ID: 1062311753

View in Genome Browser
Species Human (GRCh38)
Location 9:135941768-135941790
Sequence CTGCTGTCCGGGGGCAGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 301}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062311753_1062311769 27 Left 1062311753 9:135941768-135941790 CCAGCTCTGCCCCCGGACAGCAG 0: 1
1: 0
2: 1
3: 38
4: 301
Right 1062311769 9:135941818-135941840 GGGCAGCAGGAAATCTGTTTTGG No data
1062311753_1062311768 14 Left 1062311753 9:135941768-135941790 CCAGCTCTGCCCCCGGACAGCAG 0: 1
1: 0
2: 1
3: 38
4: 301
Right 1062311768 9:135941805-135941827 ACTGGGAAGGGAGGGGCAGCAGG No data
1062311753_1062311765 6 Left 1062311753 9:135941768-135941790 CCAGCTCTGCCCCCGGACAGCAG 0: 1
1: 0
2: 1
3: 38
4: 301
Right 1062311765 9:135941797-135941819 TGTCTACCACTGGGAAGGGAGGG No data
1062311753_1062311759 -4 Left 1062311753 9:135941768-135941790 CCAGCTCTGCCCCCGGACAGCAG 0: 1
1: 0
2: 1
3: 38
4: 301
Right 1062311759 9:135941787-135941809 GCAGGCATCCTGTCTACCACTGG No data
1062311753_1062311766 7 Left 1062311753 9:135941768-135941790 CCAGCTCTGCCCCCGGACAGCAG 0: 1
1: 0
2: 1
3: 38
4: 301
Right 1062311766 9:135941798-135941820 GTCTACCACTGGGAAGGGAGGGG No data
1062311753_1062311761 1 Left 1062311753 9:135941768-135941790 CCAGCTCTGCCCCCGGACAGCAG 0: 1
1: 0
2: 1
3: 38
4: 301
Right 1062311761 9:135941792-135941814 CATCCTGTCTACCACTGGGAAGG No data
1062311753_1062311760 -3 Left 1062311753 9:135941768-135941790 CCAGCTCTGCCCCCGGACAGCAG 0: 1
1: 0
2: 1
3: 38
4: 301
Right 1062311760 9:135941788-135941810 CAGGCATCCTGTCTACCACTGGG No data
1062311753_1062311764 5 Left 1062311753 9:135941768-135941790 CCAGCTCTGCCCCCGGACAGCAG 0: 1
1: 0
2: 1
3: 38
4: 301
Right 1062311764 9:135941796-135941818 CTGTCTACCACTGGGAAGGGAGG No data
1062311753_1062311762 2 Left 1062311753 9:135941768-135941790 CCAGCTCTGCCCCCGGACAGCAG 0: 1
1: 0
2: 1
3: 38
4: 301
Right 1062311762 9:135941793-135941815 ATCCTGTCTACCACTGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062311753 Original CRISPR CTGCTGTCCGGGGGCAGAGC TGG (reversed) Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
900580173 1:3404905-3404927 CTGCTGCCCCGGGGCTGAGACGG - Intronic
900661797 1:3788367-3788389 CTCCTCTCTGGGGGCAGAGCCGG - Intronic
901312896 1:8283192-8283214 CTGCTGTGTGGGGGCAGCCCGGG + Intergenic
901436500 1:9250179-9250201 CTGCTGTCCCGGGTGAGGGCGGG + Intronic
902360612 1:15940904-15940926 CTCCTGTCTGGAGGCAGAGACGG - Intergenic
903833679 1:26189497-26189519 CTGAGGTCAGGGGGCAGAGATGG - Exonic
903951305 1:26997526-26997548 CTTCTGTCCGAGGCTAGAGCTGG - Intronic
904237477 1:29124279-29124301 CTGCGGGACCGGGGCAGAGCAGG - Intergenic
904309693 1:29620852-29620874 CTGGTGACAGGGGCCAGAGCGGG + Intergenic
906724093 1:48031064-48031086 ATGCTGCCTGGGGGCAGAGTGGG - Intergenic
908599117 1:65719697-65719719 CTGCTGCCAGGGGATAGAGCAGG + Intergenic
910127650 1:83861046-83861068 CACCTGCCCGAGGGCAGAGCGGG - Intergenic
910876072 1:91879407-91879429 TTGGTGTCGGGGGGCAGGGCAGG - Intronic
912408948 1:109466739-109466761 CTGCAGGTCCGGGGCAGAGCAGG - Exonic
912670430 1:111619826-111619848 CTGCTGTCGCCGCGCAGAGCCGG + Exonic
914339406 1:146746213-146746235 CTGCTGTCCATGGGCAGGGGAGG - Intergenic
