGGGAACTGGG + Intergenic
907951016 1:59184266-59184288 CCAAATGGAAGCTGGGCACATGG + Intergenic
908240259 1:62183350-62183372 TGACAGGAAAGCTGAGCACTTGG - Intergenic
909525594 1:76618895-76618917 CCACAGGCAAGCTATGTTCTAGG + Intronic
911430142 1:97774542-97774564 CCACAGGCAAGTATGGCTCTGGG + Intronic
912503997 1:110143199-110143221 CCACATCCAAGCTTGGCACCAGG + Intergenic
912686949 1:111775369-111775391 GCACAGGTCAGCTGGGCAGTGGG + Intronic
915410598 1:155698846-155698868 CCGCAGGTGAGCGGGGCACTTGG - Intronic
917447714 1:175120718-175120740 CCAAAGTAAAGCTGGGCACAGGG - Intronic
919542211 1:198862483-198862505 GGAGAGGCAAGTTGGGCACTTGG + Intergenic
919921618 1:202169577-202169599 GGACAGGTAAGGTGGGCACTTGG + Intergenic
920569891 1:207008618-207008640 CCAGAAGGAAGCTGGGCACAGGG + Intronic
920837373 1:209523942-209523964 CCCCATGCTACCTGGGCACTGGG - Intergenic
921149585 1:212388873-212388895 CCACAGCCCAGCTGAGCACAAGG + Intronic
921170212 1:212540585-212540607 CCTCAGGCAAGCAAAGCACTGGG + Intergenic
922806305 1:228391706-228391728 CAGCATGCAAGATGGGCACTGGG + Intergenic
923495355 1:234519845-234519867 CAAGAGGCAAGCTGAGCACTTGG + Intergenic
1062979805 10:1712646-1712668 CCCCAGGGAAGGAGGGCACTGGG + Intronic
1066453728 10:35554223-35554245 CCAGAGGCAAGGAGGGCCCTAGG - Intronic
1069592320 10:69649862-69649884 CCACAGGAAAGCACGGCACTGGG - Intergenic
1069621047 10:69837417-69837439 CTACAGCCAAGCTGGGCACCTGG + Intronic
1069624720 10:69860695-69860717 CCACAGGCAAGGAGGGCATGGGG - Intronic
1069686641 10:70323177-70323199 GCCCAGACAACCTGGGCACTGGG - Intronic
1069749301 10:70735385-70735407 CCACTGGCCAGCTGGGCAGAAGG - Intronic
1070391551 10:75975250-75975272 ACTCAGGCAAGTTGGGCAGTAGG - Intronic
1070589513 10:77791851-77791873 CCACAGGCAGTCTGAGCACCTGG + Exonic
1070934884 10:80285511-80285533 CCACAGGCCACCTTGGCATTGGG + Exonic
1072237568 10:93466406-93466428 CCAGAGGCCAGTGGGGCACTGGG - Intronic
1072867467 10:99079266-99079288 CCAGAGGGAAGCTGGGAACTAGG + Intronic
1074039616 10:109775338-109775360 CCACAGACAAGATGGGCAAATGG + Intergenic
1074361306 10:112825655-112825677 CCACAGGCACCCTGGTGACTTGG - Intergenic
1075516026 10:123109006-123109028 CCCCAGGGAAGCTGGGCTGTGGG - Intergenic
1077235899 11:1481869-1481891 CCACATGCAGCGTGGGCACTTGG + Intronic
1078053324 11:7986141-7986163 CCACTTGCCAGCTGGACACTAGG + Intronic
1079135534 11:17774286-17774308 CCACATGGAAGCTGGGGCCTGGG - Intronic
1079244625 11:18743419-18743441 CCACAGGCAAGCTGGGGCACAGG + Exonic
1079248743 11:18772190-18772212 CAAGAGGCAAGCAGGGCACCAGG - Intronic
1083163885 11:60871839-60871861 CCACTGGCATCCTGGGCACCTGG - Intronic
1083203192 11:61132242-61132264 CCACAGGCAGGCTGGGGGATGGG + Exonic
1084283341 11:68114407-68114429 ACACAGGGAGGCTGGGCACAGGG + Intronic
1084802683 11:71555284-71555306 CCACGGGGAAACTGGTCACTTGG + Intronic
