ID: 1062314776

View in Genome Browser
Species Human (GRCh38)
Location 9:135961276-135961298
Sequence CGCCCCGCCCCGGCTCCCGT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 254}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062314770_1062314776 2 Left 1062314770 9:135961251-135961273 CCCGCGCGCTCCTTCGCTGGGCC 0: 1
1: 0
2: 0
3: 7
4: 127
Right 1062314776 9:135961276-135961298 CGCCCCGCCCCGGCTCCCGTCGG 0: 1
1: 0
2: 0
3: 32
4: 254
1062314766_1062314776 10 Left 1062314766 9:135961243-135961265 CCAGACCGCCCGCGCGCTCCTTC 0: 1
1: 0
2: 2
3: 13
4: 135
Right 1062314776 9:135961276-135961298 CGCCCCGCCCCGGCTCCCGTCGG 0: 1
1: 0
2: 0
3: 32
4: 254
1062314772_1062314776 -8 Left 1062314772 9:135961261-135961283 CCTTCGCTGGGCCGCCGCCCCGC 0: 1
1: 0
2: 2
3: 24
4: 289
Right 1062314776 9:135961276-135961298 CGCCCCGCCCCGGCTCCCGTCGG 0: 1
1: 0
2: 0
3: 32
4: 254
1062314767_1062314776 5 Left 1062314767 9:135961248-135961270 CCGCCCGCGCGCTCCTTCGCTGG 0: 1
1: 0
2: 1
3: 5
4: 113
Right 1062314776 9:135961276-135961298 CGCCCCGCCCCGGCTCCCGTCGG 0: 1
1: 0
2: 0
3: 32
4: 254
1062314771_1062314776 1 Left 1062314771 9:135961252-135961274 CCGCGCGCTCCTTCGCTGGGCCG 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1062314776 9:135961276-135961298 CGCCCCGCCCCGGCTCCCGTCGG 0: 1
1: 0
2: 0
3: 32
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062314776 Original CRISPR CGCCCCGCCCCGGCTCCCGT CGG Exonic
900100768 1:961093-961115 CGCTGCGCCCCTGCTCCCCTGGG - Intronic
900181314 1:1312188-1312210 CGCCCCCCCCCCACTCCCTTGGG - Intronic
900245319 1:1633690-1633712 GGCCCAGCCCCGCCGCCCGTGGG - Intronic
900256550 1:1700849-1700871 GGCCCAGCCCCGCCGCCCGTGGG - Intronic
900386497 1:2413211-2413233 CGCCAGGCCCTGCCTCCCGTGGG - Intronic
900970001 1:5986747-5986769 CGCCCCACCCCTACCCCCGTGGG + Intronic
901272225 1:7961489-7961511 CGGCCTGCCCCGGCGCCCGCGGG - Intronic
902375134 1:16026922-16026944 CGCCCCGCCCCGCCGCCCCCGGG - Intronic
903184669 1:21622422-21622444 CGGCCCGGCCCGGCCCCCGCCGG + Intronic
903597134 1:24503159-24503181 CGCCCCGCCCCGCCCCGCGCTGG - Intronic
904215431 1:28914882-28914904 CGCCCCGGCCCGGGGCCTGTCGG - Intronic
904811405 1:33165453-33165475 CGCCCCGGCCAGGCTCACCTTGG + Exonic
905416431 1:37807762-37807784 CGCCCCGACCCGGCCCCGCTAGG - Intronic
905862594 1:41361380-41361402 CGCCCCGCCCCCTCCCGCGTCGG + Intergenic
912069840 1:105795918-105795940 CGCGCAGCCCCGGCTCCCGCTGG - Intergenic
912561684 1:110555718-110555740 CGTCCCGCCCCGGCTGCCGGCGG - Intergenic
913047948 1:115089539-115089561 GGCCCCGCCCCGCCCCCCGGAGG - Intergenic
914250662 1:145918975-145918997 CGCCCCGCCCCGGCCCCTGCAGG - Intergenic