915211569 1:154313396-154313418 CTGATGTCTGGGGGAAAAGCAGG - Intergenic
915358117 1:155268793-155268815 CTGCTGTCGGGGGGCAGGGGGGG + Intronic
915480463 1:156181052-156181074 CTGCTGTCTCAGGGCAGAGGCGG + Intergenic
915932759 1:160070192-160070214 GGGCCGGCCGGGGGCAGAGCTGG + Exonic
916390809 1:164329008-164329030 ATACTGTCAGGGGGCAGATCAGG - Intergenic
917011727 1:170481793-170481815 CTGCTGTACCTGGACAGAGCAGG - Intergenic
919974242 1:202600472-202600494 CGGCTGTCCAGGGGAAGAGCAGG + Exonic
922153027 1:223021276-223021298 CTGATGGCCGTGAGCAGAGCTGG + Intergenic
922738931 1:228005068-228005090 ATCCTGTCGGTGGGCAGAGCTGG + Intergenic
923046288 1:230358113-230358135 CTGCTGTCTGGGGGGAGTGTTGG - Intronic
924032414 1:239899870-239899892 CTCCTCTCTGGGGTCAGAGCAGG - Intronic
924645527 1:245873866-245873888 CAGCTGGCCAGTGGCAGAGCTGG - Intronic
1062848691 10:727056-727078 ATGCTGGCCAGGGGCAGTGCTGG + Intergenic
1063144768 10:3287053-3287075 CTGCTATAGGGGGGCACAGCAGG - Intergenic
1063953058 10:11242339-11242361 CTGCGGGCAGGGGGCACAGCTGG - Intronic
1063960865 10:11304530-11304552 CTGCAGTCCTGAGGCAGTGCGGG + Intronic
1065796485 10:29312792-29312814 CTGTTCTGCTGGGGCAGAGCTGG + Intronic
1066259043 10:33711193-33711215 CTGCAGTCTCGGGACAGAGCAGG + Intergenic
1067165656 10:43864549-43864571 CAGCTGGCAGGTGGCAGAGCCGG - Intergenic
1069947296 10:71996801-71996823 CTACTGTCCGAGGCAAGAGCTGG + Intronic
1070969163 10:80549419-80549441 CTGCTGTATGGAGGCAGAACAGG - Intronic
1072537952 10:96377562-96377584 TTGCTGATAGGGGGCAGAGCTGG + Intronic
1072804374 10:98415297-98415319 CTGCTGCCCTGGGGCTGTGCTGG + Intergenic
1073593018 10:104774256-104774278 CTGCTGTCCCAGGGAAGGGCTGG - Intronic
1074460252 10:113630132-113630154 CTGCTGTTAGAGGGCAGATCAGG - Intronic
1074752836 10:116603325-116603347 CTGCCATTCTGGGGCAGAGCTGG + Intronic
1075396734 10:122133112-122133134 CTGATCTCCTGGGACAGAGCTGG + Intronic
1075873763 10:125789786-125789808 CAGCTAGCAGGGGGCAGAGCCGG - Intronic
1076616511 10:131758836-131758858 CTGCTCTCCGGGGCCAGGGCTGG - Intergenic
1077033266 11:480075-480097 CAGCTGTCAGGGGTCAGGGCCGG - Intronic
1077090834 11:777535-777557 CTGGCGGCCGGGGGCGGAGCCGG + Intergenic
1077227978 11:1446660-1446682 CTGCTGGGTGGGGGCAGGGCTGG + Intronic
1077364932 11:2157825-2157847 CGGCTGCCCTGGGCCAGAGCTGG - Intronic
1077492903 11:2870341-2870363 CTGGGGTCGGGGGGCAGAGGTGG - Intergenic
1077906556 11:6539106-6539128 CTGCTATCTGGGGTCTGAGCTGG + Intronic
1078731597 11:13979940-13979962 ATGCTGTCAGGGGACAGAGCTGG - Intronic
1083733067 11:64663586-64663608 CTGCAGTGGGTGGGCAGAGCAGG - Intronic
1084183695 11:67459095-67459117 CAGCTGTCAGGGGGCAGAAGCGG + Exonic
1086500208 11:87445076-87445098 CAGCTCTCAAGGGGCAGAGCTGG + Intergenic
1089301299 11:117500584-117500606 CAGCTATCCAGTGGCAGAGCTGG + Intronic
1089729570 11:120511855-120511877 CCGCACTCCGGGGGCTGAGCCGG - Exonic
1090259965 11:125312475-125312497 CTGCTCTCCTGGGGCACAGCAGG - Intronic
1090385618 11:126356125-126356147 CTTCAGTCCGGGCGCAGGGCTGG - Intronic
1091451557 12:575429-575451 CTGTAGTCCTGGAGCAGAGCAGG - Intronic
1091878777 12:3959879-3959901 CTGCTCTCTGAGGGCAGAGGCGG - Intergenic
1095736865 12:45567165-45567187 CAGCTGTTAGGTGGCAGAGCTGG - Intergenic