1087232570 11:95682777-95682799 CCACAGGCAGCCTGAGCACCAGG - Intergenic
1090398442 11:126434080-126434102 ACACAGGCAGGCTGGGGACTGGG - Intronic
1090415688 11:126538764-126538786 CCACACCCAACCTGGGGACTTGG - Intronic
1090498865 11:127242116-127242138 CCAGATGCAAGCTTGGCACTGGG + Intergenic
1090868156 11:130720436-130720458 CCACAGACACACTGGGCACTGGG - Intergenic
1091834597 12:3576780-3576802 CCTCAGGCACGCTGTGCTCTAGG + Intronic
1092060883 12:5549194-5549216 CCCCATGAAAGCTGGGCACTGGG + Intronic
1092146588 12:6218883-6218905 ACACAGGTAAGCTGGTCACCTGG - Intronic
1096169515 12:49456003-49456025 CCTCAGGCTAGCTGAGCCCTTGG + Intronic
1097134022 12:56836486-56836508 CCACAGGAAAACTTGGCCCTGGG + Intergenic
1099874922 12:88392726-88392748 CCACAGTCAAAGTGGGCTCTAGG - Intergenic
1100382349 12:94073573-94073595 CCACAAGCCAGATGGGCAGTGGG + Intergenic
1100518558 12:95351707-95351729 CCACAGGCTTGCTTGGCTCTAGG + Intergenic
1101357863 12:103997691-103997713 CCTCAGATAAGTTGGGCACTGGG - Intronic
1102254635 12:111408485-111408507 CCACAGGACTGCTGGGCCCTTGG + Intronic
1102436805 12:112930477-112930499 CCACTGCGGAGCTGGGCACTTGG + Intronic
1102622764 12:114209940-114209962 CCCAAGCCAAGCTGGGCCCTTGG - Intergenic
1103189001 12:118984370-118984392 CTAGAGGCAATCTGGGGACTTGG + Intronic
1104019559 12:124982534-124982556 CCACTTCCAAGCTAGGCACTGGG - Exonic
1104607101 12:130198218-130198240 ACGCAGGTAAGCTGGGCCCTGGG + Intergenic
1105472933 13:20707878-20707900 CCACCTGCAGGCTGGGCACAGGG + Intronic
1113706977 13:112441401-112441423 ACACAGGCAAGTTGGGGACGGGG - Intergenic
1113722741 13:112572961-112572983 CCACAAGGAAGCTCAGCACTGGG + Intronic
1113916982 13:113880132-113880154 CCACAGCCCATCTGGTCACTAGG + Intergenic
1114614220 14:24059760-24059782 GCACAGGGAGGCTGGGGACTTGG - Intronic
1115177943 14:30586271-30586293 CCACTGCCCAGCTGGGCAGTGGG + Intronic
1115499702 14:34038401-34038423 TCAAAGGCAAGCAGGGCAGTAGG + Intronic
1115805911 14:37051548-37051570 GCACAGGCAACTTGGGCAATTGG + Intronic
1117400434 14:55354391-55354413 CTACAGGCAAGCTGTACTCTAGG - Intronic
1118624178 14:67642358-67642380 CCACAGGTAAGCTGGGAGCCAGG + Exonic
1121482704 14:94291082-94291104 CCCCAGCCAAACAGGGCACTGGG - Intronic
1121509345 14:94500784-94500806 CCAGAGGCAAGGTGGGCTCTGGG - Intronic
1122502985 14:102213635-102213657 CCACGTGCCAGCTGGGCCCTGGG - Intronic
1122781637 14:104146271-104146293 CAGCAGGCAAGCTGGGCCCCTGG - Intronic
1202856192 14_GL000225v1_random:53403-53425 CCCCAGGCATGCAGGGCACGTGG - Intergenic
1202858214 14_GL000225v1_random:64342-64364 CCCCAGGCCAGCAGGGCACGTGG + Intergenic
1123438771 15:20274633-20274655 CCACAGGTAAGCCAGGCACGGGG + Intergenic
1125003227 15:34793228-34793250 CCACAGGTATGCTGGGCTCTGGG - Exonic
1125901167 15:43349092-43349114 CCCCAGGCAACCTGGGGATTGGG - Intronic
1127974123 15:63984606-63984628 CCCCGGGCAAGATGGTCACTGGG - Intronic