914702905 1:150150233-150150255 CGCCCCGCGCCCGCGCCCGCTGG + Exonic
915351218 1:155227536-155227558 GGCCCCGCCCCGCCTCCCCAGGG - Intergenic
915485434 1:156216838-156216860 CGGCCCGCCTCCGCTCCCGGGGG + Intronic
915835550 1:159172546-159172568 CACCCCGCCTCTGCTCCTGTCGG - Intronic
917578585 1:176349622-176349644 CGCGCAGCCCCGGTTCCCGCTGG + Intergenic
918260256 1:182789540-182789562 CGCAGCGCCCCGGCTCCCCGAGG - Intronic
919463152 1:197902573-197902595 CGCCGCGCCCAGGCCCGCGTTGG + Intergenic
920184647 1:204152224-204152246 CGCCCCGCCCGGGTCCCCGCCGG + Intergenic
920795298 1:209131089-209131111 GCCCCCGCCCCGACCCCCGTCGG - Intergenic
922753768 1:228082941-228082963 CGCCCAGCCCCGACTCCGGCCGG - Intronic
923056091 1:230426466-230426488 CGCCCCGCCCCGCCCCGCGGAGG - Intergenic
924835161 1:247639793-247639815 CGCCCCGCCTCAGTTCCCCTCGG - Intergenic
1064209105 10:13348186-13348208 CGCGGCGGCCCGGCTCCCGCAGG - Exonic
1066653862 10:37681912-37681934 CGCCCCGGCTGGGCTGCCGTGGG + Intergenic
1067216924 10:44310990-44311012 GGCGCGGCCCCGGCACCCGTGGG + Intergenic
1069186559 10:65429768-65429790 CGCGCAGCCCCGGTTCCCGCTGG + Intergenic
1069551535 10:69367646-69367668 GGCCCCGCCCCAGCTCACGGTGG - Intronic
1069957143 10:72059163-72059185 CGTCCCGCCCCGCCTCCACTTGG - Exonic
1070162315 10:73873936-73873958 CGCCCGGCCCCGCCCCCCGCGGG - Intronic
1070736159 10:78865226-78865248 CCCCCTGCCCCTGCTCCCTTTGG + Intergenic
1070947900 10:80408469-80408491 TGACCCGCCCCGCCCCCCGTGGG - Intronic
1072151975 10:92690668-92690690 CGCCCCTGGCCGGCCCCCGTGGG + Intronic
1072377297 10:94830500-94830522 CGCCCTGCTTCGGCTCCCGCAGG + Intronic
1072983013 10:100115333-100115355 AGCCCCGGCCCGGCTGCCGTCGG + Intergenic
1073099111 10:100997854-100997876 TGCTCCGCCCCGGCTCCAGGGGG - Intronic
1074585974 10:114768154-114768176 CGCCCGGCCCCGGCCCCCTCCGG + Intergenic
1074592094 10:114822368-114822390 ACCCCCGCCCCGGCTCCTGGAGG - Intronic
1074829888 10:117241040-117241062 CCCCCCGCCCCCGCTCCCTCCGG + Intergenic
1075645464 10:124093335-124093357 CGCCCAGCCCCGGCCGCCGCCGG + Intronic
1076374194 10:129972717-129972739 AGCCCCGCCCGCGCTCCCGTAGG + Intergenic
1076761249 10:132606795-132606817 GGCCCTGCCCCCGCTCCCATCGG - Intronic
1076796569 10:132801288-132801310 CGCGCAGCCCCGGTTCCCGCTGG + Intergenic
1077064993 11:637181-637203 CGACCCGCCCCGGCTCAGGGGGG - Intergenic
1077100340 11:819684-819706 CGCCGGGCCCCGGGTTCCGTGGG - Exonic
1077254076 11:1572779-1572801 CGCCCCGCCGCGACCCCCGCAGG + Intergenic
1077491444 11:2862706-2862728 CGCCCGGCCGCGGCTCCCGGAGG - Intergenic
1077495789 11:2885960-2885982 CGCCCCGCCCCGCCCCCGGTGGG - Intergenic
1077501024 11:2909766-2909788 GGCCCCGCCCCGCCTCCTCTTGG + Intronic
