ID: 1062313363

View in Genome Browser
Species Human (GRCh38)
Location 9:135952114-135952136
Sequence ATCTGTCCGCTGCAGATGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062313352_1062313363 20 Left 1062313352 9:135952071-135952093 CCAGAAACAGGCCTGACTCAGGG 0: 1
1: 0
2: 0
3: 20
4: 250
Right 1062313363 9:135952114-135952136 ATCTGTCCGCTGCAGATGGGTGG No data
1062313350_1062313363 21 Left 1062313350 9:135952070-135952092 CCCAGAAACAGGCCTGACTCAGG 0: 1
1: 0
2: 1
3: 34
4: 214
Right 1062313363 9:135952114-135952136 ATCTGTCCGCTGCAGATGGGTGG No data
1062313356_1062313363 9 Left 1062313356 9:135952082-135952104 CCTGACTCAGGGACAGGCGGAGG 0: 1
1: 0
2: 1
3: 24
4: 206
Right 1062313363 9:135952114-135952136 ATCTGTCCGCTGCAGATGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062313363 Original CRISPR ATCTGTCCGCTGCAGATGGG TGG Intronic
No off target data available for this crispr