1129180238 15:73869650-73869672 CCACAGGCAAGAGGGAGACTTGG + Intergenic
1129699725 15:77760662-77760684 CCATAGGCTAGCTGCTCACTGGG + Intronic
1130054716 15:80512506-80512528 GCAGGGGCAAGCTGGGCAGTGGG + Intronic
1131146715 15:90018699-90018721 ACACAGGAAAGCTGGGCCCTGGG + Intronic
1131266831 15:90920490-90920512 CCCCTGGCAAACTGGGCACTTGG + Exonic
1132320219 15:100919694-100919716 CCACAGGCTGGCTGGGCTCCGGG - Intronic
1133279324 16:4656096-4656118 CCACAGGCAAGCAGGGCGGTGGG + Intronic
1136063579 16:27743617-27743639 CCACAAGCATGCTGTGCACCTGG - Intronic
1136687288 16:32002914-32002936 GCACAGGGAAGCTGGGCATCTGG - Intergenic
1136787900 16:32946465-32946487 GCACAGGGAAGCTGGGCATCTGG - Intergenic
1136881881 16:33907324-33907346 GCACAGGGAAGCTGGGCATCTGG + Intergenic
1137677250 16:50309804-50309826 CCAGAGGCCAGCTGGGCCCATGG - Intronic
1137811089 16:51353148-51353170 CCACAAGCAAGAAGGGCAATGGG - Intergenic
1139954967 16:70688795-70688817 CCAGGGGCAAGCTAAGCACTGGG - Intronic
1141475101 16:84267611-84267633 GCGCAGGGAAGCTGGGCACTTGG + Intergenic
1141699543 16:85636125-85636147 CCAGCTGCAACCTGGGCACTGGG + Intronic
1141704984 16:85659883-85659905 CCACAGGCCACTTGGGCAGTGGG + Intronic
1141984626 16:87571827-87571849 CCACAGGACAGCTGGCCGCTTGG + Intergenic
1142114475 16:88349070-88349092 CCACAGGCCAGCATGGCTCTGGG + Intergenic
1142126317 16:88412285-88412307 GCACTGGGAAGGTGGGCACTGGG - Intergenic
1203090130 16_KI270728v1_random:1208122-1208144 GCACAGGGAAGCTGGGCATCTGG - Intergenic
1142559352 17:800822-800844 CCACAGAGAGGCTGGACACTTGG + Exonic
1143120377 17:4602963-4602985 CAGCAGGCAACCAGGGCACTGGG - Intronic
1143586257 17:7852115-7852137 CCACAGGTCAGGTGGGAACTGGG - Intronic
1143903928 17:10195234-10195256 CCAAGGGCTAGCTGGCCACTGGG + Intronic
1146182203 17:30705688-30705710 GCAAAGGGAAGCTGAGCACTGGG + Intergenic
1147148267 17:38498583-38498605 GCACAGGGAAGCTGGGCATCTGG - Intronic
1147403191 17:40193084-40193106 TGTTAGGCAAGCTGGGCACTTGG - Intronic
1151369796 17:73640537-73640559 CCCCAGGCAAGCACGACACTCGG + Intronic
1151439791 17:74120705-74120727 CCACTGCCAAAGTGGGCACTAGG + Intergenic
1152351588 17:79786597-79786619 CGGCAGGCAATCTGGTCACTAGG + Exonic
1152460371 17:80439150-80439172 GCACAGGCAACCAGGGCCCTGGG + Intergenic
1152747833 17:82049414-82049436 CCCCATGCCAGCTGGGCAGTGGG - Intronic
1153401803 18:4690156-4690178 CCACTGGCAAGCTTAACACTGGG - Intergenic
1153966845 18:10190137-10190159 CTACAGGCCAGGTGGACACTGGG + Intergenic
1155069580 18:22302567-22302589 CCAAAGGTTAGCAGGGCACTTGG - Intergenic
1158126080 18:54100760-54100782 CCAGTGCCAAGCTAGGCACTGGG - Intergenic
1160939590 19:1614143-1614165 CACCAGGCATGCTGGGCACTGGG - Intronic
1160985939 19:1838768-1838790 TCACAGCCAAGGTGGGCTCTTGG - Intronic
1160998750 19:1897915-1897937 CCACGTGCATGCTGGGCAATAGG + Intergenic