1079996843 11:27304595-27304617 CGCCTCTTCCTGGCTCCCGTTGG - Intergenic
1083766681 11:64844743-64844765 CGCCGCGCCCCGCCCCCCGACGG + Intergenic
1083970466 11:66070903-66070925 CTCCCCGCCCCAGCGCCCATGGG + Intronic
1089428622 11:118401814-118401836 CATCCCGCCCCGGCACCCGCAGG - Exonic
1092108841 12:5945071-5945093 CACCCTGCCCAGGCTCCCTTGGG + Intronic
1093793689 12:23285954-23285976 CGCGCAGCCCCGGTTCCCGCCGG - Intergenic
1094607316 12:31959694-31959716 CGGCCCGGCCCAGCTCCGGTGGG - Intronic
1098186298 12:67900369-67900391 CGCCCCGCTTCGGCTCGCGCAGG - Intergenic
1101504054 12:105330644-105330666 CGCCCCGCCCGGGGACCCGCCGG - Exonic
1102058652 12:109915593-109915615 TGCCCGGCCCCTGCTCCCCTGGG + Intronic
1103954298 12:124567720-124567742 CGCCCCGGCCCGGCCCCCTCTGG + Intergenic
1105874606 13:24541096-24541118 CGCCCCAGCCAGGCTCCCCTGGG + Intergenic
1109745779 13:66621957-66621979 CGCGCAGCCCCGGTTCCCGCTGG - Intronic
1113665867 13:112141980-112142002 CTCCCAGCCACGGCTCCCCTGGG + Intergenic
1116152163 14:41154590-41154612 CGCACAGCCCCGGTTCCCGGTGG + Intergenic
1117876042 14:60250077-60250099 CGCGCCGCCCCGGCTGTCCTGGG + Intronic
1119494776 14:75069427-75069449 CGCCCCTCCCCGGCTCCCCAAGG + Exonic
1122131267 14:99605361-99605383 CGCCCCGCCCCGCCTGCTGGCGG - Intergenic
1122217532 14:100214112-100214134 CGCCCGGCCCCCGCTCGGGTCGG + Intergenic
1122220861 14:100238661-100238683 CGCCCCGCCCCCGGTCCCATCGG + Intronic
1122596728 14:102898986-102899008 CGCCACGCCCAGCCTCCTGTGGG - Intronic
1122736729 14:103847668-103847690 CTCCCCGCCCCCGCTCCCACCGG - Intergenic
1122975017 14:105167535-105167557 CGCCGCGACCCCGCTCCCGGTGG + Intronic
1124469195 15:29968520-29968542 CGGCGCGCCCCGCGTCCCGTCGG + Intronic
1126392845 15:48178042-48178064 CACCTCGCCCCGGTTCCCGGAGG + Intronic
1127768083 15:62207546-62207568 CGCGCAGCCCCGGCTCCCGCTGG - Intergenic
1129082190 15:73051737-73051759 GGCCCTGGCGCGGCTCCCGTGGG - Exonic
1130352958 15:83107616-83107638 CGCCCCGCCCCAGCTTCCGGCGG - Exonic
1130370842 15:83284443-83284465 CGCTGGGCTCCGGCTCCCGTGGG - Intronic
1130656451 15:85794835-85794857 GGCTCCGCCGCGGCTCCCGTCGG + Exonic
1130967080 15:88705502-88705524 CGCGCCGCCCGGGCTCCCTCGGG + Intergenic
1131160651 15:90102590-90102612 CGCCGGGTCCCGGCTCCCGCGGG - Intergenic
1132497621 16:271184-271206 TGCCCCGCCTGGGCTCACGTGGG + Exonic
1132829649 16:1921051-1921073 AGCCCCGCCCCTGTTCCCGCAGG - Intergenic
1133224262 16:4333120-4333142 CCCCCCTCCCCGGCTCACGGGGG + Intronic
1136237838 16:28925354-28925376 GGCCCCGCCCCGGCTCTTCTTGG + Exonic
1136478567 16:30527371-30527393 AGCCCCGCCCCGGCTCCCAGAGG + Intronic
1139896240 16:70289762-70289784 CCCCCGCCCCCGGCTCCCGGAGG + Intronic