1095864527 12:46956955-46956977 CTGCTGTCCGGTTGCAGAACGGG + Intergenic
1096666710 12:53171126-53171148 CTTCTGTTTGGGGGCAGAGGAGG - Intronic
1102173896 12:110862064-110862086 CTGCTGTCTGGCACCAGAGCAGG + Intronic
1102257569 12:111425107-111425129 CAGCAGGTCGGGGGCAGAGCTGG - Intronic
1102298447 12:111754765-111754787 CTGCTGCTTGGAGGCAGAGCTGG + Intronic
1107057849 13:36126256-36126278 CTGCAGCCCGGTGACAGAGCAGG - Intronic
1107426346 13:40296880-40296902 CTGCTGACAGGGGGCATAGCTGG + Intergenic
1113538811 13:111090386-111090408 CAGCTTTCAGGGGACAGAGCTGG + Intergenic
1113784515 13:112995508-112995530 CTGCTCTCCTGGGGCAGAAGTGG - Intronic
1113884594 13:113651979-113652001 CGGCTGGCAGGAGGCAGAGCTGG + Intronic
1116817576 14:49598474-49598496 CTGCTCTCCGGAGGCACACCTGG - Intronic
1119617892 14:76110878-76110900 CAGCTGTCGAGGAGCAGAGCTGG - Intergenic
1121492968 14:94372938-94372960 CTGCTGATCTGGGGCAGAGGAGG - Intergenic
1122027127 14:98886188-98886210 CTGCAGTGCATGGGCAGAGCAGG - Intergenic
1122235623 14:100329379-100329401 CTGGTGGCCGGGGGCTGTGCAGG + Exonic
1122346785 14:101065844-101065866 CTGCTTCCCGGGGGCAGCGCTGG + Intergenic
1122514478 14:102297610-102297632 GGGCTGGCCGGGGCCAGAGCCGG + Intronic
1122828910 14:104386055-104386077 CTGCTGTCCAGAGGCACCGCTGG + Intergenic
1122836162 14:104432110-104432132 CTGCTGTCTGTGGGAGGAGCCGG + Intergenic
1122836175 14:104432163-104432185 CTGCTGTCTGTGGGAGGAGCCGG + Intergenic
1124341354 15:28891296-28891318 CTGCTGTGACGGGGCAGTGCTGG + Intronic
1124504446 15:30261237-30261259 CGGCCAGCCGGGGGCAGAGCAGG - Intergenic
1124739105 15:32277398-32277420 CGGCCAGCCGGGGGCAGAGCAGG + Intergenic
1124982380 15:34578530-34578552 CTGCTGTGACGGGGCAGTGCTGG - Intronic
1125274893 15:37979352-37979374 GTTCTGTCCGAGGGCAGTGCAGG + Intergenic
1125477985 15:40060496-40060518 ATGCTCACCAGGGGCAGAGCAGG + Intergenic
1125758756 15:42083382-42083404 CTGCTGTCCCAGGTCCGAGCTGG - Intronic
1125825843 15:42675721-42675743 CTGCTGTCCTGCGGCAGCGAAGG + Exonic
1125832630 15:42727684-42727706 CTGCTGCCCGGGGGGAGCGGAGG - Exonic
1126072467 15:44876888-44876910 CTGCTGACCAGGGGCATAGTCGG + Intergenic
1126085723 15:45009764-45009786 CTGCTGACCAGGGGCATAGTCGG - Intergenic
1127805121 15:62512089-62512111 CTGCTGTCCTGGGTCACAGCTGG + Intronic
1128732765 15:70032571-70032593 CTGTGGTCCTGGGGCAGGGCTGG - Intergenic
1129694447 15:77732727-77732749 CATCTGTCCGAGTGCAGAGCAGG - Intronic
1130016334 15:80189420-80189442 CTACTGCCCGGGGCCAGGGCAGG + Intergenic
1131295319 15:91143088-91143110 GTGCTGTCCAGGGACAGACCGGG + Intronic
1132404920 15:101536307-101536329 CTGCTTTCCCAGGGCAGAGAGGG + Intergenic
1132713494 16:1279398-1279420 CAGCTGCTCAGGGGCAGAGCTGG + Intergenic
1132743425 16:1427195-1427217 CTGGGGTCCGTGGGCACAGCAGG + Intergenic
1133330881 16:4973157-4973179 CAGCTGTCAAGTGGCAGAGCTGG + Intronic
1134032986 16:11007466-11007488 CAGCTGTTCAGGGGCAGAGCTGG - Intronic
1134186388 16:12088259-12088281 CGGCTCTGCGGGGTCAGAGCAGG + Intronic
1134517461 16:14898712-14898734 CAGCTGTCAAGTGGCAGAGCAGG + Intronic
1134705129 16:16297363-16297385 CAGCTGTCAAGTGGCAGAGCAGG + Intergenic
1134962412 16:18414751-18414773 CAGCTGTCAAGTGGCAGAGCAGG - Intergenic
1134966709 16:18497350-18497372 CAGCTGTCAAGTGGCAGAGCAGG - Intronic