1161064057 19:2228925-2228947 CCCCAGGCAGGCAGGGCACTTGG - Intronic
1161575864 19:5053912-5053934 AAACAGGGAAGCTGGGCACCAGG - Intronic
1162147227 19:8620369-8620391 CCTCAGGCAGGCTGGGGACCAGG + Intergenic
1162466567 19:10845015-10845037 CCACAGGCATGCACGGCACCTGG - Intronic
1162469413 19:10863440-10863462 CCACAGGCAGGCAGGCCCCTTGG + Intronic
1162976629 19:14210114-14210136 GCAAAGGGAAGCTGAGCACTGGG - Intergenic
1163314552 19:16532971-16532993 CCAAGGGAAAGCTGGGCTCTGGG + Intronic
1163849368 19:19654660-19654682 CTACAGGGATGCTGGACACTGGG + Exonic
1164679709 19:30125793-30125815 CCACTGGGAAGGTGGTCACTGGG - Intergenic
1164719231 19:30420021-30420043 TCACAGGCAGGCTGGGCGCTGGG + Intronic
1164812137 19:31165589-31165611 CCACAGGCCAGCTCAGCCCTCGG + Intergenic
1166346216 19:42167789-42167811 CCATAGGCAATATGGGCAATGGG - Intronic
1167747987 19:51364036-51364058 CCACAGGCAGGCTGGGAGCAGGG + Intronic
925434916 2:3828464-3828486 CCAAAGGGTTGCTGGGCACTTGG - Intronic
926245685 2:11121220-11121242 CCACAGGCCACCTGGGAGCTAGG + Intergenic
929865637 2:45715079-45715101 CCACAGGCAGGCAGGCAACTCGG + Intronic
931823799 2:65978694-65978716 ACACAGGCTGGCTGGCCACTTGG + Intergenic
932759953 2:74432729-74432751 CCACAGCCCACCTGGGGACTGGG - Intronic
933418945 2:82023385-82023407 CCACAGGTAAGTAGGGCACTTGG + Intergenic
935408784 2:102736976-102736998 TCTCAGGCAAGGTGGGGACTGGG + Intronic
936064770 2:109322369-109322391 CCACAGGCAGACTAGGCAGTTGG + Intronic
936462788 2:112724606-112724628 CCCCAGCCAAGCTGGGCACTAGG - Intronic
938239199 2:129729932-129729954 CCACATGCGAGGTTGGCACTGGG - Intergenic
942114216 2:172712442-172712464 CCAAGGGCAAGCTAGGCACAGGG + Intergenic
946096568 2:217279573-217279595 CCAGATGCAAGCTGGGTACAGGG - Intergenic
946418214 2:219551140-219551162 GCAGAGGCAAGCTGGGCAGAGGG + Intronic
947870909 2:233437408-233437430 GCACAGGCCAAGTGGGCACTTGG - Exonic
947917999 2:233847062-233847084 CGACAGGAAAGCTGGGCTCTCGG - Intronic
948280959 2:236747716-236747738 ACAGAGGGAGGCTGGGCACTTGG + Intergenic
948444426 2:238021025-238021047 CCACAGGCCAGCTAGGGTCTGGG - Intronic
1170353309 20:15465794-15465816 CCAAAGGTAAGGTGGGCACATGG - Intronic
1171213616 20:23335745-23335767 ACAGAGGCAAGCTGGCTACTTGG + Intergenic
1172126091 20:32626198-32626220 CCACAGGCATGCTGGGAAGTGGG - Intergenic
1172226893 20:33311181-33311203 CCCCAGCCAAGCGGGGCACAGGG + Intergenic
1172590628 20:36115308-36115330 GCAAAGGCAAGATGGCCACTTGG - Intronic
1173309697 20:41886500-41886522 CCAGAGGCAGACTGGGCACTTGG + Intergenic
1173547383 20:43909265-43909287 CCACAGGCATGCTGGCTACTGGG + Intergenic
1173812093 20:45962234-45962256 CCACAGGCATGGTGGGGACGGGG - Intronic
1173945016 20:46943593-46943615 ACACAGGCAAGCTGGCCTCCTGG - Intronic
1175800672 20:61799616-61799638 CCACACTCAGCCTGGGCACTGGG + Intronic
1175813289 20:61870296-61870318 CCTCGGGCCAGCTGGGCACAGGG + Intronic