1140097023 16:71883996-71884018 CGCCCCGGCCCGGCTGGCTTGGG - Exonic
1141531232 16:84648455-84648477 CGCCCGGCCCCGCCTCCCCGCGG + Intergenic
1142352744 16:89587346-89587368 CGCCCCCGCCCCGCTCCCGAGGG + Intronic
1142518583 17:489778-489800 AGCACCGCCGGGGCTCCCGTGGG + Intergenic
1143323158 17:6080939-6080961 GGCCCCGGCCCGGCCCCCGCTGG + Exonic
1143483895 17:7242371-7242393 CCCCCCGTCCCGGCCCCCCTGGG - Exonic
1144787487 17:17840151-17840173 CTCTGCGCCCCGGCTCCCCTGGG - Intergenic
1146003894 17:29148932-29148954 GGCCCCGCCCAGGCTCCGGCTGG - Intronic
1146286516 17:31577777-31577799 AGCCCAGCCCTGGCTCCAGTGGG + Intergenic
1148337471 17:46851432-46851454 CGCCCCGCCCCGTCGCGGGTGGG - Intronic
1148733432 17:49851379-49851401 GCCCCCGGCCCGGCTCCCGCGGG - Intergenic
1148857054 17:50584584-50584606 CCCCCGCCCCCGGCTCCCCTGGG - Intronic
1151854485 17:76711057-76711079 CGCCCCGCCCCCGCCCCCTCCGG + Intergenic
1155053260 18:22165800-22165822 CCCCCAGCGCCGGCTCCCGCCGG - Intergenic
1155271992 18:24149905-24149927 CGCGCAGCCCCGGTTCCCGCTGG + Intronic
1156079479 18:33316237-33316259 CGCGCAGCCCCGGTTCCCGCCGG - Intronic
1159057077 18:63476873-63476895 CGCCCCGCCCCGCCCCGCCTCGG - Exonic
1160500747 18:79400252-79400274 CGCCCCGCCCCCGCCCCCCGGGG - Intronic
1160736042 19:662870-662892 CGCACCGCCCGGGCTCCCCGCGG + Intronic
1160869124 19:1269091-1269113 CGCCCCGCCCCGCCGCGCGCTGG + Intronic
1161063597 19:2227152-2227174 CCCCCCGCCCCGGCCCCCGCCGG + Intronic
1161306604 19:3572552-3572574 GGCCCCGCCCCGGTTGCCATGGG - Intronic
1161357594 19:3827561-3827583 CACCCCGCGCGGGCTCCCGTTGG + Exonic
1161925043 19:7293865-7293887 CGCCCCCCGCCGGCCCCCGGTGG + Exonic
1162327518 19:10007682-10007704 CCCCCCGCCCCAGCTCCCCGTGG - Intronic
1162455285 19:10780334-10780356 CACCCCGACCCGGCTGCCCTTGG + Intronic
1162800159 19:13105606-13105628 CGCCCCACCCCTGCTTCCCTAGG - Exonic
1163243115 19:16076413-16076435 CCCCCCGGGCCGGCTGCCGTCGG - Intronic
1163243393 19:16077339-16077361 CCCGCCGCCCCGGTTCCCGCAGG - Intronic
1163426910 19:17245224-17245246 CGCCCCGGCCCCGCTGCCCTGGG - Exonic
1163762618 19:19145817-19145839 CGCCCTGCGCCGGCTGCCCTTGG - Exonic
1164052166 19:21592863-21592885 ACCCCAGCCCCGGCTCCAGTGGG + Intergenic
1165172352 19:33903151-33903173 CCCCCCGCCCCGTCTCTTGTGGG - Intergenic
1165435267 19:35791724-35791746 CCCCCAGCCCCGCCTCCTGTTGG - Intergenic
1165955310 19:39498857-39498879 CGCCCCGCCCTTGGTCCCTTGGG + Intergenic
1166366408 19:42280631-42280653 CGCCCCGCCGCGGCCCGCGTGGG + Intronic
1167142468 19:47661459-47661481 CTCCCCGGCCCGGCTCCCTCTGG - Intronic
1167263086 19:48469824-48469846 CGCCCCTCCCCGGCCCCGGCAGG - Intronic
1167637982 19:50666519-50666541 CCCCCCGCCACGCCTGCCGTGGG + Exonic