1135863940 16:26083136-26083158 GTGCTGTCAGAGGGCAGAGGAGG - Intronic
1137290431 16:47048847-47048869 CTCCTGTGCAGGGGAAGAGCAGG - Intergenic
1138578324 16:57923041-57923063 CTGCTGGCCGTGGACACAGCTGG + Intronic
1139034486 16:62927007-62927029 CTGCTTTTAGGGGGCAAAGCAGG + Intergenic
1139661077 16:68421262-68421284 CAGATGTGCGAGGGCAGAGCTGG - Intronic
1139994869 16:70971134-70971156 CTGCTGTCCATGGGCAGGGGAGG + Intronic
1140515120 16:75535728-75535750 GCGCTGGCCGAGGGCAGAGCAGG + Intronic
1141369262 16:83472207-83472229 CAGCTGTTCAGTGGCAGAGCTGG + Intronic
1141386179 16:83624342-83624364 CTGCTGACCTGGGGCAGGGGTGG - Intronic
1141992840 16:87620336-87620358 CTGGTGTCATGGGCCAGAGCGGG + Intronic
1142416035 16:89942825-89942847 GTGGTGTCTGGGGACAGAGCTGG + Intergenic
1142741582 17:1934806-1934828 CTGCTGGCCGGGGGCCCAGGTGG - Exonic
1143491084 17:7285570-7285592 CTGCTGTCCCGGGTTAGAGCAGG - Intronic
1144701468 17:17343634-17343656 CTGCCACCCTGGGGCAGAGCCGG - Intronic
1144728990 17:17515979-17516001 CTGCTGGCTGGGGACAGGGCGGG - Intronic
1145853218 17:28124492-28124514 CTTCAGTCTGGGTGCAGAGCAGG + Intronic
1146403380 17:32517939-32517961 GTGCTGTCCAGAGGGAGAGCCGG - Intronic
1147131914 17:38414846-38414868 CTGGTGGCCGCGGGCAGAGCTGG + Intergenic
1147393346 17:40122866-40122888 CTGCTGCCCGGGGGCCGCCCCGG - Intronic
1148085998 17:44994193-44994215 AAGCTGTCCGGAGGCAGAGGTGG - Intergenic
1148491033 17:48024124-48024146 CAGCTTTCCGGGGGCTGAGGCGG - Intergenic
1149746808 17:59106716-59106738 CTGCTGGCCGGCGGCTGAGCCGG - Exonic
1150398212 17:64837196-64837218 CCGCGGGCCGGGGGCAGGGCCGG - Intergenic
1150692513 17:67378071-67378093 CTGCTGCCCAGGCGCAGGGCAGG - Intronic
1151578641 17:74965093-74965115 GTGCTGTGAGAGGGCAGAGCCGG - Intronic
1151817060 17:76476573-76476595 CTGCTGTCTGGGAGCAAGGCTGG + Intronic
1152190815 17:78886133-78886155 CTGCTGCCAGGGGACAGTGCAGG + Intronic
1152234207 17:79130111-79130133 CTGCTGTCAGGGGACAGAATGGG - Intronic
1152465750 17:80465137-80465159 CTGCTGCATGGGGGCAGAGCTGG + Intergenic
1152651023 17:81493022-81493044 CTGCTGTCCTGGGTCAGAAAAGG - Intergenic
1152678413 17:81653358-81653380 CTGCGGTCTGGGGGCAGACCAGG + Exonic
1152729089 17:81961133-81961155 CGGCCGTCCGAGGGCAGCGCAGG + Exonic
1153479322 18:5531036-5531058 CTGTTGTCAGGGAGTAGAGCTGG - Intronic
1153522744 18:5967746-5967768 CTGCTGGCAGTGGGCAGAGTGGG + Intronic
1153714979 18:7838845-7838867 CTGTTGTCCTGTGGCTGAGCTGG + Intronic
1154389182 18:13922011-13922033 CTGCTGGGTAGGGGCAGAGCAGG + Intergenic
1155184743 18:23377223-23377245 CTGCAGTCCTGGGCCATAGCAGG - Intronic
1160463506 18:79057072-79057094 CTGCTCTATGGGTGCAGAGCAGG + Intergenic
1160754066 19:748538-748560 CTGCTGTGGGGGGGCAGGACTGG + Intergenic
1160805219 19:989625-989647 CCGCAGTCCTGGGGCAGGGCAGG + Intronic
1161742771 19:6034012-6034034 CTGCTATGCAGGGGCTGAGCAGG + Intronic
1162967785 19:14164203-14164225 CTGCCGGCTGGGGGCAGGGCTGG - Intronic
1163361639 19:16850679-16850701 CTGCAGGACGTGGGCAGAGCTGG - Intronic
1163548617 19:17952914-17952936 CAGCTGGGCTGGGGCAGAGCAGG + Intronic
1165266038 19:34664431-34664453 CTGGTGTCCCTGGGCAGGGCTGG - Intronic
1165828263 19:38717912-38717934 TTGATGTCCTGGGGCAGGGCAGG - Exonic
1166283809 19:41811355-41811377 CTGGTGTCTGGGGGCAGGGAGGG + Exonic