1178421285 21:32445502-32445524 GAACAGTCAAGCTGGGAACTGGG - Intronic
1179609929 21:42543697-42543719 CCACGGGCAAACAGGGCGCTAGG - Intronic
1181022521 22:20111135-20111157 CGAGAAGCAAGCTGGGCACCAGG - Exonic
1182107804 22:27701760-27701782 CTCCAGACATGCTGGGCACTTGG - Intergenic
1182422585 22:30255880-30255902 CCCCAGGAAAGCTGGGCCCAGGG + Intergenic
1182492025 22:30679443-30679465 CGGCAGGAAAGCTGAGCACTGGG - Intergenic
1183235840 22:36616889-36616911 GCAAAGGGATGCTGGGCACTGGG + Intronic
1183828144 22:40404450-40404472 CCACAGGTAAGGTGGCCACAGGG + Exonic
1184550235 22:45200472-45200494 CCACAGGCAAGCCAGGGTCTCGG - Intronic
1185008896 22:48302089-48302111 CCACAGGCATCCTGGGCAGACGG + Intergenic
949871803 3:8595492-8595514 GCACAGGCTAGCTGTGCACAGGG + Intergenic
952956813 3:38562693-38562715 TCACAGGCCAGCTCTGCACTGGG + Intronic
953628092 3:44587454-44587476 CCACAGGCCAGTAGGACACTAGG - Intronic
954745273 3:52784235-52784257 CCACAGGCATGTGGGGCACGAGG - Intronic
954793680 3:53150485-53150507 GGACAGGGAAGCTGGGCACGTGG + Intergenic
956511050 3:69993826-69993848 CAACAGGTAAGGAGGGCACTGGG + Intergenic
956912640 3:73835015-73835037 CCCCAGGCAAGCTGGCCCCTGGG - Intergenic
957050102 3:75405022-75405044 GAACAGTCAAGCTGGGAACTGGG + Intergenic
957281253 3:78154185-78154207 CCACTGCCAAGCTGGGCCCCTGG - Intergenic
957516532 3:81260799-81260821 CAACAGGCAAACTGTGCACTGGG + Intergenic
958058655 3:88448439-88448461 CCACAGGCAAACTAGGATCTAGG - Intergenic
960509426 3:118530771-118530793 GAAAAGGCAAGCTGGGAACTGGG - Intergenic
960891355 3:122452048-122452070 TCACAGGCAGTCTGGGCTCTTGG - Exonic
961013977 3:123453484-123453506 CCAGAGGGAAGCTTGGAACTGGG - Intergenic
961262978 3:125617306-125617328 CTGCTGGCAAACTGGGCACTTGG - Intergenic
961724893 3:128921302-128921324 CAGCAGGAAAGCTGAGCACTCGG + Intronic
962105719 3:132386624-132386646 CCACTGCCCAGCTGGGCAGTGGG + Intergenic
962145629 3:132836729-132836751 GAAAAGTCAAGCTGGGCACTGGG + Intergenic
962339275 3:134568390-134568412 CCACAGGCAAGCATAGCCCTTGG + Intronic
963545511 3:146652906-146652928 CCACAGGGAAGCTGGGAATATGG - Intergenic
963572485 3:147015584-147015606 GCACAGGGCAGCTGGGCCCTGGG - Intergenic
963748560 3:149150506-149150528 TCACAGGCAAACAGGGCAATGGG - Intronic
967962226 3:194934966-194934988 CCACAGGCAAGGTGAACCCTGGG - Intergenic
967983221 3:195077870-195077892 CCCCAGGCAGGCTGGGCACGGGG - Intronic
969141419 4:5077543-5077565 CCACAGGAAGGCTGTGCAATGGG - Intronic
969582282 4:8072353-8072375 CCTCAGGCACGCTCCGCACTGGG - Intronic
969692364 4:8710642-8710664 CCACAGGGAGGCAGGGCAGTGGG + Intergenic
974047099 4:56907736-56907758 CCCCAGGCGAGCTGGAGACTGGG + Intergenic
974701938 4:65462504-65462526 TCAAAGACTAGCTGGGCACTAGG + Intronic
975427890 4:74251974-74251996 CCACAGGCAAGGTGGGTGATGGG + Intronic
976000817 4:80371230-80371252 GCACAGGATAGCGGGGCACTGGG + Intronic