1168685983 19:58350012-58350034 CGCCCCGGCCCCGGTCCCGCAGG - Intronic
925571504 2:5317043-5317065 CTCTCCTCCCCGGCTCCCTTAGG - Intergenic
926901223 2:17753818-17753840 CGCCCCGCCCTCCCTCCCTTCGG + Intronic
927667406 2:25042182-25042204 CTCCCCGCCCGGGCCCCTGTCGG + Exonic
929890911 2:45918025-45918047 CGCGCAGCCCCGGTTCCCGCTGG + Intronic
930640996 2:53854318-53854340 CGCCCTGCACCGGCTCCGGATGG - Exonic
931374411 2:61694814-61694836 CGCCCCACCCCGCCTCCCTTGGG - Intergenic
932331660 2:70901375-70901397 CGTCCCGCGCCGTCTCCCCTGGG - Intronic
932570635 2:72936565-72936587 CTCCCCGCCCCGCCCCCCGCAGG - Intergenic
932773226 2:74513288-74513310 CGGCCCGCCCCGGCCCCCGGGGG - Intergenic
932780218 2:74554647-74554669 CGCCCCTCCCCGGCCCCCGCCGG - Exonic
933858446 2:86441503-86441525 CGCGCGGCCCCGTCGCCCGTTGG + Intronic
934518885 2:95007013-95007035 CGCCCCGCCCTGGCTGCAGCAGG - Intergenic
934566986 2:95346618-95346640 CCCCGCGCCCCGGCGCCCGCGGG + Intronic
934567167 2:95347239-95347261 CGCCCCCTCCCGGCTCCGGAGGG + Intronic
934985689 2:98883193-98883215 CACCCCGCCCCTGCTCCCAATGG - Intronic
936433242 2:112482173-112482195 CGCCGCGCCCGGGCGCCCGCCGG - Exonic
938017059 2:127876046-127876068 CGCCCCGCCCCCCCACCCGCTGG + Intronic
939629828 2:144517483-144517505 GGCCCTGGCCCGGCTCCCCTGGG - Intronic
943033817 2:182716249-182716271 GGCCCCGCCCCGGCTCGCCGTGG + Intronic
945080916 2:206085639-206085661 CGCCCCACTCCGGCTCCGGCTGG + Intronic
946250133 2:218406537-218406559 CGCCCCGCCCCGCGTCCGGGAGG + Intergenic
948607203 2:239143746-239143768 AGCCCCTCCCCGGCTTCCCTAGG + Intronic
948645310 2:239400661-239400683 AGCCCCGGCCCGGCGCCCGCGGG - Exonic
948824659 2:240568423-240568445 CGCCCCGCTCGGGCTCCGCTCGG - Intronic
948893131 2:240916556-240916578 CGCCCCCCTCCGGCTCCAGCTGG + Intergenic
949012218 2:241687167-241687189 CGCCCAGCGTCGGCTCTCGTTGG + Intergenic
1169926963 20:10793800-10793822 AGACCCGCCCTGGCTCCCGCCGG + Intergenic
1172252550 20:33490058-33490080 CGCCCCGCCCCGCCCCCGGCTGG - Intronic
1173308581 20:41875286-41875308 CGCCCTGCCCCATCTCCCCTTGG + Intergenic
1175384170 20:58583699-58583721 CGCCCTGCTCCTGCTCCCCTGGG - Intergenic
1176005870 20:62861937-62861959 CGCCCGGCCCCGCCCCACGTCGG + Intergenic
1176201547 20:63863041-63863063 CCCCCCGCCCCGCCCCGCGTCGG - Exonic
1176207231 20:63895533-63895555 CGGCCCGGCCCGGCTCCCGCAGG - Intronic
1177010892 21:15729833-15729855 GGCCCCGCCCCGCCGCCCGGAGG + Intergenic
1180559369 22:16602418-16602440 CCGCCCGCCCGGGCTCCCGTCGG + Intergenic
1180615060 22:17121204-17121226 CGGCGGGCCCCGGCTCCCCTCGG - Exonic
1180995022 22:19961299-19961321 GGCACTGCCCCGGCTTCCGTTGG - Intronic
1181064607 22:20299541-20299563 GGCCCCGCCCCGCCCGCCGTAGG - Intergenic