1166743505 19:45128861-45128883 CTGCTGTCCTGGAGCAGTGAGGG - Intronic
1167507659 19:49879386-49879408 CTCCTGCCCTGGGGCAGCGCAGG - Intronic
1167613148 19:50517057-50517079 CCGCCGGCCGGGAGCAGAGCCGG + Exonic
1167620246 19:50556434-50556456 CGGCTGGCCGAGGGCACAGCAGG - Intronic
1168501147 19:56894614-56894636 CTGCTCTCCTGGGCCAGACCTGG + Intergenic
1168636499 19:58001220-58001242 CTGCAGTCATGGGTCAGAGCTGG - Intronic
1168649630 19:58085168-58085190 CTGCGATCCGGTGGCAGAGTCGG + Exonic
925033987 2:672348-672370 CTGATGTCGGGGGGCACCGCTGG - Intronic
925438255 2:3860193-3860215 CTGCAGATCTGGGGCAGAGCTGG - Intergenic
925686708 2:6480703-6480725 CGGCTTTCCGGGGGCAGTGACGG + Intergenic
929592709 2:43157622-43157644 ATGCTGGCCTGGGGCGGAGCAGG - Intergenic
930768872 2:55112280-55112302 TTGCTGTCCGGGGGTAGATGAGG - Intronic
932735215 2:74249641-74249663 CTGCTGTGCTGGGGAAGGGCAGG + Intronic
936773066 2:115938330-115938352 CTGCTTGCTGGAGGCAGAGCAGG + Intergenic
941274605 2:163475141-163475163 CTGCAGTTCTGGGGCAAAGCTGG - Intergenic
942611169 2:177744019-177744041 CTGCTGGGCAGGGGCAGAGGAGG - Intronic
942798276 2:179846876-179846898 CAGCTGTATGGTGGCAGAGCAGG - Intronic
943672430 2:190677768-190677790 CTGCTATCCAGTAGCAGAGCCGG + Intronic
944495818 2:200306711-200306733 ATCCAGTCCGGGGGCCGAGCTGG + Intronic
944661270 2:201923791-201923813 CTGCTGGCCGGGGTCTGAGGTGG - Intergenic
944987168 2:205190598-205190620 CAGCTGGCCAGGGGCAAAGCTGG - Intronic
946685622 2:222266591-222266613 CAGCTGTTAAGGGGCAGAGCTGG - Intronic
946909541 2:224445813-224445835 CTGCTGTACTGAGTCAGAGCTGG + Intergenic
947181522 2:227415633-227415655 CTGCTCTCAGGGGGTAGGGCAGG - Intergenic
947326205 2:228980722-228980744 CTGCAGTCTGTGGACAGAGCTGG + Intronic
947370358 2:229439479-229439501 CAGCTGTTCGGAGGCAAAGCTGG + Intronic
947502380 2:230680815-230680837 CTGTTGTCCTCGGGCAGAGCCGG - Intergenic
947670763 2:231934085-231934107 CTTCTGTCTGAGGGCAGAGGAGG - Intergenic
947856532 2:233328178-233328200 TTGCTGACAGGAGGCAGAGCTGG + Intronic
948431137 2:237919767-237919789 CTGTTTTCTGGGGGCAGGGCGGG + Intergenic
948701683 2:239764604-239764626 CTGCTGCCTGGGGGCAGAGCAGG + Intronic
948834705 2:240620408-240620430 CTGCTGCAGGTGGGCAGAGCTGG + Intronic
948945123 2:241215458-241215480 CTGCCTTCTGGGGGCAGATCAGG - Intronic
1168819461 20:763342-763364 CAGCTGACAGGTGGCAGAGCTGG + Intronic
1169141759 20:3230648-3230670 CTGCAGGCAGGGGGCAGGGCGGG + Intronic
1169770559 20:9195591-9195613 CCGATGTCCAAGGGCAGAGCAGG - Intronic
1171339049 20:24412805-24412827 AAGCTGTCCAGTGGCAGAGCTGG - Intergenic
1172662955 20:36579951-36579973 CTGCTTTCCTGGAGCAGAGGCGG + Intronic
1172690530 20:36786436-36786458 CTGCTATCCAGGGGCTGGGCTGG + Exonic
1172929945 20:38579445-38579467 CTGTTGTGCGTGGGCAGAGCAGG - Intergenic
1173662910 20:44746266-44746288 CAGCTGGGCGGGGGCAGAGGTGG - Intronic
1173867207 20:46319990-46320012 CAGGTGTTCTGGGGCAGAGCTGG + Intergenic
1174100115 20:48120952-48120974 CTGGAGACCTGGGGCAGAGCTGG - Intergenic
1175272193 20:57742213-57742235 CTTCTGTGAGGAGGCAGAGCCGG - Intergenic
1175553292 20:59830813-59830835 CAGCTGGCAGGGGTCAGAGCTGG + Intronic
1175924354 20:62464748-62464770 CTGCTGTGCTGGAGCAAAGCAGG + Exonic