978501254 4:109412193-109412215 CCACATGCCAGCTGCTCACTGGG + Intergenic
980127436 4:128787498-128787520 CCACATCCAAGCTGGGCAGGGGG - Intergenic
980242942 4:130201593-130201615 CCTCAGGGAAGCAGGGCACAGGG - Intergenic
981744581 4:148040183-148040205 CCCCAGGCAAGTGGGGAACTTGG + Intronic
983661317 4:170133156-170133178 CTACAGGTAAGTAGGGCACTGGG - Intergenic
985353830 4:189096278-189096300 CCACTGGCCGGCTGGGCACGCGG + Intergenic
985648712 5:1097419-1097441 CCACAGGCAACCTATGCAGTTGG + Intronic
985984673 5:3504573-3504595 CCACAGAGAAGCTGGGAACATGG + Intergenic
987084791 5:14458385-14458407 GCACAGGTAACCTAGGCACTGGG - Intronic
987155141 5:15081599-15081621 CTCCAGCCAACCTGGGCACTGGG - Intergenic
988611866 5:32734453-32734475 CCACAGGATCGCTGGGCACAGGG + Intronic
994139800 5:96329517-96329539 CCCCAGGGAAACTGGGCAGTGGG - Intergenic
994399070 5:99256672-99256694 CCACAGCCACTGTGGGCACTGGG + Intergenic
995752836 5:115471699-115471721 CCCCAGACCAGCTGGGCACCAGG - Intergenic
998451190 5:142235746-142235768 CCGCAGGGAAGAAGGGCACTTGG + Intergenic
998567131 5:143225779-143225801 CCACAGGGAAGCTGGGGAGGGGG - Exonic
999244561 5:150147124-150147146 CCACAGGCCTGCTGTGCACAGGG + Intronic
999800257 5:155026924-155026946 CCACAGAGAAGCTGGGAGCTAGG - Intergenic
999820420 5:155222465-155222487 CCAAGGGCAAGCTGGCCTCTGGG - Intergenic
1002530505 5:179841727-179841749 CCACAGCCCACCTGGGCATTGGG - Intronic
1002534438 5:179868557-179868579 CCACTGGCCAGATGGTCACTGGG - Intronic
1003571544 6:7259444-7259466 GCACAGGGAAGCTGGCCACGGGG + Intergenic
1005575805 6:27188181-27188203 CTGCAGGTAAGCAGGGCACTTGG + Intergenic
1006614020 6:35312538-35312560 GGTCAGGCAAGCTGGGAACTAGG + Exonic
1010173181 6:72996531-72996553 CCACTGGCAATCTGTGTACTTGG - Intronic
1013530080 6:111011116-111011138 CCACAGGCAAGATGGACAGTAGG - Intronic
1015568533 6:134598671-134598693 CCACAGGCCACCAGGACACTAGG - Intergenic
1017568497 6:155714796-155714818 ACACAGGAAAGCTGGACATTAGG - Intergenic
1018025168 6:159800161-159800183 ACACGGGGAAGCTGGGCACGTGG + Intergenic
1018105553 6:160483091-160483113 TCACAGGCAAGCTGGTCTTTAGG + Intergenic
1018835709 6:167482176-167482198 CCACAGCCACGCTGAGCTCTCGG - Intergenic
1019116051 6:169763535-169763557 CCCGTGGGAAGCTGGGCACTTGG - Intronic
1019183174 6:170205377-170205399 CCCAAGGCAAGGTGGGCAGTGGG - Intergenic
1020700371 7:11474473-11474495 CCACTGGCAAACTGGTCCCTGGG - Exonic
1029590353 7:101503003-101503025 CAGCAGGCAGGCTGGGCCCTGGG - Intronic
1031923121 7:127615568-127615590 CCACAGGCGGGCAGGGCAGTGGG - Exonic
1032087892 7:128893255-128893277 CCAGAGGCAGGCAGGGCACAGGG + Exonic
1032923356 7:136575211-136575233 CTGCTGGCAAACTGGGCACTCGG + Intergenic
1033085707 7:138339648-138339670 CAGCAGGAAAGCTGAGCACTTGG + Intergenic
1034372788 7:150615042-150615064 CGTCAGGAAAGCTGAGCACTTGG - Intergenic