1181155449 22:20917379-20917401 CGCTGGGCCCCGGCTCCCGGCGG - Intergenic
1182547553 22:31084875-31084897 CGCGCCGGCCCGGCCCCCGCTGG + Intronic
1183190951 22:36321897-36321919 CCCCCCGCCCCACCTCCGGTGGG + Intronic
1183653352 22:39171564-39171586 AGCCCCGGCCCCCCTCCCGTGGG + Intergenic
1183738464 22:39656949-39656971 CTCCCTGCCACGGCTCCCCTGGG - Intronic
1185046828 22:48532792-48532814 GCCCCTGCCCCGGCTCCCATCGG + Intronic
1185272193 22:49934779-49934801 CGCCCCTCCCCGCCTCCCTGGGG + Intergenic
1185273096 22:49937577-49937599 CGCCACGCCCAGGGTCCCCTTGG + Intergenic
1185285139 22:49996727-49996749 CGCCACGCCCAGCCTGCCGTGGG + Exonic
1185291572 22:50030263-50030285 CCCCGCTCCCCGGCTCCCGCCGG + Intronic
1185315759 22:50178470-50178492 CGCCCTGGCCAGGCTCCCGTGGG - Intronic
950518229 3:13480756-13480778 CCCCCCGCCCTGGCTCAGGTTGG + Intronic
950710609 3:14810712-14810734 CGCCCGGCCCCGGCGCGCCTCGG - Intergenic
951898344 3:27632766-27632788 CCCCCCGGGCCGGCTGCCGTCGG - Intergenic
953219870 3:40959844-40959866 CGCCCTGCTTCGGCTCGCGTAGG + Intergenic
954664695 3:52245701-52245723 CCCCCGGCCCCGCCTCCCGCCGG + Intergenic
955228464 3:57079370-57079392 CGCCCGGCTCCGGCGCCCGCGGG - Intergenic
957830058 3:85505027-85505049 CGCGCAGCCCCGGTTCCCGCTGG + Intronic
958949541 3:100401348-100401370 CGCCCCTCCTCGGCTTCAGTAGG - Exonic
962498416 3:135965706-135965728 CGCCCCGCCCAGCCACCCGCAGG - Exonic
964130510 3:153281410-153281432 CGTGCAGCCCCGGCTCCCGCCGG - Intergenic
964569217 3:158094513-158094535 CGCCGCGGCCCGACTCCCGCGGG + Intergenic
965256754 3:166423986-166424008 CGCGCAGCCCCGGTTCCCGCTGG - Intergenic
966787843 3:183636459-183636481 CCGCCCGCCCCGGCTCCCCGGGG - Intronic
968093015 3:195909694-195909716 CGCCCCGCGCCGGCCCCCGCAGG + Intronic
968405461 4:336638-336660 CACCCGGACCCGGCTGCCGTCGG - Intergenic
968500267 4:946725-946747 CACCCAGCCCCGGCTCCCACAGG + Intronic
968702944 4:2065305-2065327 CGCCCTGCCCCTCCTCCCGGAGG - Exonic
968879888 4:3293299-3293321 CGCCCCGCCCCGCCCCGCGCCGG - Intronic
969506354 4:7590502-7590524 CGTCCCAGCCCGGCTCCCGAGGG - Intronic
970407674 4:15778851-15778873 CGCCCCCCCCCGCCTCCCGCGGG - Intronic
972675776 4:41257814-41257836 CGCCCCGCCCCCTCCCCTGTAGG + Intronic
972817215 4:42657254-42657276 CGCCCCGCCCCGCCCCGCTTCGG + Intergenic
976092425 4:81471975-81471997 CGCCCCGCCCCGGCAGGCGCGGG + Intronic
979739524 4:124131780-124131802 CGCCCTGCTTCGGCTCACGTAGG + Intergenic
979857539 4:125652080-125652102 CGTGCAGCCCCGGTTCCCGTCGG + Intergenic
980799728 4:137733746-137733768 CGCGCAGCCCTGGCTCCCGCTGG - Intergenic
983649762 4:170026418-170026440 CGGCCGGCCCAGGCTCCTGTAGG - Intronic
984770534 4:183433184-183433206 CGCGCAGCCCCGGTTCCCGCTGG - Intergenic