1175972132 20:62692034-62692056 CTGGTGGCCGTGGGCAGAGCTGG - Intergenic
1176091878 20:63321907-63321929 CTGCTGTCAAGGGGAAGAGAAGG - Intronic
1176143209 20:63554089-63554111 CTGCGGCCCGGGGGCGGGGCGGG - Exonic
1176248585 20:64109390-64109412 CTGCTGTCCTGGGGTGGGGCTGG + Intergenic
1176248607 20:64109461-64109483 CTGCTGTCCTGGGGTGGGGCTGG + Intergenic
1179185959 21:39085401-39085423 CTGCTGTATGGGGAGAGAGCAGG + Intergenic
1179277674 21:39907147-39907169 ATGCTGTCAGTGGGCAGAGTGGG + Intronic
1179501726 21:41813396-41813418 CTGCAGTCCAGGGGCAGAGGAGG + Intronic
1179809901 21:43864385-43864407 CCGCTGTCCTGGGGCTGAGAGGG + Intergenic
1180147693 21:45930437-45930459 CTGCTCTCCTGGGGCAGGGCTGG - Intronic
1180252318 21:46597623-46597645 CTGCTGCCGGGGGGCAGCTCTGG - Intergenic
1181432848 22:22893709-22893731 CTGCTCTCTGGGGGCTGGGCTGG - Exonic
1181763992 22:25078071-25078093 CAGCTGGCCAGGGGCAGAGCTGG + Intronic
1181809596 22:25395333-25395355 CGGCTGGGCGGGGGCAGAGCTGG + Intronic
1181907417 22:26210329-26210351 CTCCTCTCTGGGGGCAGAGAAGG - Intronic
1181998365 22:26901250-26901272 CTGGAATCTGGGGGCAGAGCAGG - Intergenic
1182541331 22:31044336-31044358 GTGCAGTGCGGGGGCAGAGCTGG - Intergenic
1182740290 22:32562589-32562611 GTGCTGACAGGGGGCAGAGCCGG - Intronic
1182949110 22:34354846-34354868 CTGCTGTTTGGAGTCAGAGCTGG + Intergenic
1184163954 22:42716557-42716579 CTGCTGGGCAGCGGCAGAGCGGG + Intronic
949797071 3:7863023-7863045 ATGCTGTACCGGGGCAGAACAGG + Intergenic
950131851 3:10552689-10552711 GTGCTGCCCTGAGGCAGAGCTGG + Intronic
950683691 3:14602308-14602330 CTGCTGTGCAGGGGCAGGCCCGG + Intergenic
953407412 3:42666304-42666326 CTGCTGTCCTGGGGGAGAGAAGG + Intergenic
953559894 3:43979443-43979465 CTGCTGTCCGTAATCAGAGCAGG - Intergenic
953884850 3:46709384-46709406 CTGGTCTCCAGGGGCAGGGCTGG - Intronic
954437324 3:50503150-50503172 GCGCGGACCGGGGGCAGAGCGGG + Intronic
960190887 3:114704766-114704788 CAGCTTTCTGGAGGCAGAGCTGG + Intronic
960479489 3:118171346-118171368 GTGCTGGCCGAGGCCAGAGCCGG + Intergenic
960586138 3:119322940-119322962 CTGCGGGGCGGGGGCAGGGCTGG - Intronic
960941953 3:122940735-122940757 TTGCTGTCCTGGGGCTGGGCGGG + Intronic
961374477 3:126454712-126454734 CTGCTGTCTAAGGGCAGAGAAGG - Intronic
961507973 3:127383948-127383970 CAGGTGTCTGGGTGCAGAGCTGG - Intergenic
961565662 3:127761683-127761705 CAGCCGGCCGTGGGCAGAGCTGG + Intronic
961666523 3:128496444-128496466 CTGCGGGCCGCGGGCAGGGCGGG + Intergenic
962363447 3:134760825-134760847 CTGCTGTCCTGGGGCACCTCCGG + Intronic
966808479 3:183824606-183824628 CGGCTGTCCAGGAGCAGAGCTGG + Intronic
968492831 4:899653-899675 TTGCTGTCCTGGGGCATGGCGGG - Intronic
968605162 4:1531976-1531998 CTGCTGATGGGGGACAGAGCGGG - Intergenic
969590854 4:8121253-8121275 CTTCCTTCCAGGGGCAGAGCTGG + Intronic
969870950 4:10104448-10104470 GTGCTGTGCAGGAGCAGAGCAGG + Intronic
970209758 4:13696939-13696961 CTGCTGTCAGGGTGCACAACTGG + Intergenic
970250980 4:14115794-14115816 CAGCTGGCCAGTGGCAGAGCTGG + Intergenic
972780367 4:42281985-42282007 CTGCTGTTCAGAGTCAGAGCTGG - Intergenic
976695574 4:87916760-87916782 CTGCTATCCGGGGGCAGGTCAGG + Intergenic
978161358 4:105552282-105552304 CTGCTGCCTGGAGGCAGACCAGG - Intergenic
981055725 4:140359289-140359311 CTGCTGGCTGGGAGCTGAGCTGG + Intronic