1035120064 7:156559549-156559571 CCAAAGGGGAGCTGGGCACTGGG + Intergenic
1035204161 7:157283991-157284013 CCACAGGCAAGGCTGGCACCAGG + Intergenic
1035375234 7:158403131-158403153 CCACCTTCAAGCTGTGCACTTGG + Intronic
1037731392 8:21526599-21526621 CCACAGGCAAGCTGGGCCCTGGG + Intergenic
1038395189 8:27241359-27241381 CCCCAAGCAAGCTGGAGACTGGG + Intronic
1039891149 8:41686348-41686370 ACACAGGCTGGGTGGGCACTGGG + Intronic
1041663605 8:60422168-60422190 CCACTGGCAAGCTTAACACTGGG + Intergenic
1045685032 8:104702941-104702963 CCCCAGGCATTCTGGCCACTAGG + Intronic
1048486023 8:134848166-134848188 CCAGAGCCAAGCATGGCACTGGG + Intergenic
1048526221 8:135205560-135205582 GCACAGAGAAGCTGGGCCCTGGG - Intergenic
1048930673 8:139313283-139313305 CCACAATCATGCTGGGCTCTGGG + Intergenic
1049218915 8:141420074-141420096 CACCAGGCAGGCTGGGCCCTTGG - Intronic
1049266120 8:141668747-141668769 CTAGAGCCGAGCTGGGCACTGGG - Intergenic
1049319300 8:141987463-141987485 CCACAGCCAGGCCGGGCACCTGG + Intergenic
1052553816 9:29986827-29986849 CCACAGAGAAGCTAGGCACGAGG - Intergenic
1056542179 9:87581635-87581657 CCACAGGCCAGAAGGGAACTAGG - Intronic
1057474122 9:95384358-95384380 CCACGGGAAAGGTGGGCACGGGG + Intergenic
1057903856 9:98969536-98969558 CCACAGTCTTGCTGGCCACTGGG - Intronic
1058828595 9:108796073-108796095 CCCCAGGGATGCTGGTCACTGGG + Intergenic
1059447943 9:114350692-114350714 CCACAGAAACGCTGGGAACTGGG + Intronic
1060198455 9:121638033-121638055 ACAATGCCAAGCTGGGCACTGGG + Intronic
1060409479 9:123390645-123390667 ACCCAGGCTAGCTGTGCACTGGG + Intronic
1060804245 9:126564671-126564693 GCACAGGGATGCTGTGCACTGGG - Intergenic
1061577294 9:131515028-131515050 CCCCAGGCCAGCTGGGCGCAGGG + Intronic
1061730608 9:132611076-132611098 GAACAGGCAAGCTGGACACTGGG + Intronic
1062034453 9:134376708-134376730 CCTGGGGGAAGCTGGGCACTGGG + Intronic
1062311252 9:135938689-135938711 CCACAGGCAAGCTGGGCACTTGG - Intronic
1062424556 9:136500102-136500124 TCACCGGCAAGCTGAGCCCTAGG + Intronic
1062520114 9:136954270-136954292 CTGCAGGCATGCTGGGCAGTAGG + Intronic
1187447964 X:19374418-19374440 CCACAAGAATGCTGGGCGCTGGG - Intronic
1188538066 X:31219304-31219326 CCCCAGGCACGCTTAGCACTTGG - Intronic
1192148302 X:68696262-68696284 CAACAGGGTAGTTGGGCACTGGG + Intronic
1194512295 X:94811633-94811655 CCAGAGGCAAACTAGGCACAGGG - Intergenic
1194864468 X:99048789-99048811 GCACAGAGCAGCTGGGCACTGGG + Intergenic
1195520586 X:105823621-105823643 CTAGAGGGAAGCTGGGCATTCGG - Intronic
1195630929 X:107054442-107054464 CCACTGGCAAGCTTAACACTGGG + Intergenic
1195681227 X:107548009-107548031 CCACAGCCAAGCTTGTCTCTTGG + Intronic
1196799598 X:119530870-119530892 CCACAGACAAGATGAGGACTTGG - Intergenic
1196999998 X:121429289-121429311 ACACAAGAAAGCTAGGCACTAGG - Intergenic
1197729092 X:129795016-129795038 CCCCAGGCCAGTTGGGCACCAGG - Exonic