984805378 4:183746790-183746812 CGCGCAGCCCCGGTTCCCGCAGG + Intergenic
984857618 4:184208386-184208408 CGCCCCGCTTCGGCTCGCGCAGG - Intronic
985539801 5:482653-482675 GGCCCCGCGCAGGCCCCCGTAGG + Exonic
985783504 5:1882567-1882589 CGCCCCGCCCAGGCCACCGCAGG - Intronic
985803606 5:2022104-2022126 CCTCCCGCCCCGGCTCCCCTTGG + Intergenic
986721552 5:10564226-10564248 CGCCCCGCCCCGCCCCGCCTCGG + Intergenic
987347462 5:16991289-16991311 CGCGCAGCCCCGGTTCCCGCCGG + Intergenic
989207126 5:38821907-38821929 CGCGCAGCCCCAGCTCCCGCCGG - Intergenic
992837409 5:80654607-80654629 CCCCCCGCCCCGGCGCACGCAGG + Exonic
997329993 5:133052834-133052856 TGCCCCGCCCCCACTCACGTGGG - Intronic
997382645 5:133448723-133448745 CCCCCCGCCCCCGCACCCCTGGG - Intronic
999232473 5:150069810-150069832 CCCCCCGCCCCTGCTCCTTTAGG - Intronic
1002093458 5:176817753-176817775 CCCTCTGCCCCGGCTGCCGTGGG - Intronic
1002185850 5:177454584-177454606 TGGCCCGCCTCGGCTCCCCTCGG + Intronic
1002616485 5:180459448-180459470 CACCCCACCCCCACTCCCGTGGG + Intergenic
1002771236 6:292294-292316 TGCCCCTGCCCGGCTCCCGCCGG + Intronic
1003581410 6:7344227-7344249 CGCCCAGCCCCGGTTCCCGCTGG - Intronic
1006083587 6:31581245-31581267 CGGCCCGGCTCGGCTCCCGCAGG - Intronic
1006334036 6:33411178-33411200 TGCCCCTGCCCGGCTCCCGGCGG + Exonic
1006641077 6:35490212-35490234 AGCCCCGCCCCGCCCCCCGCGGG + Intronic
1006813353 6:36835115-36835137 CGCCCCGCCGCGTCTTCCCTGGG + Intronic
1006814321 6:36840045-36840067 GGCCCCGCCCCGGCCCCTGCGGG - Intergenic
1007532360 6:42554239-42554261 CGCGCAGCCCCAGCTCCCGCCGG - Intergenic
1007782497 6:44262662-44262684 AGCCCCGCCTCTGCTCCCCTAGG - Exonic
1010617344 6:78029809-78029831 CGCGCAGCCCCGGTTCCCGCTGG - Intergenic
1011075101 6:83430770-83430792 CGCCCCTCCGCCGCTCCCCTGGG - Intronic
1011246489 6:85325989-85326011 CGCGCAGCCCCGGTTCCCGCTGG - Intergenic
1013106185 6:107028339-107028361 CGCCCCGCCCACGCTCCCGCCGG + Exonic
1014098259 6:117482862-117482884 CGCCCCGCTCCGGCTGCAGGCGG + Exonic
1014272532 6:119349842-119349864 CGCGCCGCCCAGGGTCCCGCGGG + Intergenic
1017665916 6:156720105-156720127 CGCCCCGCACCCGCTCCCCGGGG + Intergenic
1019153403 6:170023658-170023680 CGCCCCACCCGGGGTCCCCTCGG - Intergenic
1019536296 7:1531253-1531275 CGCCCCGCCCCGCCCCCCGCAGG - Intronic
1024691239 7:51805845-51805867 CGCGCAGCCCCGGTTCCCGCTGG - Intergenic
1026674643 7:72418614-72418636 TTCCCCGCCCCGGCTCACATAGG + Intronic
1026893048 7:73993606-73993628 CCCCCCGCCCCGGCAGCCTTTGG - Intergenic
1027001769 7:74658608-74658630 GGCCCCGCCCCCGCGCCGGTTGG - Intronic
1029813930 7:103075033-103075055 CGCACCGCCCCGCCTCGCCTGGG + Exonic