981154175 4:141414373-141414395 CTGGTGGAGGGGGGCAGAGCAGG + Intergenic
983075838 4:163325530-163325552 TTGCTGTGAGGTGGCAGAGCAGG + Exonic
985717028 5:1468415-1468437 CTGCTCTCTGGGGGCTGAGTGGG - Intronic
985722989 5:1500604-1500626 CTCCTGTCCGAAGGCAGGGCTGG + Intronic
986348839 5:6858585-6858607 TTCCTGTCCTGGGGCAGTGCTGG + Intergenic
986769420 5:10958276-10958298 CTGCTGTCCCTGGGCTGAGCTGG + Intergenic
987999353 5:25330118-25330140 GAGCTGGCCTGGGGCAGAGCCGG + Intergenic
991239843 5:64445133-64445155 CTGCTGACCAGGGGCATAGTGGG - Intergenic
992089847 5:73307198-73307220 CTCCTGTCCTGCTGCAGAGCTGG - Intergenic
994200471 5:96968843-96968865 ATGCTGTTCAGAGGCAGAGCAGG + Intronic
996599792 5:125249549-125249571 CTGCAGTCCAGGCACAGAGCTGG + Intergenic
997230514 5:132239079-132239101 CAGCAGTCAGGGCGCAGAGCAGG - Intronic
997265121 5:132490832-132490854 CGGCTGTCCGGGGGCGGGGCCGG - Intergenic
997947057 5:138212348-138212370 CTCCAGCCCGAGGGCAGAGCGGG - Intronic
998274757 5:140742014-140742036 GTGCTGTCCTGTGGGAGAGCTGG - Intergenic
1000640469 5:163696390-163696412 CGGCTGCCCAGGGGCAGAGTTGG + Intergenic
1001534055 5:172486219-172486241 CAGCTATTCAGGGGCAGAGCCGG - Intergenic
1001965731 5:175908645-175908667 CTGCTGTGCTGGGGCAGGGCTGG + Intergenic
1002251214 5:177930551-177930573 CTGCTGTGCTGGGGCAGGGCTGG - Intergenic
1002330179 5:178435530-178435552 CTGAGGTCAGGTGGCAGAGCTGG - Intronic
1002451282 5:179320196-179320218 CTGCTGCCCAGGAGCACAGCAGG - Intronic
1002868692 6:1146943-1146965 GGGCTGTGCGGGGGCAGAGATGG - Intergenic
1003174951 6:3747359-3747381 CTGCTGTGCTGGGAAAGAGCAGG - Intronic
1004081175 6:12394570-12394592 TTGCTGTGCAGGGGCAGAGAGGG + Intergenic
1004901146 6:20195318-20195340 CTGCTGTCAGTGGCCAAAGCTGG - Intronic
1006217952 6:32461523-32461545 CTGCTGGGGGAGGGCAGAGCTGG - Intergenic
1007635961 6:43299881-43299903 CTCCTGTCCTGGCCCAGAGCTGG + Exonic
1010381576 6:75231679-75231701 CTTGTGTCCTGGGGCAGAGCTGG - Intergenic
1017604771 6:156122308-156122330 CTGCTCTGCGGGGGCTGAGCTGG - Intergenic
1018065635 6:160123449-160123471 CTGCTTGCCTGGAGCAGAGCAGG + Intronic
1019175966 6:170159711-170159733 GAGCTGTGCGGGGGCAGAGCTGG - Intergenic
1019300738 7:302244-302266 CTGCTATCCTGGGCCTGAGCTGG + Intergenic
1019540033 7:1547281-1547303 CTGCTGGCCGAGGCCAGACCTGG - Intronic
1023223341 7:37943844-37943866 CTTCTGTATGTGGGCAGAGCGGG + Intronic
1023592711 7:41796350-41796372 CTGCTCTCCTAGGGCAGAGGTGG - Intergenic
1024648133 7:51385593-51385615 CTGCTGTGCTGGGGGAAAGCTGG + Intergenic
1024757298 7:52549952-52549974 CTGCTGTCCAGGGTCAAAGCTGG - Intergenic
1024819582 7:53311583-53311605 CTGCTCCCCGGGGCCAGTGCTGG - Intergenic
1026942244 7:74293830-74293852 CTCCTGTCCCGGGGCAGGGCTGG - Intronic
1027145128 7:75688730-75688752 TGGCTGTTGGGGGGCAGAGCTGG - Intronic
1029274186 7:99394355-99394377 CTGCTGTGCTGGGGCTGAGATGG + Intronic
1032264853 7:130363520-130363542 CTGCTGTCCTGGGGCAGGGTTGG + Intronic
1032794607 7:135267760-135267782 TGGCTGTGCTGGGGCAGAGCTGG + Intergenic
1034401054 7:150861738-150861760 CTGTAGTCCTGGGGCAGAGGGGG + Intergenic
1034423407 7:151000753-151000775 CTGCGGTTCGGGGACAGGGCAGG + Intronic
1034488793 7:151382015-151382037 CTGCTTGCGGGGGGCCGAGCAGG - Intronic