1030102151 7:105956107-105956129 CGCGCCGTCCCGGTTCCCGCCGG + Intronic
1033657163 7:143381808-143381830 CCCCCCACCCCGGCTCCTGCCGG - Intronic
1034469778 7:151248968-151248990 CTCCCCGCGCCGCCTCCCGCGGG - Exonic
1034617873 7:152435401-152435423 CCGCCCGCCCGGGCTCCCGCCGG - Intronic
1035404259 7:158587836-158587858 CGCCCCGGCCCCGCCCCCGGCGG + Intergenic
1036664783 8:10731063-10731085 CCCCCAGCCCCGGCTCCGGCCGG - Intronic
1037305153 8:17497035-17497057 CGCCCCGCCCCCGCCCCGGGTGG + Intergenic
1038150901 8:24941992-24942014 GGCCCCGCCCCGCCTCCCGGTGG + Intergenic
1041792743 8:61714732-61714754 CTCCCCGCCCCTGCTCACTTAGG + Intergenic
1041914490 8:63126119-63126141 CGCTCAGCCCCGGTTCCCGCTGG - Intergenic
1044788645 8:95823648-95823670 CGCGCAGCCCCGGTTCCCGCTGG - Intergenic
1049396366 8:142402989-142403011 CGCCACGCCGCGGCCCCCGCCGG + Intronic
1049537579 8:143189508-143189530 CTCCCCGCCCCCACCCCCGTGGG + Intergenic
1049673171 8:143878544-143878566 CGCCCCGCCCCGCCCCGCGTCGG - Intergenic
1049708293 8:144052661-144052683 CCCCCCGCCCCAGCACCCGTGGG + Intronic
1053027324 9:34740587-34740609 CGCGCAGCCCCGGTTCCCGCTGG + Intergenic
1057716673 9:97501567-97501589 CGCCCCGCCCCGCCCGCCGCCGG - Intronic
1058727487 9:107817803-107817825 CGCGCAGCCCCGGTTCCCGCCGG - Intergenic
1060208949 9:121699000-121699022 CCCCTCGCCCCGGCGCCCGGGGG + Intronic
1060629605 9:125143582-125143604 CGCCTCTCCTCGGCTCCCATTGG + Intergenic
1061045004 9:128160198-128160220 CGCCCCGCCCCGCCCCCAGCCGG - Intergenic
1061609917 9:131739651-131739673 CACCCCGCCCCGGCGCACGGAGG + Intronic
1061859368 9:133460253-133460275 CGCCCCGCCCCGGCGGCCCCAGG + Intronic
1061914231 9:133740990-133741012 CTCCCCGCCACCGCTCCAGTGGG + Intergenic
1062314776 9:135961276-135961298 CGCCCCGCCCCGGCTCCCGTCGG + Exonic
1062475672 9:136725785-136725807 AGCCCCGCCCCCGCCCCCCTGGG + Intergenic
1062478595 9:136741446-136741468 GGTCCCGCCCCTGCTCCCGTGGG + Intronic
1203772005 EBV:54223-54245 CGCCCCGCCCAGGCTGGCCTCGG - Intergenic
1190556904 X:51644919-51644941 CGCCCTGCTTCGGCTCGCGTAGG - Intergenic
1192260614 X:69504264-69504286 CACCCCGCCCCAGCCCCCGCCGG - Intergenic
1194890464 X:99372163-99372185 CTCCCCGCCCCGCCTCCCCGCGG - Intergenic
1196845018 X:119890600-119890622 CGCGCAGCCCCGGTTCCCGCTGG - Intergenic
1197241444 X:124127145-124127167 CCCCCCGCCCCGACGCCCGCTGG + Intronic
1197754447 X:129984129-129984151 GGCCCCGCCCCGCCGCCCGCCGG - Intronic
1198369238 X:135974330-135974352 CGCCCCACCCATCCTCCCGTAGG - Intergenic
1200129005 X:153830922-153830944 CGCCCCTCCCCCGCCGCCGTGGG - Intergenic
1201062019 Y:10054710-10054732 AGCCCCCCCATGGCTCCCGTGGG - Intergenic
1202137137 Y:21677014-21677036 CGCGCAGCCCCGGTTCCCGCTGG + Intergenic