1035221511 7:157409243-157409265 GTGTTGTGCGGGGCCAGAGCTGG + Intronic
1035579420 8:730963-730985 CCGCGGTCCGGGGTAAGAGCGGG + Intronic
1036667829 8:10759220-10759242 CTGCAGGCAGGAGGCAGAGCCGG + Intronic
1037946748 8:22994404-22994426 CTGATGTCCGGGTCCAGCGCGGG - Intronic
1038556771 8:28525456-28525478 ATGATATCTGGGGGCAGAGCGGG + Intronic
1039843151 8:41307961-41307983 CAGCCCTCCGAGGGCAGAGCTGG + Intronic
1040547275 8:48408511-48408533 CTGTAGTTCTGGGGCAGAGCAGG - Intergenic
1042198588 8:66256797-66256819 CAGCTGTCAGGAGGCAGAGGTGG + Intergenic
1043654504 8:82645704-82645726 CTGGTGTCTGGGGGCATAGGTGG - Intergenic
1044622212 8:94201724-94201746 CTGCTGTCCCAGGACAGAGGTGG + Intronic
1044623643 8:94215476-94215498 CTGCAGTTGGGGGGCAGAGGGGG + Intronic
1045649525 8:104329015-104329037 ATGCTGTCTTGGGGCAGAACTGG - Intergenic
1047021049 8:120775382-120775404 CTTCTGCCTGGGGCCAGAGCAGG - Intronic
1047262380 8:123274421-123274443 CGGCCGTCCGGGGGCGGAGGGGG + Exonic
1047566106 8:126046378-126046400 CTGCTACCCTGGGGCGGAGCAGG - Intergenic
1047775803 8:128069455-128069477 CTGCACTCAGGGGTCAGAGCAGG + Intergenic
1048205585 8:132412727-132412749 CTGCTGTCCCAGGGCAGGGGAGG - Intronic
1048871719 8:138804429-138804451 CTGCTGTGCTTGAGCAGAGCAGG - Intronic
1049023800 8:139974934-139974956 CTGCTGATGGGAGGCAGAGCAGG - Intronic
1049228677 8:141470761-141470783 CTGCTGGCCAGGGGCAGGGTGGG + Intergenic
1049319328 8:141987609-141987631 CTGCTGTTCCGGGGCTGGGCAGG - Intergenic
1049399253 8:142417545-142417567 CTCCTGTGAGGAGGCAGAGCGGG - Intergenic
1049472655 8:142783279-142783301 CTGCTGGCCGGGGCCGGAGGGGG - Intergenic
1049562922 8:143321054-143321076 CTGCTGTGCCGGGGCTGATCGGG - Intronic
1049603284 8:143517928-143517950 CTGCTGTCCTGGCCCCGAGCAGG - Intronic
1050106775 9:2174044-2174066 CTGCTGTACGTGGGCATAACTGG - Intronic
1060269983 9:122133417-122133439 CATCTGTCTGGAGGCAGAGCTGG - Intergenic
1060655779 9:125371739-125371761 CTGCTGACCGGTGTCAGAGGAGG - Intergenic
1060979509 9:127784590-127784612 AGGCTGTCCTTGGGCAGAGCTGG + Intergenic
1061083142 9:128384231-128384253 CTGCCCATCGGGGGCAGAGCAGG - Intronic
1061191729 9:129086241-129086263 CTGCTATCCTGGGGAACAGCGGG - Exonic
1061390321 9:130314150-130314172 CTGGTTGCCGGGGGCCGAGCTGG + Intronic
1062019868 9:134314174-134314196 CTGCTGGCTGGGCGCAGGGCTGG + Intergenic
1062027966 9:134349283-134349305 CGGCTGTCCAGGTGCAGAACAGG - Intronic
1062218785 9:135403381-135403403 CTGCAGGCCTGGGGCTGAGCCGG - Intergenic
1062311753 9:135941768-135941790 CTGCTGTCCGGGGGCAGAGCTGG - Intronic
1062621115 9:137423054-137423076 CTGGGCGCCGGGGGCAGAGCGGG - Intronic
1189220260 X:39365725-39365747 GTGCTTCCCGGGGACAGAGCTGG - Intergenic
1189920805 X:45901453-45901475 CTGCCGGCTGGGGACAGAGCTGG - Intergenic
1190911273 X:54774668-54774690 CTGCTGTTGCTGGGCAGAGCAGG + Intronic
1190919944 X:54841542-54841564 CTGCTGTTGCTGGGCAGAGCAGG - Intergenic
1192201551 X:69069469-69069491 CTGCTGGCTGGTGGCTGAGCTGG - Intergenic
1192510380 X:71717644-71717666 CTGCGGTCCTGGGCCAGTGCGGG - Exonic
1192516317 X:71763909-71763931 CTGCGGTCCTGGGCCAGTGCGGG + Exonic
1199814431 X:151385341-151385363 ATGATGTCCGGAAGCAGAGCAGG - Intergenic
1201650248 Y:16276869-16276891 CTGCTGGACAGGGGCAGAGAAGG - Intergenic